btgzi  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 89
    Name:
    BtgZI
    Description:
    BtgZI 500 units
    Catalog Number:
    r0703l
    Price:
    277
    Size:
    500 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs btgzi
    BtgZI
    BtgZI 500 units
    https://www.bioz.com/result/btgzi/product/New England Biolabs
    Average 89 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    btgzi - by Bioz Stars, 2020-01
    89/100 stars

    Images

    1) Product Images from "Bacillus SEVA siblings: A Golden Gate-based toolbox to create personalized integrative vectors for Bacillus subtilis"

    Article Title: Bacillus SEVA siblings: A Golden Gate-based toolbox to create personalized integrative vectors for Bacillus subtilis

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-14329-5

    Architecture of the MCS-IIS C2. This DNA-sequence is located on the cargo vector between the E. coli ori and the Bacillus antibiotic marker. The recognition sites for five type IIS restriction enzymes (AarI, BtgZI, BbsI, BsaI, BsmBI), each designed to create a 5′ GCGA-overhang are encoded on the DNA stretch. Architecture of all MCS-IIS can be found in Fig. S1 .
    Figure Legend Snippet: Architecture of the MCS-IIS C2. This DNA-sequence is located on the cargo vector between the E. coli ori and the Bacillus antibiotic marker. The recognition sites for five type IIS restriction enzymes (AarI, BtgZI, BbsI, BsaI, BsmBI), each designed to create a 5′ GCGA-overhang are encoded on the DNA stretch. Architecture of all MCS-IIS can be found in Fig. S1 .

    Techniques Used: Sequencing, Plasmid Preparation, Marker

    Related Articles

    Clone Assay:

    Article Title: Mitochondrial type II NADH dehydrogenase of Plasmodium falciparum (PfNDH2) is dispensable in the asexual blood stages
    Article Snippet: The vector, pAIO-Cas9-yDHOD(-), was digested with BtgZI and joined with the annealed oligonucleotide pair by gene assembly (New England Biolabs® , Inc), yielding a pAIO-Cas9-yDHOD(-)-gRNA construct. .. Other gRNA cloning procedures followed our published protocol [ ].

    Article Title: The Exported Chaperone PfHsp70x Is Dispensable for the Plasmodium falciparum Intraerythrocytic Life Cycle
    Article Snippet: .. Briefly, pMK-U6 was digested with BtgZI (New England Biolabs), and annealed oligonucleotides were inserted using In-Fusion HD Cloning kit (Clontech). (iii) pHA-glmS and pHA-M9 were used as donor DNA templates consisting of two homology regions flanking the hemagglutinin (HA) tag and the glmS (or the M9 ) sequences. ..

    Article Title: The Exported Chaperone PfHsp70x Is Dispensable for the Plasmodium falciparum Intraerythrocytic Life Cycle
    Article Snippet: .. Briefly, pL6 was digested with BtgZI (New England Biolabs), and annealed oligonucleotides were inserted using In-Fusion HD cloning kit (Clontech). ..

    Article Title: Effect of transcription terminator usage on the establishment of transgene transcriptional gene silencing
    Article Snippet: BsmBI (ThermoFisher), BsaI and BtgZI (New England BioLabs) and T4 Ligase (Promega) were used. ffLUC and FUS3short were domesticated into pUPD vectors using BsmBI enzyme. p35S, ffLUC, FUS3short and Thsp or T35S in pUPD vectors were assembled into pDBG_2alpha2. .. Positive clones were selected in LB solid media containing Ampicillin (100 µg/ml) (Formedium), Spectinomycin (50 µg/ml) (Sigma) or Kanamycin (50 µg/ml) (Formedium), X-Gal (20 µg/ml) (Duchefa) and IPTG (1 mM) (Anatrace).

    Amplification:

    Article Title: The Exported Chaperone PfHsp70x Is Dispensable for the Plasmodium falciparum Intraerythrocytic Life Cycle
    Article Snippet: For generation of plasmid PfHsp70x-HADB, a 1-kb homologous sequence from the 3′ end of the pfhsp70x gene (not including the stop codon) was amplified by PCR using primers 5′ CACTATAGAACTCGAGGTGAAAAAGCTAAACGTGTATTATCATCATCCGCACAAGC 3′ and 5′ CGTATGGGTACCTAGGATTTACTTCTTCAACGGTTGGTCCATTATTTTGTGC 3′ and inserted into pHADB ( ) using restriction sites XhoI and AvrII (New England Biolabs). .. Briefly, pMK-U6 was digested with BtgZI (New England Biolabs), and annealed oligonucleotides were inserted using In-Fusion HD Cloning kit (Clontech). (iii) pHA-glmS and pHA-M9 were used as donor DNA templates consisting of two homology regions flanking the hemagglutinin (HA) tag and the glmS (or the M9 ) sequences.

    Article Title: The Exported Chaperone PfHsp70x Is Dispensable for the Plasmodium falciparum Intraerythrocytic Life Cycle
    Article Snippet: The C terminus of the pfhsp70x gene was PCR amplified from genomic DNA using primers 5′ taaatctagaattcTGATCAATCATCAGCTGTCAAAGACTTATTATTATTAGATG 3′ and 5′ ttaccgttccatggTTAATTTACTTCTTCAACGGTTGGTCCATTATTTTGTGCTTC 3′ and inserted into pL6 (already containing the C-terminal homology region) using restriction sites NcoI and EcoRI (New England Biolabs). .. Briefly, pL6 was digested with BtgZI (New England Biolabs), and annealed oligonucleotides were inserted using In-Fusion HD cloning kit (Clontech).

    Article Title: Effect of transcription terminator usage on the establishment of transgene transcriptional gene silencing
    Article Snippet: Phusion Hot Start II DNA Polymerase (ThermoFisher) was used for DNA amplification. .. BsmBI (ThermoFisher), BsaI and BtgZI (New England BioLabs) and T4 Ligase (Promega) were used. ffLUC and FUS3short were domesticated into pUPD vectors using BsmBI enzyme. p35S, ffLUC, FUS3short and Thsp or T35S in pUPD vectors were assembled into pDBG_2alpha2.

    Synthesized:

    Article Title: Mitochondrial type II NADH dehydrogenase of Plasmodium falciparum (PfNDH2) is dispensable in the asexual blood stages
    Article Snippet: For each of these sequences, a pair of complementary oligonucleotides (60 or 61 bp) was synthesized and annealed in a mixture of NEB Buffers 2 and 4 by heating to 95°C for 5 minutes, then slowly cooling to room temperature. .. The vector, pAIO-Cas9-yDHOD(-), was digested with BtgZI and joined with the annealed oligonucleotide pair by gene assembly (New England Biolabs® , Inc), yielding a pAIO-Cas9-yDHOD(-)-gRNA construct.

    Construct:

    Article Title: Mitochondrial type II NADH dehydrogenase of Plasmodium falciparum (PfNDH2) is dispensable in the asexual blood stages
    Article Snippet: .. The vector, pAIO-Cas9-yDHOD(-), was digested with BtgZI and joined with the annealed oligonucleotide pair by gene assembly (New England Biolabs® , Inc), yielding a pAIO-Cas9-yDHOD(-)-gRNA construct. .. Other gRNA cloning procedures followed our published protocol [ ].

    Article Title: The Exported Chaperone PfHsp70x Is Dispensable for the Plasmodium falciparum Intraerythrocytic Life Cycle
    Article Snippet: Briefly, pMK-U6 was digested with BtgZI (New England Biolabs), and annealed oligonucleotides were inserted using In-Fusion HD Cloning kit (Clontech). (iii) pHA-glmS and pHA-M9 were used as donor DNA templates consisting of two homology regions flanking the hemagglutinin (HA) tag and the glmS (or the M9 ) sequences. .. PCR constructs were then inserted into a TOPO cloning vector (Thermo Fisher).

    Incubation:

    Article Title: The Exported Chaperone PfHsp70x Is Dispensable for the Plasmodium falciparum Intraerythrocytic Life Cycle
    Article Snippet: Briefly, insert and cut vector were mixed with a T4 DNA polymerase and incubated for 2.5 min at room temperature, followed by 10-min incubation on ice, and then transformed into bacteria. .. Briefly, pMK-U6 was digested with BtgZI (New England Biolabs), and annealed oligonucleotides were inserted using In-Fusion HD Cloning kit (Clontech). (iii) pHA-glmS and pHA-M9 were used as donor DNA templates consisting of two homology regions flanking the hemagglutinin (HA) tag and the glmS (or the M9 ) sequences.

    Luciferase:

    Article Title: Effect of transcription terminator usage on the establishment of transgene transcriptional gene silencing
    Article Snippet: Firefly luciferase was amplified from GB0255 using primers 1678 (5′-GCGCCGTCTCGCTCGAATGGAAGACGCCAAAAACATAAAG-3′)/1679 (5′-GCGCCGTCTCGCTCGCTGCTTACACGGCGATCTTTCCGC-3′). .. BsmBI (ThermoFisher), BsaI and BtgZI (New England BioLabs) and T4 Ligase (Promega) were used. ffLUC and FUS3short were domesticated into pUPD vectors using BsmBI enzyme. p35S, ffLUC, FUS3short and Thsp or T35S in pUPD vectors were assembled into pDBG_2alpha2.

    Activity Assay:

    Article Title: Bacillus SEVA siblings: A Golden Gate-based toolbox to create personalized integrative vectors for Bacillus subtilis
    Article Snippet: BsaI, BbsI, BsmBI and BtgZI were purchased from NEB, AarI from Thermo ScientificTM . .. For all enzymes, 0.5 µl were used per reaction, except for AarI where 1.5 µl were necessary because of its lower activity.

    Expressing:

    Article Title: The Exported Chaperone PfHsp70x Is Dispensable for the Plasmodium falciparum Intraerythrocytic Life Cycle
    Article Snippet: For the generation of the glmS conditional mutants, three plasmids were used. (i) pUF1-Cas9 (from J. J. Lopez-Rubio) was used to drive cas9 expression ( ). (ii) pMK-U6 was used to drive expression of the RNA guide. .. Briefly, pMK-U6 was digested with BtgZI (New England Biolabs), and annealed oligonucleotides were inserted using In-Fusion HD Cloning kit (Clontech). (iii) pHA-glmS and pHA-M9 were used as donor DNA templates consisting of two homology regions flanking the hemagglutinin (HA) tag and the glmS (or the M9 ) sequences.

    Transformation Assay:

    Article Title: The Exported Chaperone PfHsp70x Is Dispensable for the Plasmodium falciparum Intraerythrocytic Life Cycle
    Article Snippet: Briefly, insert and cut vector were mixed with a T4 DNA polymerase and incubated for 2.5 min at room temperature, followed by 10-min incubation on ice, and then transformed into bacteria. .. Briefly, pMK-U6 was digested with BtgZI (New England Biolabs), and annealed oligonucleotides were inserted using In-Fusion HD Cloning kit (Clontech). (iii) pHA-glmS and pHA-M9 were used as donor DNA templates consisting of two homology regions flanking the hemagglutinin (HA) tag and the glmS (or the M9 ) sequences.

    Article Title: Effect of transcription terminator usage on the establishment of transgene transcriptional gene silencing
    Article Snippet: Paragraph title: Generation of transformation plasmids ... BsmBI (ThermoFisher), BsaI and BtgZI (New England BioLabs) and T4 Ligase (Promega) were used. ffLUC and FUS3short were domesticated into pUPD vectors using BsmBI enzyme. p35S, ffLUC, FUS3short and Thsp or T35S in pUPD vectors were assembled into pDBG_2alpha2.

    Derivative Assay:

    Article Title: The Exported Chaperone PfHsp70x Is Dispensable for the Plasmodium falciparum Intraerythrocytic Life Cycle
    Article Snippet: For the generation of pfhsp70x-ko parasites, two plasmids were used: (i) a cas9-expressing plasmid (as described above), and (ii) pL7-PfHsp70x plasmid that is derived from the pL6 plasmid (from J. J. Lopez-Rubio [ ]). pL7-PfHsp70x contained the guide RNA and 800-bp homology regions flanking an hdhfr gene that confers resistance to WR99210. .. Briefly, pL6 was digested with BtgZI (New England Biolabs), and annealed oligonucleotides were inserted using In-Fusion HD cloning kit (Clontech).

    Transfection:

    Article Title: Mitochondrial type II NADH dehydrogenase of Plasmodium falciparum (PfNDH2) is dispensable in the asexual blood stages
    Article Snippet: Maxi prep DNA of 5'3'PfNDH2_pCC1 (Qiagen) was digested with HincII overnight to linearize the vector before transfections. .. The vector, pAIO-Cas9-yDHOD(-), was digested with BtgZI and joined with the annealed oligonucleotide pair by gene assembly (New England Biolabs® , Inc), yielding a pAIO-Cas9-yDHOD(-)-gRNA construct.

    Ligation:

    Article Title: The Exported Chaperone PfHsp70x Is Dispensable for the Plasmodium falciparum Intraerythrocytic Life Cycle
    Article Snippet: The N terminus of the pfhsp70x gene was amplified via PCR from genomic DNA using primers 5′ cggggaggactagtATGAAGACAAAAATTTGTAGTTATATTCATTATATTG 3′ and 5′ acaaaatgcttaagGGAAACATCTTTACCTCCATTTTTTTTTTTAAAATCTTGTAC 3′ (lowercase nucleotides are not part of the pfhsp70x gene but are part of the plasmid used for sequence and ligation independent cloning [SLIC]) and inserted into pL6 using restriction sites AflII and SpeI (New England Biolabs). .. Briefly, pL6 was digested with BtgZI (New England Biolabs), and annealed oligonucleotides were inserted using In-Fusion HD cloning kit (Clontech).

    Atomic Absorption Spectroscopy:

    Article Title: Effect of transcription terminator usage on the establishment of transgene transcriptional gene silencing
    Article Snippet: FUS3short was amplified from Arabidopsis genomic DNA using primers 1668 (5′-GCGCCGTCTCGCTCGGCAGGGAAATGTTCTTACTATTATCCAGTCAT-3′)/1676 (5′-GCGCCGTCTCGCTCGAAGCTTATCCACCCAAAAAATCGAG-3′) to include FUS3 AAs 246–283. .. BsmBI (ThermoFisher), BsaI and BtgZI (New England BioLabs) and T4 Ligase (Promega) were used. ffLUC and FUS3short were domesticated into pUPD vectors using BsmBI enzyme. p35S, ffLUC, FUS3short and Thsp or T35S in pUPD vectors were assembled into pDBG_2alpha2.

    other:

    Article Title: Adaptation of the GoldenBraid modular cloning system and creation of a toolkit for the expression of heterologous proteins in yeast mitochondria
    Article Snippet: Molecular biology enzymes Enzymes used for molecular biology were the following: restriction enzymes BsmBI/Esp3I (Fermentas), BsaI and BtgZI (NEB), T4 DNA ligase (Promega), Phusion DNA Polymerase (Agilent) and KAPA2G (KAPA Biosystems).

    Article Title: Biomolecular computers with multiple restriction enzymes
    Article Snippet: Enzymes The restriction enzymes Acu I, Bae I,Bbv I, Mbo II, Btgz I and T4 DNA ligase were obtained from New England Biolabs (Ipswich, MA, USA).

    Sequencing:

    Article Title: Mitochondrial type II NADH dehydrogenase of Plasmodium falciparum (PfNDH2) is dispensable in the asexual blood stages
    Article Snippet: The sequence between the 5’HR and 3’HR of PfNDH2 (490 bp) was submitted to the gRNA design tool ( http://grna.ctegd.uga.edu/ ) to seek potential gRNAs. .. The vector, pAIO-Cas9-yDHOD(-), was digested with BtgZI and joined with the annealed oligonucleotide pair by gene assembly (New England Biolabs® , Inc), yielding a pAIO-Cas9-yDHOD(-)-gRNA construct.

    Article Title: The Exported Chaperone PfHsp70x Is Dispensable for the Plasmodium falciparum Intraerythrocytic Life Cycle
    Article Snippet: For generation of plasmid PfHsp70x-HADB, a 1-kb homologous sequence from the 3′ end of the pfhsp70x gene (not including the stop codon) was amplified by PCR using primers 5′ CACTATAGAACTCGAGGTGAAAAAGCTAAACGTGTATTATCATCATCCGCACAAGC 3′ and 5′ CGTATGGGTACCTAGGATTTACTTCTTCAACGGTTGGTCCATTATTTTGTGC 3′ and inserted into pHADB ( ) using restriction sites XhoI and AvrII (New England Biolabs). .. Briefly, pMK-U6 was digested with BtgZI (New England Biolabs), and annealed oligonucleotides were inserted using In-Fusion HD Cloning kit (Clontech). (iii) pHA-glmS and pHA-M9 were used as donor DNA templates consisting of two homology regions flanking the hemagglutinin (HA) tag and the glmS (or the M9 ) sequences.

    Article Title: The Exported Chaperone PfHsp70x Is Dispensable for the Plasmodium falciparum Intraerythrocytic Life Cycle
    Article Snippet: In order to insert the guide DNA sequence, oligonucleotides 5′ TAAGTATATAATATTGTACAAGCAGCCATCTTATCGTTTTAGAGCTAGAA 3′ and 5′ TTCTAGCTCTAAAACGATAAGATGGCTGCTTGTACAATATTATATACTTA 3′ were annealed and cloned into pL6 as previously described ( ). .. Briefly, pL6 was digested with BtgZI (New England Biolabs), and annealed oligonucleotides were inserted using In-Fusion HD cloning kit (Clontech).

    Purification:

    Article Title: Characterization of MazF-Mediated Sequence-Specific RNA Cleavage in Pseudomonas putida Using Massive Parallel Sequencing
    Article Snippet: The pMD19 plasmid encoding the graA gene was digested with Hin dIII (New England Biolabs, Ipswich, MA). pUC19 plasmids encoding synthetic RNA (500–2, 1000–1, 1000–2, 1000–3, and 1000–4) and the pUC19 plasmid encoding 1000–5 synthetic RNA were digested with Bbs I and Btg ZI, respectively (New England Biolabs). .. Digested fragments were purified with a PCR purification kit and then in vitro transcription was carried out with MEGAscript T7 Kit (Life Technologies) according to the manufacturer’s instruction.

    Polymerase Chain Reaction:

    Article Title: The Exported Chaperone PfHsp70x Is Dispensable for the Plasmodium falciparum Intraerythrocytic Life Cycle
    Article Snippet: For generation of plasmid PfHsp70x-HADB, a 1-kb homologous sequence from the 3′ end of the pfhsp70x gene (not including the stop codon) was amplified by PCR using primers 5′ CACTATAGAACTCGAGGTGAAAAAGCTAAACGTGTATTATCATCATCCGCACAAGC 3′ and 5′ CGTATGGGTACCTAGGATTTACTTCTTCAACGGTTGGTCCATTATTTTGTGC 3′ and inserted into pHADB ( ) using restriction sites XhoI and AvrII (New England Biolabs). .. Briefly, pMK-U6 was digested with BtgZI (New England Biolabs), and annealed oligonucleotides were inserted using In-Fusion HD Cloning kit (Clontech). (iii) pHA-glmS and pHA-M9 were used as donor DNA templates consisting of two homology regions flanking the hemagglutinin (HA) tag and the glmS (or the M9 ) sequences.

    Article Title: The Exported Chaperone PfHsp70x Is Dispensable for the Plasmodium falciparum Intraerythrocytic Life Cycle
    Article Snippet: The C terminus of the pfhsp70x gene was PCR amplified from genomic DNA using primers 5′ taaatctagaattcTGATCAATCATCAGCTGTCAAAGACTTATTATTATTAGATG 3′ and 5′ ttaccgttccatggTTAATTTACTTCTTCAACGGTTGGTCCATTATTTTGTGCTTC 3′ and inserted into pL6 (already containing the C-terminal homology region) using restriction sites NcoI and EcoRI (New England Biolabs). .. Briefly, pL6 was digested with BtgZI (New England Biolabs), and annealed oligonucleotides were inserted using In-Fusion HD cloning kit (Clontech).

    Article Title: Characterization of MazF-Mediated Sequence-Specific RNA Cleavage in Pseudomonas putida Using Massive Parallel Sequencing
    Article Snippet: The pMD19 plasmid encoding the graA gene was digested with Hin dIII (New England Biolabs, Ipswich, MA). pUC19 plasmids encoding synthetic RNA (500–2, 1000–1, 1000–2, 1000–3, and 1000–4) and the pUC19 plasmid encoding 1000–5 synthetic RNA were digested with Bbs I and Btg ZI, respectively (New England Biolabs). .. Digested fragments were purified with a PCR purification kit and then in vitro transcription was carried out with MEGAscript T7 Kit (Life Technologies) according to the manufacturer’s instruction.

    Plasmid Preparation:

    Article Title: Mitochondrial type II NADH dehydrogenase of Plasmodium falciparum (PfNDH2) is dispensable in the asexual blood stages
    Article Snippet: .. The vector, pAIO-Cas9-yDHOD(-), was digested with BtgZI and joined with the annealed oligonucleotide pair by gene assembly (New England Biolabs® , Inc), yielding a pAIO-Cas9-yDHOD(-)-gRNA construct. .. Other gRNA cloning procedures followed our published protocol [ ].

    Article Title: The Exported Chaperone PfHsp70x Is Dispensable for the Plasmodium falciparum Intraerythrocytic Life Cycle
    Article Snippet: Paragraph title: Plasmid construction. ... Briefly, pMK-U6 was digested with BtgZI (New England Biolabs), and annealed oligonucleotides were inserted using In-Fusion HD Cloning kit (Clontech). (iii) pHA-glmS and pHA-M9 were used as donor DNA templates consisting of two homology regions flanking the hemagglutinin (HA) tag and the glmS (or the M9 ) sequences.

    Article Title: Characterization of MazF-Mediated Sequence-Specific RNA Cleavage in Pseudomonas putida Using Massive Parallel Sequencing
    Article Snippet: .. The pMD19 plasmid encoding the graA gene was digested with Hin dIII (New England Biolabs, Ipswich, MA). pUC19 plasmids encoding synthetic RNA (500–2, 1000–1, 1000–2, 1000–3, and 1000–4) and the pUC19 plasmid encoding 1000–5 synthetic RNA were digested with Bbs I and Btg ZI, respectively (New England Biolabs). .. Digested fragments were purified with a PCR purification kit and then in vitro transcription was carried out with MEGAscript T7 Kit (Life Technologies) according to the manufacturer’s instruction.

    Article Title: Effect of transcription terminator usage on the establishment of transgene transcriptional gene silencing
    Article Snippet: BsmBI (ThermoFisher), BsaI and BtgZI (New England BioLabs) and T4 Ligase (Promega) were used. ffLUC and FUS3short were domesticated into pUPD vectors using BsmBI enzyme. p35S, ffLUC, FUS3short and Thsp or T35S in pUPD vectors were assembled into pDBG_2alpha2. .. These three constructions were assembled with GB0235 into pDGB_2omega1, and again assembled with GB0466, a “twister” plasmid that contains a 150 bp stuffer fragment in order to get the constructions into pDBG_2alpha1 as the final plasmid.

    RNA Expression:

    Article Title: The Exported Chaperone PfHsp70x Is Dispensable for the Plasmodium falciparum Intraerythrocytic Life Cycle
    Article Snippet: For this purpose, pL6 plasmid (from J. J. Lopez-Rubio [ ]) was digested with NotI and NcoI (New England Biolabs), and the fragment that contained the U6 RNA expression cassette was blunted and religated to form the pMK-U6 plasmid. .. Briefly, pMK-U6 was digested with BtgZI (New England Biolabs), and annealed oligonucleotides were inserted using In-Fusion HD Cloning kit (Clontech). (iii) pHA-glmS and pHA-M9 were used as donor DNA templates consisting of two homology regions flanking the hemagglutinin (HA) tag and the glmS (or the M9 ) sequences.

    In Vitro:

    Article Title: Characterization of MazF-Mediated Sequence-Specific RNA Cleavage in Pseudomonas putida Using Massive Parallel Sequencing
    Article Snippet: The pMD19 plasmid encoding the graA gene was digested with Hin dIII (New England Biolabs, Ipswich, MA). pUC19 plasmids encoding synthetic RNA (500–2, 1000–1, 1000–2, 1000–3, and 1000–4) and the pUC19 plasmid encoding 1000–5 synthetic RNA were digested with Bbs I and Btg ZI, respectively (New England Biolabs). .. Digested fragments were purified with a PCR purification kit and then in vitro transcription was carried out with MEGAscript T7 Kit (Life Technologies) according to the manufacturer’s instruction.

    Knock-Out:

    Article Title: Mitochondrial type II NADH dehydrogenase of Plasmodium falciparum (PfNDH2) is dispensable in the asexual blood stages
    Article Snippet: The vector, pAIO-Cas9-yDHOD(-), was digested with BtgZI and joined with the annealed oligonucleotide pair by gene assembly (New England Biolabs® , Inc), yielding a pAIO-Cas9-yDHOD(-)-gRNA construct. .. P1 (Remove yDHOD-F), 5’- ATACCTAATAGAAATATATCAGGATCCAAAAATGGACAAGAAGTACAGCATCG; P2 (Remove yDHOD-R), 5’- CCATCTCGTTGCTGAAGATC; P3 (Remove yDHOD-chk), 5’- GTATATTTTAAACTAGAAAAGGAATAAC; P4 (knockout-5fF), 5’- gaccatggatatcaaaaaataatgcagtaaaatgc; P5 (knockout-5fR), 5’- ccgaattCTGAACCTAGGATTATAATCTTTTCTTTTC; P6 (knockout-3fF), 5’- ctactaGTGTCGAAGTTACCGCAGAATTTG; P7 (knockout-3fR), 5’- aaccgcgGTCTTAATAAAATCGATGAAAAAATGGAACC; P8 (gRNA1-F), 5’- CATATTAAGTATATAATATTgAATGTACCACTACATAAACAGTTTTAGAGCTAGAAATAGC; P9 (gRNA1-R), 5’- GCTATTTCTAGCTCTAAAACTGTTTATGTAGTGGTACATTcAATATTATATACTTAATATG; P10 (gRNA2-F), 5’- CATATTAAGTATATAATATTgCATGTAGCTGTTGTAGGAGGGTTTTAGAGCTAGAAATAGC; P11 (gRNA2-R), 5’- GCTATTTCTAGCTCTAAAACCCTCCTACAACAGCTACATGcAATATTATATACTTAATATG; P12 (gRNA3-F), 5’- CATATTAAGTATATAATATTgTTATTTAATTATAGCTGTAGGTTTTAGAGCTAGAAATAGC; P13 (gRNA3-R), 5’- GCTATTTCTAGCTCTAAAACCTACAGCTATAATTAAATAAcAATATTATATACTTAATATG; P14 (gRNA1-N20), 5’- AATGTACCACTACATAAACA; P15 (gRNA2-N20), 5’- CATGTAGCTGTTGTAGGAGG; P16 (gRNA3-N20), 5’- TTATTTAATTATAGCTGTAG; P17 (N20CheckR), 5’- ATATGAATTACAAATATTGCATAAAGA; P18 (5fchk), 5’- GAACTATACATCTATAAAGCATTAC; P19 (3fchk), 5’- GAAAAAAGAAGCACATATATATATAT; P20 (hDHFR-F), 5’- ATGCATGGTTCGCTAAACTGCATC; P21 (hDHFR-R), 5’-ATCATTCTTCTCATATACTTCAAATTTGTAC.

    Concentration Assay:

    Article Title: Characterization of MazF-Mediated Sequence-Specific RNA Cleavage in Pseudomonas putida Using Massive Parallel Sequencing
    Article Snippet: The pMD19 plasmid encoding the graA gene was digested with Hin dIII (New England Biolabs, Ipswich, MA). pUC19 plasmids encoding synthetic RNA (500–2, 1000–1, 1000–2, 1000–3, and 1000–4) and the pUC19 plasmid encoding 1000–5 synthetic RNA were digested with Bbs I and Btg ZI, respectively (New England Biolabs). .. Transcribed RNAs were purified with RNA Clean & Concentrator™-5 (Zymo Research, Orange, CA, USA) and their concentration was determined using Qubit RNA Assay Kit (Life Technologies).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 89
    New England Biolabs btgz i
    Btgz I, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 89/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/btgz i/product/New England Biolabs
    Average 89 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    btgz i - by Bioz Stars, 2020-01
    89/100 stars
      Buy from Supplier

    Image Search Results