i sce i  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    I SceI
    Description:
    I SceI 2 500 units
    Catalog Number:
    r0694l
    Price:
    290
    Size:
    2 500 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs i sce i
    I SceI
    I SceI 2 500 units
    https://www.bioz.com/result/i sce i/product/New England Biolabs
    Average 95 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    i sce i - by Bioz Stars, 2020-02
    95/100 stars

    Images

    1) Product Images from "The Tumor-Associated Variant RAD51 G151D Induces a Hyper-Recombination Phenotype"

    Article Title: The Tumor-Associated Variant RAD51 G151D Induces a Hyper-Recombination Phenotype

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1006208

    Enhanced HDR of chromosomal DSBs in cell lines expressing RAD51 G151D. A. RAD51 WT and G151D were stably expressed in MCF7 cells harboring the I- Sce I reporter construct using the pRVY TET-OFF inducible expression vector. The addition of doxycycline to the media turns off exogenous RAD51 expression (repressed, abbreviated R; endogenous RAD51 protein levels only), with expression induced upon removal of DOX (induced, abbreviated I; endogenous levels + exogenous protein levels). Western blot with an antisera raised against RAD51 protein demonstrates equivalent expression of exogenous WT and G151D (I) in their respective MCF-7 DR-GFP pools (RAD51/tubulin), as well as the fold increase in expression over endogenous RAD51 (I/R). B. The percentage of GFP positive cells was measured by flow cytometry 72hrs after nucleofection with an I- Sce I expression vector. The percentage of GFP-positive cells from MCF-7 DR-GFP parental cells was normalized to 1 and the relative change of percent GFP-positive cells from MCF-7 DR-GFP RAD51 WT and G151D cells was calculated. Data are graphed as mean ± SD from 3 independent experiments ** p
    Figure Legend Snippet: Enhanced HDR of chromosomal DSBs in cell lines expressing RAD51 G151D. A. RAD51 WT and G151D were stably expressed in MCF7 cells harboring the I- Sce I reporter construct using the pRVY TET-OFF inducible expression vector. The addition of doxycycline to the media turns off exogenous RAD51 expression (repressed, abbreviated R; endogenous RAD51 protein levels only), with expression induced upon removal of DOX (induced, abbreviated I; endogenous levels + exogenous protein levels). Western blot with an antisera raised against RAD51 protein demonstrates equivalent expression of exogenous WT and G151D (I) in their respective MCF-7 DR-GFP pools (RAD51/tubulin), as well as the fold increase in expression over endogenous RAD51 (I/R). B. The percentage of GFP positive cells was measured by flow cytometry 72hrs after nucleofection with an I- Sce I expression vector. The percentage of GFP-positive cells from MCF-7 DR-GFP parental cells was normalized to 1 and the relative change of percent GFP-positive cells from MCF-7 DR-GFP RAD51 WT and G151D cells was calculated. Data are graphed as mean ± SD from 3 independent experiments ** p

    Techniques Used: Expressing, Stable Transfection, Construct, Plasmid Preparation, Western Blot, Flow Cytometry, Cytometry

    2) Product Images from "Protocols for yTREX/Tn5‐based gene cluster expression in Pseudomonas putida"

    Article Title: Protocols for yTREX/Tn5‐based gene cluster expression in Pseudomonas putida

    Journal: Microbial Biotechnology

    doi: 10.1111/1751-7915.13402

    Schematic of the gene cluster assembly in the yTREX vector. A. The yTREX vector backbone comprises replication elements and selection markers for E. coli (ori, pMB 1 origin of replication; Km R , kanamycin resistance gene) and yeast ( CEN 4 / ARS 1 , S. cerevisiae centromere region and autonomously replicating sequence; URA 3 , orotidine 5′‐phosphate decarboxylase gene) and the yTREX cassettes. L‐ yTREX (orange): oriT, origin of transfer; OE , outside end of transposon Tn5; P T 7 , T7 bacteriophage promoter, R‐ yTREX (green): tnp , Tn5 transposase gene; OE ; Tc R , tetracycline resistance gene; P T 7 . The vector is linearized by hydrolysis with restriction endonuclease I‐ Sce I, thereby exposing the partial I‐ Sce I recognition site and the sequences of the CIS (cluster integration site) at the termini. At the respective CIS 1 and CIS 2 sequences, insert fragments with appropriate homology arms to the CIS sequences and to one another can be integrated via yeast recombineering. Depiction is not drawn to scale. The complete vector sequence is available at the NCBI database (GenBank MK416190) and in the Table S1 in GenBank format. Right panel: Creation of homologous regions for recombination can generally be achieved by PCR and appropriate positioning of fully binding primers. Accordingly, designed primers can be used to re‐assemble large gene clusters in their native organization from freely defined PCR fragments (B). Alternatively, the use of primers with 5′‐elongations adding sequences to match new adjacent fragments enables re‐arrangements of genes or the addition of new parts (C). In this case, primer positions are defined by the ends of the fragments that are to be connected. Find further information under section Generation of gene cluster DNA fragments yeast assembly cloning in the yTREX vector , step 3b.
    Figure Legend Snippet: Schematic of the gene cluster assembly in the yTREX vector. A. The yTREX vector backbone comprises replication elements and selection markers for E. coli (ori, pMB 1 origin of replication; Km R , kanamycin resistance gene) and yeast ( CEN 4 / ARS 1 , S. cerevisiae centromere region and autonomously replicating sequence; URA 3 , orotidine 5′‐phosphate decarboxylase gene) and the yTREX cassettes. L‐ yTREX (orange): oriT, origin of transfer; OE , outside end of transposon Tn5; P T 7 , T7 bacteriophage promoter, R‐ yTREX (green): tnp , Tn5 transposase gene; OE ; Tc R , tetracycline resistance gene; P T 7 . The vector is linearized by hydrolysis with restriction endonuclease I‐ Sce I, thereby exposing the partial I‐ Sce I recognition site and the sequences of the CIS (cluster integration site) at the termini. At the respective CIS 1 and CIS 2 sequences, insert fragments with appropriate homology arms to the CIS sequences and to one another can be integrated via yeast recombineering. Depiction is not drawn to scale. The complete vector sequence is available at the NCBI database (GenBank MK416190) and in the Table S1 in GenBank format. Right panel: Creation of homologous regions for recombination can generally be achieved by PCR and appropriate positioning of fully binding primers. Accordingly, designed primers can be used to re‐assemble large gene clusters in their native organization from freely defined PCR fragments (B). Alternatively, the use of primers with 5′‐elongations adding sequences to match new adjacent fragments enables re‐arrangements of genes or the addition of new parts (C). In this case, primer positions are defined by the ends of the fragments that are to be connected. Find further information under section Generation of gene cluster DNA fragments yeast assembly cloning in the yTREX vector , step 3b.

    Techniques Used: Plasmid Preparation, Selection, Sequencing, Polymerase Chain Reaction, Binding Assay, Clone Assay

    3) Product Images from "Precise Editing of the Zebrafish Genome Made Simple and Efficient"

    Article Title: Precise Editing of the Zebrafish Genome Made Simple and Efficient

    Journal: Developmental cell

    doi: 10.1016/j.devcel.2016.02.015

    Reporter knock-in/knock-out alleles at the kcnh6a locus (A) Schematic representation of the genomic structure of the kcnh6a gene, indicating the kcnh6a-int1 TALEN target, and the structures of the donor DNAs (composed in pKH4 vector), highlighting the reporter coding sequences (colored) and translation/transcription termination signal sequences (grey) that are introduced by the donor. Left and right homology arms are bordered by I-Sce I recognition sites in head-to-head orientation (red arrows). Diagnostic primers are depicted: the rP1/kR1 pair specifically amplifies edited alleles, whereas the kF3/kR1 pair amplifies edited and unedited forms of the kcnh6a gene. (B) In vivo I-Sce I-digestion of donor plasmids stimulates genome editing. Individual embryos were injected with kcnh6a (eGFP) or kcnh6a (mCherry) donor DNAs with or without the I-Sce I meganuclease. Edited alleles were detected by PCR with diagnostic primers. (C) Genome editing is enhanced following I-Sce I digestion of donor plasmids, performed either in vivo or in vitro , prior to injection. Zygotes were injected with TALEN RNA and donor plasmid DNA mixed with differing amounts of I-Sce I enzyme on ice until injection (no pre-digestion) or digested in vitro prior to injection (pre-digestion). As a control, in vitro -digested donor plasmid was injected alone. The fraction of edited alleles (detected with the rP1/kR1 primer pair) relative to total kcnh6a alleles (detected with the kF3/kR1 primer pair) present in injected 2 dpf embryos was determined by qPCR. The relative recombination efficiency was determined by normalizing to 1.0 the mean fraction of edited alleles following injection of TALEN RNA and undigested donor plasmid DNA. For each condition, six individual embryos were analyzed (circles) and the mean relative recombination efficiency is indicated (horizontal dash). Unpaired t-test analysis indicated that in vivo or in vitro digestion of donor DNA with 1mU enzyme significantly stimulated the production of edited alleles as compared with untreated donor DNA (p
    Figure Legend Snippet: Reporter knock-in/knock-out alleles at the kcnh6a locus (A) Schematic representation of the genomic structure of the kcnh6a gene, indicating the kcnh6a-int1 TALEN target, and the structures of the donor DNAs (composed in pKH4 vector), highlighting the reporter coding sequences (colored) and translation/transcription termination signal sequences (grey) that are introduced by the donor. Left and right homology arms are bordered by I-Sce I recognition sites in head-to-head orientation (red arrows). Diagnostic primers are depicted: the rP1/kR1 pair specifically amplifies edited alleles, whereas the kF3/kR1 pair amplifies edited and unedited forms of the kcnh6a gene. (B) In vivo I-Sce I-digestion of donor plasmids stimulates genome editing. Individual embryos were injected with kcnh6a (eGFP) or kcnh6a (mCherry) donor DNAs with or without the I-Sce I meganuclease. Edited alleles were detected by PCR with diagnostic primers. (C) Genome editing is enhanced following I-Sce I digestion of donor plasmids, performed either in vivo or in vitro , prior to injection. Zygotes were injected with TALEN RNA and donor plasmid DNA mixed with differing amounts of I-Sce I enzyme on ice until injection (no pre-digestion) or digested in vitro prior to injection (pre-digestion). As a control, in vitro -digested donor plasmid was injected alone. The fraction of edited alleles (detected with the rP1/kR1 primer pair) relative to total kcnh6a alleles (detected with the kF3/kR1 primer pair) present in injected 2 dpf embryos was determined by qPCR. The relative recombination efficiency was determined by normalizing to 1.0 the mean fraction of edited alleles following injection of TALEN RNA and undigested donor plasmid DNA. For each condition, six individual embryos were analyzed (circles) and the mean relative recombination efficiency is indicated (horizontal dash). Unpaired t-test analysis indicated that in vivo or in vitro digestion of donor DNA with 1mU enzyme significantly stimulated the production of edited alleles as compared with untreated donor DNA (p

    Techniques Used: Knock-In, Knock-Out, Plasmid Preparation, Diagnostic Assay, In Vivo, Injection, Polymerase Chain Reaction, In Vitro, Real-time Polymerase Chain Reaction

    4) Product Images from "Turning the fate of reprogramming cells from retinal disorder to regeneration by Pax6 in newts"

    Article Title: Turning the fate of reprogramming cells from retinal disorder to regeneration by Pax6 in newts

    Journal: Scientific Reports

    doi: 10.1038/srep33761

    Retinal regeneration in control condition. ( a ) Time schedule of experiments. One-cell stage embryos were microinjected with a solution containing both a Cre driver construct (RPE65 > CreER T2 -CAGGs > YFP) and a loxP reporter/shRNA construct (CAGGs > [AmCyan]mCherry-shRNA). On the sixth day after injection, blastula embryos (St. 10) that uniformly expressed intense fluorescence of both YFP and AmCyan were screened. Swimming larvae at St. 58–59 (~4 months old) were incubated in a rearing solution containing 4 μM (Z)-4-Hydroxytamoxifen (4-OHT) for 48 h. Juvenile newts around 7 months old (1–2 months after metamorphosis) were subjected to surgical removal of both the lens and the neural retina under anesthesia and then allowed to recover for the study of retinal regeneration. ( b,c ) Representative of regenerated retinas at Stage L-2 (n = 4). mCherry fluorescence was observed in the central retina (box). The image is enlarged in ( c ). mCherry fluorescence was localized in both RPE cells and cells in the regenerated NR. In the regenerated NR, the mCherry+ cells composed a column structure similar to those observed in embryonic retinal development 7 8 9 . The column structure was comprised of all kinds of retinal neurons and glia. Interestingly, as in retinal development 9 , cell bodies of the horizontal cells were located distant from the body of the column. Note that in mCherry+ NR cells fluorescence of AmCyan was decreased (Cyan), indicating that Cre-mediated recombination successfully took place in parental RPE cells. Br: brain; ONL: outer nuclear layer; OPL: outer plexiform layer; INL: inner nuclear layer; IPL: inner plexiform layer; GCL: ganglion cell layer. Scale bars: 100 μm. ( d–f ) Contribution of the endogenous retinal stem/progenitor cells in the CMZ during retinal regeneration. Nuclei were counterstained with DAPI. Regenerating NR originating from the CMZ (arrow heads) had covered a large area of the RPE before the central RPE cells reached Stage E1 (right-hand box) to E2 (left-hand box) (n = 7). The images in these boxes are enlarged in ( e , f ) respectively. Dotted line in ( e ) shows Bruch’s membrane and that in ( f ) shows the outer margin of the regenerating NR. The arrow in ( f ) indicates a junction (called the Splayed-joint 1 ) between the CMZ-originating (non-pigmented; left-hand) and RPE-originating regenerating NR (partially pigmented; right-hand). Scale bars: 100 μm. ( g ) Summary of results.
    Figure Legend Snippet: Retinal regeneration in control condition. ( a ) Time schedule of experiments. One-cell stage embryos were microinjected with a solution containing both a Cre driver construct (RPE65 > CreER T2 -CAGGs > YFP) and a loxP reporter/shRNA construct (CAGGs > [AmCyan]mCherry-shRNA). On the sixth day after injection, blastula embryos (St. 10) that uniformly expressed intense fluorescence of both YFP and AmCyan were screened. Swimming larvae at St. 58–59 (~4 months old) were incubated in a rearing solution containing 4 μM (Z)-4-Hydroxytamoxifen (4-OHT) for 48 h. Juvenile newts around 7 months old (1–2 months after metamorphosis) were subjected to surgical removal of both the lens and the neural retina under anesthesia and then allowed to recover for the study of retinal regeneration. ( b,c ) Representative of regenerated retinas at Stage L-2 (n = 4). mCherry fluorescence was observed in the central retina (box). The image is enlarged in ( c ). mCherry fluorescence was localized in both RPE cells and cells in the regenerated NR. In the regenerated NR, the mCherry+ cells composed a column structure similar to those observed in embryonic retinal development 7 8 9 . The column structure was comprised of all kinds of retinal neurons and glia. Interestingly, as in retinal development 9 , cell bodies of the horizontal cells were located distant from the body of the column. Note that in mCherry+ NR cells fluorescence of AmCyan was decreased (Cyan), indicating that Cre-mediated recombination successfully took place in parental RPE cells. Br: brain; ONL: outer nuclear layer; OPL: outer plexiform layer; INL: inner nuclear layer; IPL: inner plexiform layer; GCL: ganglion cell layer. Scale bars: 100 μm. ( d–f ) Contribution of the endogenous retinal stem/progenitor cells in the CMZ during retinal regeneration. Nuclei were counterstained with DAPI. Regenerating NR originating from the CMZ (arrow heads) had covered a large area of the RPE before the central RPE cells reached Stage E1 (right-hand box) to E2 (left-hand box) (n = 7). The images in these boxes are enlarged in ( e , f ) respectively. Dotted line in ( e ) shows Bruch’s membrane and that in ( f ) shows the outer margin of the regenerating NR. The arrow in ( f ) indicates a junction (called the Splayed-joint 1 ) between the CMZ-originating (non-pigmented; left-hand) and RPE-originating regenerating NR (partially pigmented; right-hand). Scale bars: 100 μm. ( g ) Summary of results.

    Techniques Used: Construct, shRNA, Injection, Fluorescence, Incubation

    5) Product Images from "RAG1/2 induces genomic insertions by mobilizing DNA into RAG1/2-independent breaks"

    Article Title: RAG1/2 induces genomic insertions by mobilizing DNA into RAG1/2-independent breaks

    Journal: The Journal of Experimental Medicine

    doi: 10.1084/jem.20161638

    RAG1/2 mobilizes DNA from antibody gene segments into RAG1/2-independent DNA breaks. (A–C) Cartoon diagram to illustrate the pathways leading to insertion of RAG1/2-mobilized DNA into I-SceI breaks. Aberrant RAG1/2-mediated DNA excision at Vκ1-110 (A), Vκ3-1 (B), and Jκ1/2 (C) generates signal-end, coding-end, and hybrid-end insertions, respectively. Boxes represent Ig segments (gray) or Myc I (black), triangles indicate RSSs (green) or cRSSs (purple), red lightning points to RAG1/2 cleavage sites, and brown ellipses represent the post-cleavage complex. From top to bottom: first, RAG1/2 induces DNA breaks at paired RSSs/cRSSs. Second, DNA is aberrantly excised, and cleaved ends remain bound to the post-cleavage complex to support their repair by the NHEJ machinery. Third, excised DNA is either circularized and released from the post-cleavage complex as episomal joint (right arrow) or it escapes before end joining as linear fragment (left arrow). For signal-end insertions (A), linear DNA fragments might also originate from recleavage of episomal signal joints by RAG1/2 (dashed arrow). For coding-end and hybrid-end insertions (B and C), recleavage of episomal joints is unlikely because of the absence of paired RSSs (crossed arrows). Finally, mobilized linear DNA fragments reinsert into the genome at the I-SceI break.
    Figure Legend Snippet: RAG1/2 mobilizes DNA from antibody gene segments into RAG1/2-independent DNA breaks. (A–C) Cartoon diagram to illustrate the pathways leading to insertion of RAG1/2-mobilized DNA into I-SceI breaks. Aberrant RAG1/2-mediated DNA excision at Vκ1-110 (A), Vκ3-1 (B), and Jκ1/2 (C) generates signal-end, coding-end, and hybrid-end insertions, respectively. Boxes represent Ig segments (gray) or Myc I (black), triangles indicate RSSs (green) or cRSSs (purple), red lightning points to RAG1/2 cleavage sites, and brown ellipses represent the post-cleavage complex. From top to bottom: first, RAG1/2 induces DNA breaks at paired RSSs/cRSSs. Second, DNA is aberrantly excised, and cleaved ends remain bound to the post-cleavage complex to support their repair by the NHEJ machinery. Third, excised DNA is either circularized and released from the post-cleavage complex as episomal joint (right arrow) or it escapes before end joining as linear fragment (left arrow). For signal-end insertions (A), linear DNA fragments might also originate from recleavage of episomal signal joints by RAG1/2 (dashed arrow). For coding-end and hybrid-end insertions (B and C), recleavage of episomal joints is unlikely because of the absence of paired RSSs (crossed arrows). Finally, mobilized linear DNA fragments reinsert into the genome at the I-SceI break.

    Techniques Used: Non-Homologous End Joining

    Rearrangements between I-SceI and RAG1/2 core -induced DNA breaks at Igκ . (A) Overview of rearrangement breakpoints at the Igκ locus on chromosome 6. Histogram of the number of breakpoints in the presence or absence of RAG2 core (red and black, respectively) in 10-kb intervals. RAG1/2 core -dependent rearrangement breakpoint clusters are indicated by red triangles and labeled with the corresponding Jκ or Vκ gene segment. Asterisks mark breakpoint clusters with biased rearrangements (see B–D). Chromosome coordinates and scale bar are indicated on top. (B–D) Examples of RAG1/2 core -dependent breakpoint clusters at Jκs and Vκs. On top is a diagram of the region, with gray boxes representing Ig segments, triangles indicating 12/23RSSs (green) or cRSSs (purple), and red bars indicating the breakpoint clusters. In the middle is a histogram showing the number and position of breakpoints (Bp, red). At the bottom, each horizontal line indicates a unique rearrangement (Rx), with its breakpoint represented by the vertical line and its sheared end (which determines the uniqueness of the event) shown by the box. Color coding indicates whether rearrangements contain RSSs/cRSSs (green/purple, signal ends) or not (gray, coding ends). Rearrangements in black are undefined. Chromosome coordinates and scale bar are indicated on top. Data analysis was performed with pooled RAG2 core and RAG2 −/− TC-Seq libraries (two independent experiments each). See also Fig. S2 (A–C) and Tables S1 and S2.
    Figure Legend Snippet: Rearrangements between I-SceI and RAG1/2 core -induced DNA breaks at Igκ . (A) Overview of rearrangement breakpoints at the Igκ locus on chromosome 6. Histogram of the number of breakpoints in the presence or absence of RAG2 core (red and black, respectively) in 10-kb intervals. RAG1/2 core -dependent rearrangement breakpoint clusters are indicated by red triangles and labeled with the corresponding Jκ or Vκ gene segment. Asterisks mark breakpoint clusters with biased rearrangements (see B–D). Chromosome coordinates and scale bar are indicated on top. (B–D) Examples of RAG1/2 core -dependent breakpoint clusters at Jκs and Vκs. On top is a diagram of the region, with gray boxes representing Ig segments, triangles indicating 12/23RSSs (green) or cRSSs (purple), and red bars indicating the breakpoint clusters. In the middle is a histogram showing the number and position of breakpoints (Bp, red). At the bottom, each horizontal line indicates a unique rearrangement (Rx), with its breakpoint represented by the vertical line and its sheared end (which determines the uniqueness of the event) shown by the box. Color coding indicates whether rearrangements contain RSSs/cRSSs (green/purple, signal ends) or not (gray, coding ends). Rearrangements in black are undefined. Chromosome coordinates and scale bar are indicated on top. Data analysis was performed with pooled RAG2 core and RAG2 −/− TC-Seq libraries (two independent experiments each). See also Fig. S2 (A–C) and Tables S1 and S2.

    Techniques Used: Labeling

    Insertions of RAG1/2 core -mobilized DNA into the I-SceI site. (A) Overview of insertions originating from the Igκ locus on chromosome 6. Histogram of the number of insertions derived from each site in the presence or absence of RAG2 core (blue and black, respectively) in 10-kb intervals. RAG1/2 core -dependent rearrangement breakpoint clusters at Jκs and Vκs (triangles, same as in Fig. 2 A ) are color coded to indicate whether insertions from these sites are detected (blue) or not (red). Asterisks mark breakpoint clusters with biased rearrangements (see Fig. 2 [B–D] ). No insertions from Igκ were detected in RAG2 −/− cells. Chromosome coordinates and scale bar are indicated on top. (B–D) Examples of insertions derived from RAG1/2 core -dependent breakpoint clusters at Jκs and Vκs. On top is a diagram of the region, with gray boxes representing Ig segments, triangles indicating 12/23RSSs (green) or cRSSs (purple), and red bars indicating the breakpoint clusters (same as in Fig. 2 [B–D] ). In the middle is a histogram showing the number and position of breakpoints (Bp, red). At the bottom, each horizontal line indicates a unique insertion (Ins), with its breakpoints represented by the vertical lines at the ends. Arrows represent insertions for which only one of the two breakpoints could be identified. Chromosome coordinates and scale bar are indicated on top. Data analysis was performed with pooled RAG2 core and RAG2 −/− TC-Seq libraries (two independent experiments each). See also Table S3.
    Figure Legend Snippet: Insertions of RAG1/2 core -mobilized DNA into the I-SceI site. (A) Overview of insertions originating from the Igκ locus on chromosome 6. Histogram of the number of insertions derived from each site in the presence or absence of RAG2 core (blue and black, respectively) in 10-kb intervals. RAG1/2 core -dependent rearrangement breakpoint clusters at Jκs and Vκs (triangles, same as in Fig. 2 A ) are color coded to indicate whether insertions from these sites are detected (blue) or not (red). Asterisks mark breakpoint clusters with biased rearrangements (see Fig. 2 [B–D] ). No insertions from Igκ were detected in RAG2 −/− cells. Chromosome coordinates and scale bar are indicated on top. (B–D) Examples of insertions derived from RAG1/2 core -dependent breakpoint clusters at Jκs and Vκs. On top is a diagram of the region, with gray boxes representing Ig segments, triangles indicating 12/23RSSs (green) or cRSSs (purple), and red bars indicating the breakpoint clusters (same as in Fig. 2 [B–D] ). In the middle is a histogram showing the number and position of breakpoints (Bp, red). At the bottom, each horizontal line indicates a unique insertion (Ins), with its breakpoints represented by the vertical lines at the ends. Arrows represent insertions for which only one of the two breakpoints could be identified. Chromosome coordinates and scale bar are indicated on top. Data analysis was performed with pooled RAG2 core and RAG2 −/− TC-Seq libraries (two independent experiments each). See also Table S3.

    Techniques Used: Derivative Assay

    Landscape of insertions in primary pro–B cells by TC-Seq. (A) Cartoon diagram comparing RAG1/2 core -induced translocations and insertions. In a translocation (red), RAG1/2 core introduces a single DNA break (red lightning) that recombines with the cleaved I-SceI site at Myc I (black lightning) on chromosome 15. The resulting translocation contains Myc I only on one side. In an insertion (blue), RAG1/2 core causes tandem DNA breaks (blue lightning), thereby excising a DNA fragment that subsequently reintegrates into the cleaved I-SceI site. The resulting insertion is flanked by Myc I on both sides. (B) Origin of insertions by chromosome. Events were normalized per megabase to account for different chromosome sizes. (C) Profile of insertions near the I-SceI site in 5-kb intervals. Dashed lines indicate the ±20-kb region excluded from the analysis for D–F because of saturation. (D) Proportion of insertions from genic regions. (E) Frequency of insertions derived from differentially transcribed genes compared with a random model (dashed line). Asterisks indicate values significantly different from random (P
    Figure Legend Snippet: Landscape of insertions in primary pro–B cells by TC-Seq. (A) Cartoon diagram comparing RAG1/2 core -induced translocations and insertions. In a translocation (red), RAG1/2 core introduces a single DNA break (red lightning) that recombines with the cleaved I-SceI site at Myc I (black lightning) on chromosome 15. The resulting translocation contains Myc I only on one side. In an insertion (blue), RAG1/2 core causes tandem DNA breaks (blue lightning), thereby excising a DNA fragment that subsequently reintegrates into the cleaved I-SceI site. The resulting insertion is flanked by Myc I on both sides. (B) Origin of insertions by chromosome. Events were normalized per megabase to account for different chromosome sizes. (C) Profile of insertions near the I-SceI site in 5-kb intervals. Dashed lines indicate the ±20-kb region excluded from the analysis for D–F because of saturation. (D) Proportion of insertions from genic regions. (E) Frequency of insertions derived from differentially transcribed genes compared with a random model (dashed line). Asterisks indicate values significantly different from random (P

    Techniques Used: Translocation Assay, Derivative Assay

    Landscape of chromosomal rearrangements in primary pro–B cells by TC-Seq. (A) Detection of RAG1/2 core -induced chromosomal rearrangements by TC-Seq. Primary RAG2 −/− Myc I/I pro–B cells were infected ex vivo with retroviruses that express either I-SceI alone (RAG2 −/− TC-Seq libraries) or I-SceI together with murine RAG2 core (RAG2 core TC-Seq libraries) by using a “self-cleaving” P2A peptide. DNA breaks, such as those induced by RAG1/2 core at Igκ on chromosome 6 (red lightning), rearrange to the I-SceI break at c- myc on chromosome 15 (black lightning) and are subsequently amplified by PCR, deep-sequenced, and analyzed computationally. RAG2 core and RAG2 −/− TC-Seq libraries were prepared in independent duplicates from infected pro–B cells of 180 mice. (B) Chromosomal distribution of rearrangements. Events were normalized per megabase to account for different chromosome sizes. (C) Profile of rearrangements around the I-SceI site in 5-kb intervals. Dashed lines indicate the ±50-kb region excluded from the analysis for D–F because of saturation. (D) Proportion of genic rearrangements. (E) Frequency of rearrangements derived from differentially transcribed genes compared with a random model (dashed line). Asterisks indicate values significantly different from random (P
    Figure Legend Snippet: Landscape of chromosomal rearrangements in primary pro–B cells by TC-Seq. (A) Detection of RAG1/2 core -induced chromosomal rearrangements by TC-Seq. Primary RAG2 −/− Myc I/I pro–B cells were infected ex vivo with retroviruses that express either I-SceI alone (RAG2 −/− TC-Seq libraries) or I-SceI together with murine RAG2 core (RAG2 core TC-Seq libraries) by using a “self-cleaving” P2A peptide. DNA breaks, such as those induced by RAG1/2 core at Igκ on chromosome 6 (red lightning), rearrange to the I-SceI break at c- myc on chromosome 15 (black lightning) and are subsequently amplified by PCR, deep-sequenced, and analyzed computationally. RAG2 core and RAG2 −/− TC-Seq libraries were prepared in independent duplicates from infected pro–B cells of 180 mice. (B) Chromosomal distribution of rearrangements. Events were normalized per megabase to account for different chromosome sizes. (C) Profile of rearrangements around the I-SceI site in 5-kb intervals. Dashed lines indicate the ±50-kb region excluded from the analysis for D–F because of saturation. (D) Proportion of genic rearrangements. (E) Frequency of rearrangements derived from differentially transcribed genes compared with a random model (dashed line). Asterisks indicate values significantly different from random (P

    Techniques Used: Infection, Ex Vivo, Amplification, Polymerase Chain Reaction, Mouse Assay, Derivative Assay

    Insertions at the I-SceI site induced by wild-type RAG1/2. (A) Detection of chromosomal insertions by IC-Seq. Primary ROSA erISCEI Myc I/I Igh I/I (and ROSA erISCEI Myc I/I Igh I/I AID −/− , see Materials and methods) bone marrow B cells were treated ex vivo with tamoxifen to induce I-SceI breaks at c- myc on chromosome 15 (black lightning). Mobilized DNA fragments, such as those excised by endogenous RAG1/2 from Igκ on chromosome 6 (blue lightning), reinsert into the cleaved I-SceI site and are subsequently amplified by PCR, deep-sequenced, and analyzed computationally. Two RAG1/2 wild-type IC-Seq libraries were independently prepared from tamoxifen-treated bone marrow B cells of 12 mice. (B–D) Qualitative comparison of insertions obtained by TC-Seq (RAG1/2 core ) and IC-Seq (RAG1/2 wild type). On top is a diagram of the region, with gray boxes representing Ig segments and triangles indicating 12/23RSSs (green) or cRSSs (purple). Below, insertions detected by TC-Seq (Ins, same as in Fig. 5 [B–D] ) and IC-Seq (IC). Each horizontal line indicates a unique insertion, with its breakpoints represented by the vertical lines at the ends. Arrows represent insertions for which only one of the two breakpoints could be identified. Chromosome coordinates and scale bar are indicated on top. Data analysis was performed with pooled IC-Seq libraries (two independent experiments). See also Table S3.
    Figure Legend Snippet: Insertions at the I-SceI site induced by wild-type RAG1/2. (A) Detection of chromosomal insertions by IC-Seq. Primary ROSA erISCEI Myc I/I Igh I/I (and ROSA erISCEI Myc I/I Igh I/I AID −/− , see Materials and methods) bone marrow B cells were treated ex vivo with tamoxifen to induce I-SceI breaks at c- myc on chromosome 15 (black lightning). Mobilized DNA fragments, such as those excised by endogenous RAG1/2 from Igκ on chromosome 6 (blue lightning), reinsert into the cleaved I-SceI site and are subsequently amplified by PCR, deep-sequenced, and analyzed computationally. Two RAG1/2 wild-type IC-Seq libraries were independently prepared from tamoxifen-treated bone marrow B cells of 12 mice. (B–D) Qualitative comparison of insertions obtained by TC-Seq (RAG1/2 core ) and IC-Seq (RAG1/2 wild type). On top is a diagram of the region, with gray boxes representing Ig segments and triangles indicating 12/23RSSs (green) or cRSSs (purple). Below, insertions detected by TC-Seq (Ins, same as in Fig. 5 [B–D] ) and IC-Seq (IC). Each horizontal line indicates a unique insertion, with its breakpoints represented by the vertical lines at the ends. Arrows represent insertions for which only one of the two breakpoints could be identified. Chromosome coordinates and scale bar are indicated on top. Data analysis was performed with pooled IC-Seq libraries (two independent experiments). See also Table S3.

    Techniques Used: Ex Vivo, Amplification, Polymerase Chain Reaction, Mouse Assay

    6) Product Images from "RAG1/2 induces genomic insertions by mobilizing DNA into RAG1/2-independent breaks"

    Article Title: RAG1/2 induces genomic insertions by mobilizing DNA into RAG1/2-independent breaks

    Journal: The Journal of Experimental Medicine

    doi: 10.1084/jem.20161638

    RAG1/2 mobilizes DNA from antibody gene segments into RAG1/2-independent DNA breaks. (A–C) Cartoon diagram to illustrate the pathways leading to insertion of RAG1/2-mobilized DNA into I-SceI breaks. Aberrant RAG1/2-mediated DNA excision at Vκ1-110 (A), Vκ3-1 (B), and Jκ1/2 (C) generates signal-end, coding-end, and hybrid-end insertions, respectively. Boxes represent Ig segments (gray) or Myc I (black), triangles indicate RSSs (green) or cRSSs (purple), red lightning points to RAG1/2 cleavage sites, and brown ellipses represent the post-cleavage complex. From top to bottom: first, RAG1/2 induces DNA breaks at paired RSSs/cRSSs. Second, DNA is aberrantly excised, and cleaved ends remain bound to the post-cleavage complex to support their repair by the NHEJ machinery. Third, excised DNA is either circularized and released from the post-cleavage complex as episomal joint (right arrow) or it escapes before end joining as linear fragment (left arrow). For signal-end insertions (A), linear DNA fragments might also originate from recleavage of episomal signal joints by RAG1/2 (dashed arrow). For coding-end and hybrid-end insertions (B and C), recleavage of episomal joints is unlikely because of the absence of paired RSSs (crossed arrows). Finally, mobilized linear DNA fragments reinsert into the genome at the I-SceI break.
    Figure Legend Snippet: RAG1/2 mobilizes DNA from antibody gene segments into RAG1/2-independent DNA breaks. (A–C) Cartoon diagram to illustrate the pathways leading to insertion of RAG1/2-mobilized DNA into I-SceI breaks. Aberrant RAG1/2-mediated DNA excision at Vκ1-110 (A), Vκ3-1 (B), and Jκ1/2 (C) generates signal-end, coding-end, and hybrid-end insertions, respectively. Boxes represent Ig segments (gray) or Myc I (black), triangles indicate RSSs (green) or cRSSs (purple), red lightning points to RAG1/2 cleavage sites, and brown ellipses represent the post-cleavage complex. From top to bottom: first, RAG1/2 induces DNA breaks at paired RSSs/cRSSs. Second, DNA is aberrantly excised, and cleaved ends remain bound to the post-cleavage complex to support their repair by the NHEJ machinery. Third, excised DNA is either circularized and released from the post-cleavage complex as episomal joint (right arrow) or it escapes before end joining as linear fragment (left arrow). For signal-end insertions (A), linear DNA fragments might also originate from recleavage of episomal signal joints by RAG1/2 (dashed arrow). For coding-end and hybrid-end insertions (B and C), recleavage of episomal joints is unlikely because of the absence of paired RSSs (crossed arrows). Finally, mobilized linear DNA fragments reinsert into the genome at the I-SceI break.

    Techniques Used: Non-Homologous End Joining

    Rearrangements between I-SceI and RAG1/2 core -induced DNA breaks at Igκ . (A) Overview of rearrangement breakpoints at the Igκ locus on chromosome 6. Histogram of the number of breakpoints in the presence or absence of RAG2 core (red and black, respectively) in 10-kb intervals. RAG1/2 core -dependent rearrangement breakpoint clusters are indicated by red triangles and labeled with the corresponding Jκ or Vκ gene segment. Asterisks mark breakpoint clusters with biased rearrangements (see B–D). Chromosome coordinates and scale bar are indicated on top. (B–D) Examples of RAG1/2 core -dependent breakpoint clusters at Jκs and Vκs. On top is a diagram of the region, with gray boxes representing Ig segments, triangles indicating 12/23RSSs (green) or cRSSs (purple), and red bars indicating the breakpoint clusters. In the middle is a histogram showing the number and position of breakpoints (Bp, red). At the bottom, each horizontal line indicates a unique rearrangement (Rx), with its breakpoint represented by the vertical line and its sheared end (which determines the uniqueness of the event) shown by the box. Color coding indicates whether rearrangements contain RSSs/cRSSs (green/purple, signal ends) or not (gray, coding ends). Rearrangements in black are undefined. Chromosome coordinates and scale bar are indicated on top. Data analysis was performed with pooled RAG2 core and RAG2 −/− TC-Seq libraries (two independent experiments each). See also Fig. S2 (A–C) and Tables S1 and S2.
    Figure Legend Snippet: Rearrangements between I-SceI and RAG1/2 core -induced DNA breaks at Igκ . (A) Overview of rearrangement breakpoints at the Igκ locus on chromosome 6. Histogram of the number of breakpoints in the presence or absence of RAG2 core (red and black, respectively) in 10-kb intervals. RAG1/2 core -dependent rearrangement breakpoint clusters are indicated by red triangles and labeled with the corresponding Jκ or Vκ gene segment. Asterisks mark breakpoint clusters with biased rearrangements (see B–D). Chromosome coordinates and scale bar are indicated on top. (B–D) Examples of RAG1/2 core -dependent breakpoint clusters at Jκs and Vκs. On top is a diagram of the region, with gray boxes representing Ig segments, triangles indicating 12/23RSSs (green) or cRSSs (purple), and red bars indicating the breakpoint clusters. In the middle is a histogram showing the number and position of breakpoints (Bp, red). At the bottom, each horizontal line indicates a unique rearrangement (Rx), with its breakpoint represented by the vertical line and its sheared end (which determines the uniqueness of the event) shown by the box. Color coding indicates whether rearrangements contain RSSs/cRSSs (green/purple, signal ends) or not (gray, coding ends). Rearrangements in black are undefined. Chromosome coordinates and scale bar are indicated on top. Data analysis was performed with pooled RAG2 core and RAG2 −/− TC-Seq libraries (two independent experiments each). See also Fig. S2 (A–C) and Tables S1 and S2.

    Techniques Used: Labeling

    Insertions of RAG1/2 core -mobilized DNA into the I-SceI site. (A) Overview of insertions originating from the Igκ locus on chromosome 6. Histogram of the number of insertions derived from each site in the presence or absence of RAG2 core (blue and black, respectively) in 10-kb intervals. RAG1/2 core -dependent rearrangement breakpoint clusters at Jκs and Vκs (triangles, same as in Fig. 2 A ) are color coded to indicate whether insertions from these sites are detected (blue) or not (red). Asterisks mark breakpoint clusters with biased rearrangements (see Fig. 2 [B–D] ). No insertions from Igκ were detected in RAG2 −/− cells. Chromosome coordinates and scale bar are indicated on top. (B–D) Examples of insertions derived from RAG1/2 core -dependent breakpoint clusters at Jκs and Vκs. On top is a diagram of the region, with gray boxes representing Ig segments, triangles indicating 12/23RSSs (green) or cRSSs (purple), and red bars indicating the breakpoint clusters (same as in Fig. 2 [B–D] ). In the middle is a histogram showing the number and position of breakpoints (Bp, red). At the bottom, each horizontal line indicates a unique insertion (Ins), with its breakpoints represented by the vertical lines at the ends. Arrows represent insertions for which only one of the two breakpoints could be identified. Chromosome coordinates and scale bar are indicated on top. Data analysis was performed with pooled RAG2 core and RAG2 −/− TC-Seq libraries (two independent experiments each). See also Table S3.
    Figure Legend Snippet: Insertions of RAG1/2 core -mobilized DNA into the I-SceI site. (A) Overview of insertions originating from the Igκ locus on chromosome 6. Histogram of the number of insertions derived from each site in the presence or absence of RAG2 core (blue and black, respectively) in 10-kb intervals. RAG1/2 core -dependent rearrangement breakpoint clusters at Jκs and Vκs (triangles, same as in Fig. 2 A ) are color coded to indicate whether insertions from these sites are detected (blue) or not (red). Asterisks mark breakpoint clusters with biased rearrangements (see Fig. 2 [B–D] ). No insertions from Igκ were detected in RAG2 −/− cells. Chromosome coordinates and scale bar are indicated on top. (B–D) Examples of insertions derived from RAG1/2 core -dependent breakpoint clusters at Jκs and Vκs. On top is a diagram of the region, with gray boxes representing Ig segments, triangles indicating 12/23RSSs (green) or cRSSs (purple), and red bars indicating the breakpoint clusters (same as in Fig. 2 [B–D] ). In the middle is a histogram showing the number and position of breakpoints (Bp, red). At the bottom, each horizontal line indicates a unique insertion (Ins), with its breakpoints represented by the vertical lines at the ends. Arrows represent insertions for which only one of the two breakpoints could be identified. Chromosome coordinates and scale bar are indicated on top. Data analysis was performed with pooled RAG2 core and RAG2 −/− TC-Seq libraries (two independent experiments each). See also Table S3.

    Techniques Used: Derivative Assay

    Landscape of insertions in primary pro–B cells by TC-Seq. (A) Cartoon diagram comparing RAG1/2 core -induced translocations and insertions. In a translocation (red), RAG1/2 core introduces a single DNA break (red lightning) that recombines with the cleaved I-SceI site at Myc I (black lightning) on chromosome 15. The resulting translocation contains Myc I only on one side. In an insertion (blue), RAG1/2 core causes tandem DNA breaks (blue lightning), thereby excising a DNA fragment that subsequently reintegrates into the cleaved I-SceI site. The resulting insertion is flanked by Myc I on both sides. (B) Origin of insertions by chromosome. Events were normalized per megabase to account for different chromosome sizes. (C) Profile of insertions near the I-SceI site in 5-kb intervals. Dashed lines indicate the ±20-kb region excluded from the analysis for D–F because of saturation. (D) Proportion of insertions from genic regions. (E) Frequency of insertions derived from differentially transcribed genes compared with a random model (dashed line). Asterisks indicate values significantly different from random (P
    Figure Legend Snippet: Landscape of insertions in primary pro–B cells by TC-Seq. (A) Cartoon diagram comparing RAG1/2 core -induced translocations and insertions. In a translocation (red), RAG1/2 core introduces a single DNA break (red lightning) that recombines with the cleaved I-SceI site at Myc I (black lightning) on chromosome 15. The resulting translocation contains Myc I only on one side. In an insertion (blue), RAG1/2 core causes tandem DNA breaks (blue lightning), thereby excising a DNA fragment that subsequently reintegrates into the cleaved I-SceI site. The resulting insertion is flanked by Myc I on both sides. (B) Origin of insertions by chromosome. Events were normalized per megabase to account for different chromosome sizes. (C) Profile of insertions near the I-SceI site in 5-kb intervals. Dashed lines indicate the ±20-kb region excluded from the analysis for D–F because of saturation. (D) Proportion of insertions from genic regions. (E) Frequency of insertions derived from differentially transcribed genes compared with a random model (dashed line). Asterisks indicate values significantly different from random (P

    Techniques Used: Translocation Assay, Derivative Assay

    Landscape of chromosomal rearrangements in primary pro–B cells by TC-Seq. (A) Detection of RAG1/2 core -induced chromosomal rearrangements by TC-Seq. Primary RAG2 −/− Myc I/I pro–B cells were infected ex vivo with retroviruses that express either I-SceI alone (RAG2 −/− TC-Seq libraries) or I-SceI together with murine RAG2 core (RAG2 core TC-Seq libraries) by using a “self-cleaving” P2A peptide. DNA breaks, such as those induced by RAG1/2 core at Igκ on chromosome 6 (red lightning), rearrange to the I-SceI break at c- myc on chromosome 15 (black lightning) and are subsequently amplified by PCR, deep-sequenced, and analyzed computationally. RAG2 core and RAG2 −/− TC-Seq libraries were prepared in independent duplicates from infected pro–B cells of 180 mice. (B) Chromosomal distribution of rearrangements. Events were normalized per megabase to account for different chromosome sizes. (C) Profile of rearrangements around the I-SceI site in 5-kb intervals. Dashed lines indicate the ±50-kb region excluded from the analysis for D–F because of saturation. (D) Proportion of genic rearrangements. (E) Frequency of rearrangements derived from differentially transcribed genes compared with a random model (dashed line). Asterisks indicate values significantly different from random (P
    Figure Legend Snippet: Landscape of chromosomal rearrangements in primary pro–B cells by TC-Seq. (A) Detection of RAG1/2 core -induced chromosomal rearrangements by TC-Seq. Primary RAG2 −/− Myc I/I pro–B cells were infected ex vivo with retroviruses that express either I-SceI alone (RAG2 −/− TC-Seq libraries) or I-SceI together with murine RAG2 core (RAG2 core TC-Seq libraries) by using a “self-cleaving” P2A peptide. DNA breaks, such as those induced by RAG1/2 core at Igκ on chromosome 6 (red lightning), rearrange to the I-SceI break at c- myc on chromosome 15 (black lightning) and are subsequently amplified by PCR, deep-sequenced, and analyzed computationally. RAG2 core and RAG2 −/− TC-Seq libraries were prepared in independent duplicates from infected pro–B cells of 180 mice. (B) Chromosomal distribution of rearrangements. Events were normalized per megabase to account for different chromosome sizes. (C) Profile of rearrangements around the I-SceI site in 5-kb intervals. Dashed lines indicate the ±50-kb region excluded from the analysis for D–F because of saturation. (D) Proportion of genic rearrangements. (E) Frequency of rearrangements derived from differentially transcribed genes compared with a random model (dashed line). Asterisks indicate values significantly different from random (P

    Techniques Used: Infection, Ex Vivo, Amplification, Polymerase Chain Reaction, Mouse Assay, Derivative Assay

    Insertions at the I-SceI site induced by wild-type RAG1/2. (A) Detection of chromosomal insertions by IC-Seq. Primary ROSA erISCEI Myc I/I Igh I/I (and ROSA erISCEI Myc I/I Igh I/I AID −/− , see Materials and methods) bone marrow B cells were treated ex vivo with tamoxifen to induce I-SceI breaks at c- myc on chromosome 15 (black lightning). Mobilized DNA fragments, such as those excised by endogenous RAG1/2 from Igκ on chromosome 6 (blue lightning), reinsert into the cleaved I-SceI site and are subsequently amplified by PCR, deep-sequenced, and analyzed computationally. Two RAG1/2 wild-type IC-Seq libraries were independently prepared from tamoxifen-treated bone marrow B cells of 12 mice. (B–D) Qualitative comparison of insertions obtained by TC-Seq (RAG1/2 core ) and IC-Seq (RAG1/2 wild type). On top is a diagram of the region, with gray boxes representing Ig segments and triangles indicating 12/23RSSs (green) or cRSSs (purple). Below, insertions detected by TC-Seq (Ins, same as in Fig. 5 [B–D] ) and IC-Seq (IC). Each horizontal line indicates a unique insertion, with its breakpoints represented by the vertical lines at the ends. Arrows represent insertions for which only one of the two breakpoints could be identified. Chromosome coordinates and scale bar are indicated on top. Data analysis was performed with pooled IC-Seq libraries (two independent experiments). See also Table S3.
    Figure Legend Snippet: Insertions at the I-SceI site induced by wild-type RAG1/2. (A) Detection of chromosomal insertions by IC-Seq. Primary ROSA erISCEI Myc I/I Igh I/I (and ROSA erISCEI Myc I/I Igh I/I AID −/− , see Materials and methods) bone marrow B cells were treated ex vivo with tamoxifen to induce I-SceI breaks at c- myc on chromosome 15 (black lightning). Mobilized DNA fragments, such as those excised by endogenous RAG1/2 from Igκ on chromosome 6 (blue lightning), reinsert into the cleaved I-SceI site and are subsequently amplified by PCR, deep-sequenced, and analyzed computationally. Two RAG1/2 wild-type IC-Seq libraries were independently prepared from tamoxifen-treated bone marrow B cells of 12 mice. (B–D) Qualitative comparison of insertions obtained by TC-Seq (RAG1/2 core ) and IC-Seq (RAG1/2 wild type). On top is a diagram of the region, with gray boxes representing Ig segments and triangles indicating 12/23RSSs (green) or cRSSs (purple). Below, insertions detected by TC-Seq (Ins, same as in Fig. 5 [B–D] ) and IC-Seq (IC). Each horizontal line indicates a unique insertion, with its breakpoints represented by the vertical lines at the ends. Arrows represent insertions for which only one of the two breakpoints could be identified. Chromosome coordinates and scale bar are indicated on top. Data analysis was performed with pooled IC-Seq libraries (two independent experiments). See also Table S3.

    Techniques Used: Ex Vivo, Amplification, Polymerase Chain Reaction, Mouse Assay

    7) Product Images from "Circular synthesized CRISPR/Cas gRNAs for functional interrogations in the coding and noncoding genome"

    Article Title: Circular synthesized CRISPR/Cas gRNAs for functional interrogations in the coding and noncoding genome

    Journal: eLife

    doi: 10.7554/eLife.42549

    Quality control of the TGW validation library. ( A ) Gel electrophoresis visualizing the quality of P1 and P2 preparations of the TGW validation library (4,232 gRNAs). Please note the absence of the 3-kb DNA fragment in the final (P2) validation library. ( B ) The distributions of the TGW validation library P1 and P2 preparations visualized as Lorenz curves. The pre-I-SceI-digested library (P1) and the post-I-SceI-digested library (P2) have similar gRNA distributions. The low area under the curve (AUC) values of 0.65 (P1) and 0.64 (P2) indicate that the I-SceI clean-up digestion does not affect the distribution of gRNAs in the final product.
    Figure Legend Snippet: Quality control of the TGW validation library. ( A ) Gel electrophoresis visualizing the quality of P1 and P2 preparations of the TGW validation library (4,232 gRNAs). Please note the absence of the 3-kb DNA fragment in the final (P2) validation library. ( B ) The distributions of the TGW validation library P1 and P2 preparations visualized as Lorenz curves. The pre-I-SceI-digested library (P1) and the post-I-SceI-digested library (P2) have similar gRNA distributions. The low area under the curve (AUC) values of 0.65 (P1) and 0.64 (P2) indicate that the I-SceI clean-up digestion does not affect the distribution of gRNAs in the final product.

    Techniques Used: Nucleic Acid Electrophoresis

    Quality control and gRNA distributions of the randomized libraries. ( A ) Gel electrophoresis of P1 3Cs libraries, generated with randomized nucleotide positions (related to Figure 2A ). Template pLentiCRISPRv2 is linearized by I-SceI digests, whereas only P1 libraries are partially I-SceI digested. P2 libraries are unaffected by I-SceI digests, demonstrating their high purity. ( B ) The distribution of the randomized nucleotide libraries, derived from panel (A), visualized with Lorenz curves. The AUC values indicate that 3Cs uncouples sequence distribution from sequence diversity.
    Figure Legend Snippet: Quality control and gRNA distributions of the randomized libraries. ( A ) Gel electrophoresis of P1 3Cs libraries, generated with randomized nucleotide positions (related to Figure 2A ). Template pLentiCRISPRv2 is linearized by I-SceI digests, whereas only P1 libraries are partially I-SceI digested. P2 libraries are unaffected by I-SceI digests, demonstrating their high purity. ( B ) The distribution of the randomized nucleotide libraries, derived from panel (A), visualized with Lorenz curves. The AUC values indicate that 3Cs uncouples sequence distribution from sequence diversity.

    Techniques Used: Nucleic Acid Electrophoresis, Generated, Derivative Assay, Sequencing

    8) Product Images from "Alternative end-joining is suppressed by the canonical NHEJ component Xrcc4/ligase IV during chromosomal translocation formation"

    Article Title: Alternative end-joining is suppressed by the canonical NHEJ component Xrcc4/ligase IV during chromosomal translocation formation

    Journal: Nature structural & molecular biology

    doi: 10.1038/nsmb.1773

    Translocation breakpoint junctions have similar characteristics in wild-type, Xrcc4 −/− mutant and complemented cells, and Ku70 −/− cells. (a) Representative der(17) translocation junction sequences obtained from Xrcc4 −/− and Xrcc4-complemented cells. DNA ends generated by I-SceI on chrs.17 and 14 are indicated in red and blue, respectively. A summary of the various end modifications is presented to the left of each junction in bp: Δ, total deletion; µ, microhomology; +, insertion. Sequences are annotated as follows: del, deletion length from the DNA end; underline, microhomology; +, length of long insertion. The middle green sequences are short insertions from chr. 14; considering a template model for their insertion, the sequences in red shading (TAA) would be microhomology between the DNA ends that could anneal to act as a primer and the blue shading would represent microhomology for annealing after DNA synthesis between the 2 DNA ends (see text). (b) Deletion lengths for der(17) breakpoint junctions. Each value represents the combined deletion from both ends of an individual junction. The median deletion length for each genotype is indicated by a bar on the graph and the value is give below the graph. Deletion lengths do not differ significantly from each other (two-tailed Mann-Whitney test). +X4, transient complementation with Xrcc4. (c) Microhomology and insertion frequencies are similar for the four genotypes. (d) Distribution of microhomology lengths for der(17) breakpoint junctions. Only junctions with simple deletions (i.e., without an insertion) are included. (e) Lack of correlation between deletion length and microhomology use. Only junctions for Xrcc4 −/− cells are plotted.
    Figure Legend Snippet: Translocation breakpoint junctions have similar characteristics in wild-type, Xrcc4 −/− mutant and complemented cells, and Ku70 −/− cells. (a) Representative der(17) translocation junction sequences obtained from Xrcc4 −/− and Xrcc4-complemented cells. DNA ends generated by I-SceI on chrs.17 and 14 are indicated in red and blue, respectively. A summary of the various end modifications is presented to the left of each junction in bp: Δ, total deletion; µ, microhomology; +, insertion. Sequences are annotated as follows: del, deletion length from the DNA end; underline, microhomology; +, length of long insertion. The middle green sequences are short insertions from chr. 14; considering a template model for their insertion, the sequences in red shading (TAA) would be microhomology between the DNA ends that could anneal to act as a primer and the blue shading would represent microhomology for annealing after DNA synthesis between the 2 DNA ends (see text). (b) Deletion lengths for der(17) breakpoint junctions. Each value represents the combined deletion from both ends of an individual junction. The median deletion length for each genotype is indicated by a bar on the graph and the value is give below the graph. Deletion lengths do not differ significantly from each other (two-tailed Mann-Whitney test). +X4, transient complementation with Xrcc4. (c) Microhomology and insertion frequencies are similar for the four genotypes. (d) Distribution of microhomology lengths for der(17) breakpoint junctions. Only junctions with simple deletions (i.e., without an insertion) are included. (e) Lack of correlation between deletion length and microhomology use. Only junctions for Xrcc4 −/− cells are plotted.

    Techniques Used: Translocation Assay, Mutagenesis, Generated, Activated Clotting Time Assay, DNA Synthesis, Two Tailed Test, MANN-WHITNEY

    Chromosomal translocations are suppressed by XRCC4/ligase IV. (a) Translocation reporter in Xrcc4 −/− pCr15 cells. DSB formation on chromosomes 17 and 14 at the I-SceI sites, followed by interchromosomal NHEJ, results in a chromosomal translocation with a neo + gene on der(17). FISH analysis indicates that parental pCr15 cells have normal chromosomes 17 (red) and 14 (green), whereas neo + clones have derivative chromosomes. Vertical red bars are exons 1–5 from the targeted Pim1 locus on chr.17, and the vertical green bar is exon 20 from the Rb locus. Probes are located outside the targeting arms. HII, HincII; HIII, HindIII. (b) Translocation frequency is significantly increased in Xrcc4 −/− cells, but is suppressed by Xrcc4 expression. (c) Confirmation of the genotype of the endogenous Xrcc4 alleles in wild-type (WT), Xrcc4 −/− and Xrcc4-complemented cells. P, parental pCr15 cells of the indicated genotypes; t, neo + translocation clones. (d) Western blot analysis demonstrating that transient expression of Xrcc4 restores wild-type Xrcc4 protein levels to Xrcc4 −/− cells.
    Figure Legend Snippet: Chromosomal translocations are suppressed by XRCC4/ligase IV. (a) Translocation reporter in Xrcc4 −/− pCr15 cells. DSB formation on chromosomes 17 and 14 at the I-SceI sites, followed by interchromosomal NHEJ, results in a chromosomal translocation with a neo + gene on der(17). FISH analysis indicates that parental pCr15 cells have normal chromosomes 17 (red) and 14 (green), whereas neo + clones have derivative chromosomes. Vertical red bars are exons 1–5 from the targeted Pim1 locus on chr.17, and the vertical green bar is exon 20 from the Rb locus. Probes are located outside the targeting arms. HII, HincII; HIII, HindIII. (b) Translocation frequency is significantly increased in Xrcc4 −/− cells, but is suppressed by Xrcc4 expression. (c) Confirmation of the genotype of the endogenous Xrcc4 alleles in wild-type (WT), Xrcc4 −/− and Xrcc4-complemented cells. P, parental pCr15 cells of the indicated genotypes; t, neo + translocation clones. (d) Western blot analysis demonstrating that transient expression of Xrcc4 restores wild-type Xrcc4 protein levels to Xrcc4 −/− cells.

    Techniques Used: Translocation Assay, Non-Homologous End Joining, Fluorescence In Situ Hybridization, Clone Assay, Expressing, Western Blot

    9) Product Images from "Damage-induced lncRNAs control the DNA damage response through interaction with DDRNAs at individual double-strand breaks"

    Article Title: Damage-induced lncRNAs control the DNA damage response through interaction with DDRNAs at individual double-strand breaks

    Journal: Nature cell biology

    doi: 10.1038/ncb3643

    Sequence-specific localization of DDRNAs at DNA damage sites is transcription-dependent. ( A ) Images of NIH2/4 cells expressing GFP-LacR, microinjected with double-stranded DDRNA-Cy5, artificial CXCR4-Cy5 miRNA (Ctrl RNA 1) or let-7a-Cy5 miRNA (Ctrl RNA 2), together with BSA (-) or I-SceI restriction enzyme (+) and imaged 4 h post injection. Scale bar 5 µm. Inset is a magnified view of the boxed region. Images from one out of 3 experiments with similar results. ( B ) Quantification of (A) showing the number of fluorophore-labeled RNA molecules at the locus as measured by single-molecule analysis based on stepwise photobleaching. Dots represent individual cells. The black line represents the mean ± SEM (data are shown as pool of n=3 independent experiments). ( C ) DDRNAs localize at the damage site to restore DDR focus formation. NIH2/4 cells knocked-down for Dicer and Drosha were mildly permeabilized and incubated with DDRNA-Cy5 or CXCR4-Cy5 (Ctrl RNA 1). The bar plot shows the percentage of cells positive for co-localization of 53BP1 with TetR, of RNA-Cy5 with TetR and the triple co-localization of 53BP1, RNA-Cy5 and TetR. Error bars indicate SEM (for siLuc and siDic n=4, for siDro n=3 independent experiments, ≥70 cells analysed in total per condition). ( D ) NIH2/4 cells expressing YFP-TetR and inducible I-SceI were treated with AM, DRB or ACTD at low and high doses or vehicle alone for 2 h before cut induction, then mildly permeabilized and incubated with DDRNA-Cy5. The bar plots show the percentage of cells in which DDRNA signal co-localizes with the TetR spot. Error bars indicate SEM (n=3 independent experiments, ≥80 cells analysed in total per condition). ( E ) NIH2/4 cells expressing GFP-LacR were microinjected with double-stranded DDRNA-Cy5, together with I-SceI protein and AM and imaged 4 h post injection. The plot shows the number of DDRNA molecules at the locus as measured by single-molecule counting based on stepwise photobleaching. Dots represent individual cells. The black line represents the mean ± SEM (data are shown as pool of n=3 independent experiments). ( B,E ) P values were calculated using two-tailed t-test. ( C,D ) P values were calculated using chi-squared test. *** P
    Figure Legend Snippet: Sequence-specific localization of DDRNAs at DNA damage sites is transcription-dependent. ( A ) Images of NIH2/4 cells expressing GFP-LacR, microinjected with double-stranded DDRNA-Cy5, artificial CXCR4-Cy5 miRNA (Ctrl RNA 1) or let-7a-Cy5 miRNA (Ctrl RNA 2), together with BSA (-) or I-SceI restriction enzyme (+) and imaged 4 h post injection. Scale bar 5 µm. Inset is a magnified view of the boxed region. Images from one out of 3 experiments with similar results. ( B ) Quantification of (A) showing the number of fluorophore-labeled RNA molecules at the locus as measured by single-molecule analysis based on stepwise photobleaching. Dots represent individual cells. The black line represents the mean ± SEM (data are shown as pool of n=3 independent experiments). ( C ) DDRNAs localize at the damage site to restore DDR focus formation. NIH2/4 cells knocked-down for Dicer and Drosha were mildly permeabilized and incubated with DDRNA-Cy5 or CXCR4-Cy5 (Ctrl RNA 1). The bar plot shows the percentage of cells positive for co-localization of 53BP1 with TetR, of RNA-Cy5 with TetR and the triple co-localization of 53BP1, RNA-Cy5 and TetR. Error bars indicate SEM (for siLuc and siDic n=4, for siDro n=3 independent experiments, ≥70 cells analysed in total per condition). ( D ) NIH2/4 cells expressing YFP-TetR and inducible I-SceI were treated with AM, DRB or ACTD at low and high doses or vehicle alone for 2 h before cut induction, then mildly permeabilized and incubated with DDRNA-Cy5. The bar plots show the percentage of cells in which DDRNA signal co-localizes with the TetR spot. Error bars indicate SEM (n=3 independent experiments, ≥80 cells analysed in total per condition). ( E ) NIH2/4 cells expressing GFP-LacR were microinjected with double-stranded DDRNA-Cy5, together with I-SceI protein and AM and imaged 4 h post injection. The plot shows the number of DDRNA molecules at the locus as measured by single-molecule counting based on stepwise photobleaching. Dots represent individual cells. The black line represents the mean ± SEM (data are shown as pool of n=3 independent experiments). ( B,E ) P values were calculated using two-tailed t-test. ( C,D ) P values were calculated using chi-squared test. *** P

    Techniques Used: Sequencing, Expressing, Injection, Labeling, Incubation, Single Molecule Counting, Two Tailed Test

    10) Product Images from "Aptamer-guided gene targeting in yeast and human cells"

    Article Title: Aptamer-guided gene targeting in yeast and human cells

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gku101

    The I-SceI aptamer stimulates gene targeting at the DsRed2 locus in human cells. ( A ) Flow cytometry analysis of several transfections in HEK-293 cells, the different samples are shown on the X axis with aptamer-containing oligonucleotides in light grey and non-binding control oligonucleotides in dark grey and the number of RFP + cells per 100 000 cells is shown on the Y axis. Negative controls were the cells alone (no DNA, only transfection reagent alone), the I-SceI expression vector alone (pSce), the targeted vector (pLDSLm) that contained the DsRed2 gene disrupted with two stop codons and the I-SceI site alone and the individual oligonucleotides alone. Transfections of oligonucleotides with both pSce and pLDSLm added are bracketed. ( B ) Hand counts of each transfection were done in HEK-293 cells in lieu of flow cytometry, which was overreporting the number of background RFP + cells for the shorter oligonucleotides. The different samples are shown on the X axis and the number of RFP + cells per 150 000 cells seeded is shown on the Y axis. Negative controls did not show any RFP + cells. ( C ) Flow cytometry analysis of transfections of the in vitro digested pLDSLm vector, the different samples shown on the X axis and the number of RFP + cells per 100 000 cells is shown on the Y axis. Negative controls were the cells alone (no DNA), the digested vector alone and the individual oligonucleotides alone. Transfections with both the digested vector and an oligonucleotide are bracketed. Bars correspond to the mean value and error bars represent 95% confidence intervals. Asterisks denote statistical significant difference between the aptamer-containing oligonucleotide and the corresponding non-binding control (* P
    Figure Legend Snippet: The I-SceI aptamer stimulates gene targeting at the DsRed2 locus in human cells. ( A ) Flow cytometry analysis of several transfections in HEK-293 cells, the different samples are shown on the X axis with aptamer-containing oligonucleotides in light grey and non-binding control oligonucleotides in dark grey and the number of RFP + cells per 100 000 cells is shown on the Y axis. Negative controls were the cells alone (no DNA, only transfection reagent alone), the I-SceI expression vector alone (pSce), the targeted vector (pLDSLm) that contained the DsRed2 gene disrupted with two stop codons and the I-SceI site alone and the individual oligonucleotides alone. Transfections of oligonucleotides with both pSce and pLDSLm added are bracketed. ( B ) Hand counts of each transfection were done in HEK-293 cells in lieu of flow cytometry, which was overreporting the number of background RFP + cells for the shorter oligonucleotides. The different samples are shown on the X axis and the number of RFP + cells per 150 000 cells seeded is shown on the Y axis. Negative controls did not show any RFP + cells. ( C ) Flow cytometry analysis of transfections of the in vitro digested pLDSLm vector, the different samples shown on the X axis and the number of RFP + cells per 100 000 cells is shown on the Y axis. Negative controls were the cells alone (no DNA), the digested vector alone and the individual oligonucleotides alone. Transfections with both the digested vector and an oligonucleotide are bracketed. Bars correspond to the mean value and error bars represent 95% confidence intervals. Asterisks denote statistical significant difference between the aptamer-containing oligonucleotide and the corresponding non-binding control (* P

    Techniques Used: Flow Cytometry, Cytometry, Transfection, Binding Assay, Expressing, Plasmid Preparation, In Vitro

    11) Product Images from "Homing endonuclease mediated gene targeting in Anopheles gambiae cells and embryos"

    Article Title: Homing endonuclease mediated gene targeting in Anopheles gambiae cells and embryos

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkm632

    DNA sequence analysis of clones created by HEG cleavage and non-homologous repair. ( a ) Clones of pBC/SacRB P1 isolated from Sua4.0 cells after co-transfection with I-PpoI expression vector pEGFP-Ppo. ( b ) Clones of pBC/SacRB S1 isolated from Sua4.0 cells (top) and G3 embryos (bottom) after co-transfection/injection with I-SceI expression vector pP[v+,70I-SceI]. The native 15 bp minimal I-PpoI and 18-bp I-SceI recognition sites are shown on top of the isolated clones in the context of the SacRB gene. Deleted nucleotides are indicated by dashes (-), inserted nucleotides are underlined. If deletions extend beyond the EcoRI sites flanking the HEG recognition sites the number of base pairs deleted is indicated and the first 3 bp after the deletion are shown in brackets. The shaded area indicates the 4 bp between the HEG cleavage positions on both DNA strands. Larger insertions are marked by vertical bars: (*) Insertion of 66 bp partially homologous to A. gambiae genome. (**) Insertion of 43 bp. B, BamHI; E, EcoRI; H, HindIII.
    Figure Legend Snippet: DNA sequence analysis of clones created by HEG cleavage and non-homologous repair. ( a ) Clones of pBC/SacRB P1 isolated from Sua4.0 cells after co-transfection with I-PpoI expression vector pEGFP-Ppo. ( b ) Clones of pBC/SacRB S1 isolated from Sua4.0 cells (top) and G3 embryos (bottom) after co-transfection/injection with I-SceI expression vector pP[v+,70I-SceI]. The native 15 bp minimal I-PpoI and 18-bp I-SceI recognition sites are shown on top of the isolated clones in the context of the SacRB gene. Deleted nucleotides are indicated by dashes (-), inserted nucleotides are underlined. If deletions extend beyond the EcoRI sites flanking the HEG recognition sites the number of base pairs deleted is indicated and the first 3 bp after the deletion are shown in brackets. The shaded area indicates the 4 bp between the HEG cleavage positions on both DNA strands. Larger insertions are marked by vertical bars: (*) Insertion of 66 bp partially homologous to A. gambiae genome. (**) Insertion of 43 bp. B, BamHI; E, EcoRI; H, HindIII.

    Techniques Used: Sequencing, Clone Assay, Isolation, Cotransfection, Expressing, Plasmid Preparation, Injection

    Cell proliferation analysis and morphology of I-PpoI and I-SceI expressing cells. ( a ) I-PpoI expression arrests proliferation of Sua 4.0 cells. Cells were co-transfected with HEG expression vectors and a GFP control in combination with pIB/V5-His which confers resistance to blasticidin and counted after 5 days of growth in medium supplemented with blasticidin S. Red bars indicate cells that were heat-shocked to induce expression of I-SceI. The dotted line indicates the 150 000 cells seeded for the experiment. ( b ) Sua 4.0 cells were transfected with pEGFP-Ppo, pEGFP-Ppo H98A and control pSL-Act-GFP. Forty-eight hour post-transfection, cells were fixed and stained with DAPI as well as phalloidin. White arrows indicate nucleoli of cells. TM, transmission.
    Figure Legend Snippet: Cell proliferation analysis and morphology of I-PpoI and I-SceI expressing cells. ( a ) I-PpoI expression arrests proliferation of Sua 4.0 cells. Cells were co-transfected with HEG expression vectors and a GFP control in combination with pIB/V5-His which confers resistance to blasticidin and counted after 5 days of growth in medium supplemented with blasticidin S. Red bars indicate cells that were heat-shocked to induce expression of I-SceI. The dotted line indicates the 150 000 cells seeded for the experiment. ( b ) Sua 4.0 cells were transfected with pEGFP-Ppo, pEGFP-Ppo H98A and control pSL-Act-GFP. Forty-eight hour post-transfection, cells were fixed and stained with DAPI as well as phalloidin. White arrows indicate nucleoli of cells. TM, transmission.

    Techniques Used: Expressing, Transfection, Activated Clotting Time Assay, Staining, Transmission Assay

    I-SceI and I-PpoI expression constructs and their activity in A. gambiae cells. ( a ) Maps of HEG expression and target vectors used in the interplasmid activity assay. CMV, cytomegalovirus promoter; Hsp70, Drosophila heatshock protein 70 promoter; eGFP enhanced green fluorescent protein; SacRB , levansucrase gene; X, XbaI; B, BamHI; E, EcoRI; H, HindIII; Xh, XhoI; N, NcoI; A, AscI; S, SalI; Nh, NheI; Kan R , kanamycin resistance cassette; Cam R , chloramphenicol resistance cassette; Tet R , tetracycline resistance cassette; Amp R , ampicilin resistance cassette; NLS, nuclear localization signal. ( b ) Analysis of I-SceI and I-PpoI activity in Sua4.0 cells by Southern blot. Cells were co-transfected with I-SceI or I-PpoI expression and target plasmids. Total DNA from these cells was digested with NcoI and hybridized with the 1.8 kb BamHI/HindIII fragment of pBC/SacRB as a probe (Lanes 1–5). In lanes 6–10, DNA was also digested with I-SceI or I-PpoI in vitro . The white arrow marks linearized full-length plasmids (lanes 1–5) and plasmids resistant to in vitro endonuclease cleavage. ( c ) Number of Cam/Suc-resistant colonies after bacterial transformation of plasmid DNA isolated from transfected Sua4.0 cells. Co-transfection of the target plasmids together with I-SceI and I-PpoI expression vectors increases the number of colonies. ( d ) Expression of I-SceI and I-PpoI in A. gambiae Sua 4.0 cells. Western blot of transfected cells using anti-hemagglutinin (anti-HA) and anti-α tubulin (left). The I-PpoI-GFP fusion proteins show the expected nuclear localization unlike the Actin 5C-driven GFP control (right).
    Figure Legend Snippet: I-SceI and I-PpoI expression constructs and their activity in A. gambiae cells. ( a ) Maps of HEG expression and target vectors used in the interplasmid activity assay. CMV, cytomegalovirus promoter; Hsp70, Drosophila heatshock protein 70 promoter; eGFP enhanced green fluorescent protein; SacRB , levansucrase gene; X, XbaI; B, BamHI; E, EcoRI; H, HindIII; Xh, XhoI; N, NcoI; A, AscI; S, SalI; Nh, NheI; Kan R , kanamycin resistance cassette; Cam R , chloramphenicol resistance cassette; Tet R , tetracycline resistance cassette; Amp R , ampicilin resistance cassette; NLS, nuclear localization signal. ( b ) Analysis of I-SceI and I-PpoI activity in Sua4.0 cells by Southern blot. Cells were co-transfected with I-SceI or I-PpoI expression and target plasmids. Total DNA from these cells was digested with NcoI and hybridized with the 1.8 kb BamHI/HindIII fragment of pBC/SacRB as a probe (Lanes 1–5). In lanes 6–10, DNA was also digested with I-SceI or I-PpoI in vitro . The white arrow marks linearized full-length plasmids (lanes 1–5) and plasmids resistant to in vitro endonuclease cleavage. ( c ) Number of Cam/Suc-resistant colonies after bacterial transformation of plasmid DNA isolated from transfected Sua4.0 cells. Co-transfection of the target plasmids together with I-SceI and I-PpoI expression vectors increases the number of colonies. ( d ) Expression of I-SceI and I-PpoI in A. gambiae Sua 4.0 cells. Western blot of transfected cells using anti-hemagglutinin (anti-HA) and anti-α tubulin (left). The I-PpoI-GFP fusion proteins show the expected nuclear localization unlike the Actin 5C-driven GFP control (right).

    Techniques Used: Expressing, Construct, Activity Assay, Chick Chorioallantoic Membrane Assay, Southern Blot, Transfection, In Vitro, Electroporation Bacterial Transformation, Plasmid Preparation, Isolation, Cotransfection, Western Blot

    12) Product Images from "A recombineering based approach for high-throughput conditional knockout targeting vector construction"

    Article Title: A recombineering based approach for high-throughput conditional knockout targeting vector construction

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkm163

    Construction of conditional knockout targeting vectors using the new recombineering reagents. ( A ) The genomic structure of a locus with exons 3–5 to be deleted in the cko allele. The Bsd cassette flanked by two rare cutter sites, I-SceI and I-CeuI, is targeted to the 5′ side of the intended deletion region. Subsequently, the loxP-F3-PGK-EM7-Neo-F3 ( Neo ) cassette is targeted to the 3′ side of the deletion region. The point mutation present in the Neo coding sequence of PL452 and PL451 plasmids ( 10 , 36 ) was corrected in this Neo cassette which resulted in higher resistance to Kanamycin in E. coli and a 2-fold increase in the number of G418-resistant ES colonies. Coloured lines represent the short homology arms in recombineering. ( B ) The genomic DNA fragment is retrieved from the BAC to PL611, which has the Amp R gene. In a typical cko vector, we choose 4–5-kb genomic DNA as the left homology arm (5′), and 2–3 kb as the right homology arm (3′). The genomic DNA region to be deleted is generally between 1 and 7 kb. ( C ) The Bsd cassette can conveniently be replaced by a reporter, i.e. lacZ , in a simple ligation reaction. The final targeting vector has the reporter flanked by two FRT sites followed by a lox P site at the 5′ side of the intended deletion region, and a F3 flanked Neo cassette providing positive selection in ES cells. The negative selection marker TK is added to the vector backbone by recombineering. The vector is linearized with the rare-cutter I-PpoI.
    Figure Legend Snippet: Construction of conditional knockout targeting vectors using the new recombineering reagents. ( A ) The genomic structure of a locus with exons 3–5 to be deleted in the cko allele. The Bsd cassette flanked by two rare cutter sites, I-SceI and I-CeuI, is targeted to the 5′ side of the intended deletion region. Subsequently, the loxP-F3-PGK-EM7-Neo-F3 ( Neo ) cassette is targeted to the 3′ side of the deletion region. The point mutation present in the Neo coding sequence of PL452 and PL451 plasmids ( 10 , 36 ) was corrected in this Neo cassette which resulted in higher resistance to Kanamycin in E. coli and a 2-fold increase in the number of G418-resistant ES colonies. Coloured lines represent the short homology arms in recombineering. ( B ) The genomic DNA fragment is retrieved from the BAC to PL611, which has the Amp R gene. In a typical cko vector, we choose 4–5-kb genomic DNA as the left homology arm (5′), and 2–3 kb as the right homology arm (3′). The genomic DNA region to be deleted is generally between 1 and 7 kb. ( C ) The Bsd cassette can conveniently be replaced by a reporter, i.e. lacZ , in a simple ligation reaction. The final targeting vector has the reporter flanked by two FRT sites followed by a lox P site at the 5′ side of the intended deletion region, and a F3 flanked Neo cassette providing positive selection in ES cells. The negative selection marker TK is added to the vector backbone by recombineering. The vector is linearized with the rare-cutter I-PpoI.

    Techniques Used: Knock-Out, Mutagenesis, Sequencing, BAC Assay, Plasmid Preparation, Ligation, Selection, Marker

    13) Product Images from "Construction and applications of exon-trapping gene-targeting vectors with a novel strategy for negative selection"

    Article Title: Construction and applications of exon-trapping gene-targeting vectors with a novel strategy for negative selection

    Journal: BMC Research Notes

    doi: 10.1186/s13104-015-1241-6

    A simple and efficient method to rapidly construct exon-trapping targeting vectors. a Schematic representation of entry clones with floxed promoterless markers. For simplicity, the plasmid backbone is not drawn. IRES internal ribosome entry site, 2A a 2A-peptide sequence derived from Thosea asigna virus (TaV), Puro R puromycin-resistance gene, Hyg R hygromycin-resistance gene, Neo R neomycin-resistance gene, βgeo lacZ / Neo R , EGFP enhanced green fluorescent protein gene, pA polyadenylation signal. Half-closed triangles and closed triangles represent lox 71 and lox P sequences, respectively. b Primer design for PCR amplification of homology arms. Each primer has four guanine residues at the 5′ end followed by an att B sequence. The four att B sequences att B4, att B1, att B2 and att B3 differ from one another, enabling efficient site-specific BP and LR recombination. The 5′-arm reverse primer should be set on the exon to be trapped (i.e., exon X in panel c ), in order for the 5′-arm fragment to possess an authentic splice acceptor site at the 3′ side. The I- Sce I site added to the 3′-arm reverse primer facilitates linearization of the resulting targeting vector. GSS gene-specific sequences. See text for details. c Flow diagram of construction of targeting vectors based on the MultiSite Gateway system, which consists of three steps: (1) PCR amplification with att B-containing primers, (2) BP recombination between 5′ or 3′ arm fragment and a donor vector (pDONR P4-P1R or pDONR P2R-P3, respectively), and (3) LR recombination to yield the targeting vector by one-time assembly of four DNA fragments ( see text for details). SA splice acceptor site, drug R drug-resistance gene, Km R kanamycin-resistance gene, Amp R ampicillin-resistance gene. d Schematic representation of pENTR SA-IRES-Puro and pENTR SA-IRES-Hyg. These two entry clones harbor an SA site-linked promoterless marker gene. See “ Methods ” for details.
    Figure Legend Snippet: A simple and efficient method to rapidly construct exon-trapping targeting vectors. a Schematic representation of entry clones with floxed promoterless markers. For simplicity, the plasmid backbone is not drawn. IRES internal ribosome entry site, 2A a 2A-peptide sequence derived from Thosea asigna virus (TaV), Puro R puromycin-resistance gene, Hyg R hygromycin-resistance gene, Neo R neomycin-resistance gene, βgeo lacZ / Neo R , EGFP enhanced green fluorescent protein gene, pA polyadenylation signal. Half-closed triangles and closed triangles represent lox 71 and lox P sequences, respectively. b Primer design for PCR amplification of homology arms. Each primer has four guanine residues at the 5′ end followed by an att B sequence. The four att B sequences att B4, att B1, att B2 and att B3 differ from one another, enabling efficient site-specific BP and LR recombination. The 5′-arm reverse primer should be set on the exon to be trapped (i.e., exon X in panel c ), in order for the 5′-arm fragment to possess an authentic splice acceptor site at the 3′ side. The I- Sce I site added to the 3′-arm reverse primer facilitates linearization of the resulting targeting vector. GSS gene-specific sequences. See text for details. c Flow diagram of construction of targeting vectors based on the MultiSite Gateway system, which consists of three steps: (1) PCR amplification with att B-containing primers, (2) BP recombination between 5′ or 3′ arm fragment and a donor vector (pDONR P4-P1R or pDONR P2R-P3, respectively), and (3) LR recombination to yield the targeting vector by one-time assembly of four DNA fragments ( see text for details). SA splice acceptor site, drug R drug-resistance gene, Km R kanamycin-resistance gene, Amp R ampicillin-resistance gene. d Schematic representation of pENTR SA-IRES-Puro and pENTR SA-IRES-Hyg. These two entry clones harbor an SA site-linked promoterless marker gene. See “ Methods ” for details.

    Techniques Used: Construct, Clone Assay, Plasmid Preparation, Sequencing, Derivative Assay, Polymerase Chain Reaction, Amplification, Flow Cytometry, Marker

    14) Product Images from "Gene modification by fast‐track recombineering for cellular localization and isolation of components of plant protein complexes"

    Article Title: Gene modification by fast‐track recombineering for cellular localization and isolation of components of plant protein complexes

    Journal: The Plant Journal

    doi: 10.1111/tpj.14450

    Fast‐track recombineering using I‐ Sce I insertion cassettes. (a) Schematic presentation of N‐ and C‐terminal KmR and SpR gene‐linked I‐ Sce I cassettes (Figure S4 ) designed for replacement of start and stop codons of target genes with coding regions of GFP, mCherry and PIPL (His 18 StrepII‐HA) epitope. (b) The work flow of fast‐track recombineering is illustrated schematically by the replacement of stop codons of CYCH and H3.1 genes (Figure S2 f,g), which are carried by BACs with KmR markers. The BAC harbouring the target gene is transformed into the recombineering host SW102 and verified by PCR amplification of a segment of target gene with primers flanking its stop codon (green arrowheads). In the first step of recombineering (1), the C–GFPstop‐SpR I‐ Sce I cassette (Figure S4 ) is PCR amplified with primers carrying 50‐nt flanks of the stop codon (red and blue bars) and the cassette DNA fragment (2.07 kb) is transformed into SW102 harbouring the target BAC. Transformants are selected for the SpR marker of the I‐ Sce I cassette and verified by colony PCR with the gene‐specific primers. The PCR will detect BACs both with and without cassette insertions (2.07 kb + space between the primers versus distance between the gene‐specific primers). In the second step (2), the target gene carrying the I‐ Sce I cassette insertion replacing its stop codon is moved by gap‐repair into the pGAPBRHyg (or pGAPBRKm, Figure S5 ) binary vector. pGAPBRHyg is linearized with Bam HI, phosphatase treated (see Experimental Procedures for necessary control step), and PCR amplified with primers that carry 50 nt flanks of BAC sequences designed for transfer into plants linked to the modified target gene (Figure S2 f,g). The purified linear pGAPBRHyg is transformed into SW102 (BAC:GFPstop‐SpR). Following selection of AmpR transformants, plasmid DNA is prepared and transformed into E. coli DH10B to purify the pGAPBRHyg clones from the resident BACs. In the third step (3), the pGAPBRHyg clone is fingerprinted with restriction enzymes, cleaved by I‐ Sce I, self‐ligated and transformed into E. coli DH10B. AmpR transformants are screened for the loss of SpR marker and subjected to verification by sequencing the junction of modified plant gene in pGAPBRHyg using the gene‐specific primers. Finally, the construct is transferred by conjugation from E. coli into Agrobacterium for plant transformation as described in Figure 1 .
    Figure Legend Snippet: Fast‐track recombineering using I‐ Sce I insertion cassettes. (a) Schematic presentation of N‐ and C‐terminal KmR and SpR gene‐linked I‐ Sce I cassettes (Figure S4 ) designed for replacement of start and stop codons of target genes with coding regions of GFP, mCherry and PIPL (His 18 StrepII‐HA) epitope. (b) The work flow of fast‐track recombineering is illustrated schematically by the replacement of stop codons of CYCH and H3.1 genes (Figure S2 f,g), which are carried by BACs with KmR markers. The BAC harbouring the target gene is transformed into the recombineering host SW102 and verified by PCR amplification of a segment of target gene with primers flanking its stop codon (green arrowheads). In the first step of recombineering (1), the C–GFPstop‐SpR I‐ Sce I cassette (Figure S4 ) is PCR amplified with primers carrying 50‐nt flanks of the stop codon (red and blue bars) and the cassette DNA fragment (2.07 kb) is transformed into SW102 harbouring the target BAC. Transformants are selected for the SpR marker of the I‐ Sce I cassette and verified by colony PCR with the gene‐specific primers. The PCR will detect BACs both with and without cassette insertions (2.07 kb + space between the primers versus distance between the gene‐specific primers). In the second step (2), the target gene carrying the I‐ Sce I cassette insertion replacing its stop codon is moved by gap‐repair into the pGAPBRHyg (or pGAPBRKm, Figure S5 ) binary vector. pGAPBRHyg is linearized with Bam HI, phosphatase treated (see Experimental Procedures for necessary control step), and PCR amplified with primers that carry 50 nt flanks of BAC sequences designed for transfer into plants linked to the modified target gene (Figure S2 f,g). The purified linear pGAPBRHyg is transformed into SW102 (BAC:GFPstop‐SpR). Following selection of AmpR transformants, plasmid DNA is prepared and transformed into E. coli DH10B to purify the pGAPBRHyg clones from the resident BACs. In the third step (3), the pGAPBRHyg clone is fingerprinted with restriction enzymes, cleaved by I‐ Sce I, self‐ligated and transformed into E. coli DH10B. AmpR transformants are screened for the loss of SpR marker and subjected to verification by sequencing the junction of modified plant gene in pGAPBRHyg using the gene‐specific primers. Finally, the construct is transferred by conjugation from E. coli into Agrobacterium for plant transformation as described in Figure 1 .

    Techniques Used: SPR Assay, Flow Cytometry, BAC Assay, Transformation Assay, Polymerase Chain Reaction, Amplification, Marker, Plasmid Preparation, Modification, Purification, Selection, Clone Assay, Sequencing, Construct, Conjugation Assay

    15) Product Images from "Construction and applications of exon-trapping gene-targeting vectors with a novel strategy for negative selection"

    Article Title: Construction and applications of exon-trapping gene-targeting vectors with a novel strategy for negative selection

    Journal: BMC Research Notes

    doi: 10.1186/s13104-015-1241-6

    A simple and efficient method to rapidly construct exon-trapping targeting vectors. a Schematic representation of entry clones with floxed promoterless markers. For simplicity, the plasmid backbone is not drawn. IRES internal ribosome entry site, 2A a 2A-peptide sequence derived from Thosea asigna virus (TaV), Puro R puromycin-resistance gene, Hyg R hygromycin-resistance gene, Neo R neomycin-resistance gene, βgeo lacZ / Neo R , EGFP enhanced green fluorescent protein gene, pA polyadenylation signal. Half-closed triangles and closed triangles represent lox 71 and lox P sequences, respectively. b Primer design for PCR amplification of homology arms. Each primer has four guanine residues at the 5′ end followed by an att B sequence. The four att B sequences att B4, att B1, att B2 and att B3 differ from one another, enabling efficient site-specific BP and LR recombination. The 5′-arm reverse primer should be set on the exon to be trapped (i.e., exon X in panel c ), in order for the 5′-arm fragment to possess an authentic splice acceptor site at the 3′ side. The I- Sce I site added to the 3′-arm reverse primer facilitates linearization of the resulting targeting vector. GSS gene-specific sequences. See text for details. c Flow diagram of construction of targeting vectors based on the MultiSite Gateway system, which consists of three steps: (1) PCR amplification with att B-containing primers, (2) BP recombination between 5′ or 3′ arm fragment and a donor vector (pDONR P4-P1R or pDONR P2R-P3, respectively), and (3) LR recombination to yield the targeting vector by one-time assembly of four DNA fragments ( see text for details). SA splice acceptor site, drug R drug-resistance gene, Km R kanamycin-resistance gene, Amp R ampicillin-resistance gene. d Schematic representation of pENTR SA-IRES-Puro and pENTR SA-IRES-Hyg. These two entry clones harbor an SA site-linked promoterless marker gene. See “ Methods ” for details.
    Figure Legend Snippet: A simple and efficient method to rapidly construct exon-trapping targeting vectors. a Schematic representation of entry clones with floxed promoterless markers. For simplicity, the plasmid backbone is not drawn. IRES internal ribosome entry site, 2A a 2A-peptide sequence derived from Thosea asigna virus (TaV), Puro R puromycin-resistance gene, Hyg R hygromycin-resistance gene, Neo R neomycin-resistance gene, βgeo lacZ / Neo R , EGFP enhanced green fluorescent protein gene, pA polyadenylation signal. Half-closed triangles and closed triangles represent lox 71 and lox P sequences, respectively. b Primer design for PCR amplification of homology arms. Each primer has four guanine residues at the 5′ end followed by an att B sequence. The four att B sequences att B4, att B1, att B2 and att B3 differ from one another, enabling efficient site-specific BP and LR recombination. The 5′-arm reverse primer should be set on the exon to be trapped (i.e., exon X in panel c ), in order for the 5′-arm fragment to possess an authentic splice acceptor site at the 3′ side. The I- Sce I site added to the 3′-arm reverse primer facilitates linearization of the resulting targeting vector. GSS gene-specific sequences. See text for details. c Flow diagram of construction of targeting vectors based on the MultiSite Gateway system, which consists of three steps: (1) PCR amplification with att B-containing primers, (2) BP recombination between 5′ or 3′ arm fragment and a donor vector (pDONR P4-P1R or pDONR P2R-P3, respectively), and (3) LR recombination to yield the targeting vector by one-time assembly of four DNA fragments ( see text for details). SA splice acceptor site, drug R drug-resistance gene, Km R kanamycin-resistance gene, Amp R ampicillin-resistance gene. d Schematic representation of pENTR SA-IRES-Puro and pENTR SA-IRES-Hyg. These two entry clones harbor an SA site-linked promoterless marker gene. See “ Methods ” for details.

    Techniques Used: Construct, Clone Assay, Plasmid Preparation, Sequencing, Derivative Assay, Polymerase Chain Reaction, Amplification, Flow Cytometry, Marker

    16) Product Images from "The Tumor-Associated Variant RAD51 G151D Induces a Hyper-Recombination Phenotype"

    Article Title: The Tumor-Associated Variant RAD51 G151D Induces a Hyper-Recombination Phenotype

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1006208

    Enhanced HDR of chromosomal DSBs in cell lines expressing RAD51 G151D. A. RAD51 WT and G151D were stably expressed in MCF7 cells harboring the I- Sce I reporter construct using the pRVY TET-OFF inducible expression vector. The addition of doxycycline to the media turns off exogenous RAD51 expression (repressed, abbreviated R; endogenous RAD51 protein levels only), with expression induced upon removal of DOX (induced, abbreviated I; endogenous levels + exogenous protein levels). Western blot with an antisera raised against RAD51 protein demonstrates equivalent expression of exogenous WT and G151D (I) in their respective MCF-7 DR-GFP pools (RAD51/tubulin), as well as the fold increase in expression over endogenous RAD51 (I/R). B. The percentage of GFP positive cells was measured by flow cytometry 72hrs after nucleofection with an I- Sce I expression vector. The percentage of GFP-positive cells from MCF-7 DR-GFP parental cells was normalized to 1 and the relative change of percent GFP-positive cells from MCF-7 DR-GFP RAD51 WT and G151D cells was calculated. Data are graphed as mean ± SD from 3 independent experiments ** p
    Figure Legend Snippet: Enhanced HDR of chromosomal DSBs in cell lines expressing RAD51 G151D. A. RAD51 WT and G151D were stably expressed in MCF7 cells harboring the I- Sce I reporter construct using the pRVY TET-OFF inducible expression vector. The addition of doxycycline to the media turns off exogenous RAD51 expression (repressed, abbreviated R; endogenous RAD51 protein levels only), with expression induced upon removal of DOX (induced, abbreviated I; endogenous levels + exogenous protein levels). Western blot with an antisera raised against RAD51 protein demonstrates equivalent expression of exogenous WT and G151D (I) in their respective MCF-7 DR-GFP pools (RAD51/tubulin), as well as the fold increase in expression over endogenous RAD51 (I/R). B. The percentage of GFP positive cells was measured by flow cytometry 72hrs after nucleofection with an I- Sce I expression vector. The percentage of GFP-positive cells from MCF-7 DR-GFP parental cells was normalized to 1 and the relative change of percent GFP-positive cells from MCF-7 DR-GFP RAD51 WT and G151D cells was calculated. Data are graphed as mean ± SD from 3 independent experiments ** p

    Techniques Used: Expressing, Stable Transfection, Construct, Plasmid Preparation, Western Blot, Flow Cytometry, Cytometry

    17) Product Images from "POT1 inhibits the efficiency but promotes the fidelity of nonhomologous end joining at non-telomeric DNA regions"

    Article Title: POT1 inhibits the efficiency but promotes the fidelity of nonhomologous end joining at non-telomeric DNA regions

    Journal: Aging (Albany NY)

    doi: 10.18632/aging.101339

    POT1 promotes NHEJ fidelity but inhibits NHEJ efficiency ( A ) Schematic picture of NHEJ reporter cassette. The reporter and the cell line harboring it are as previously described [ 7 , 24 ]. ( B ) Expression of FLAG-tagged POT1. ( C ) The effect of POT1 overexpression on NHEJ efficiency. The NHEJ-I9a was transfected with POT1 vector, I-SceI vector and DsRed for normalizing transfection efficiency using Lonza 4D machine. On day 3 post transfection, cells were harvested for FACS analysis. ( D ) Overexpressing POT1 sensitizes HCA2-hTERT cells to X-Ray. POT1 overexpressing cells were treated with X-Ray at 4 Gy, and then harvested, reseeded to plates at different numbers. On day 14 post IR, cells were stained with Commassie solution and colonies with at least 50 cells were counted. Cell survival was calculated as the ratio of the relative plating efficiencies of X-Ray treated versus control cells. ( E ) Analysis of NHEJ fidelity. The method is as previously reported [ 25 ]. At least forty clones were used for junction sequencing. bp: base pairs.
    Figure Legend Snippet: POT1 promotes NHEJ fidelity but inhibits NHEJ efficiency ( A ) Schematic picture of NHEJ reporter cassette. The reporter and the cell line harboring it are as previously described [ 7 , 24 ]. ( B ) Expression of FLAG-tagged POT1. ( C ) The effect of POT1 overexpression on NHEJ efficiency. The NHEJ-I9a was transfected with POT1 vector, I-SceI vector and DsRed for normalizing transfection efficiency using Lonza 4D machine. On day 3 post transfection, cells were harvested for FACS analysis. ( D ) Overexpressing POT1 sensitizes HCA2-hTERT cells to X-Ray. POT1 overexpressing cells were treated with X-Ray at 4 Gy, and then harvested, reseeded to plates at different numbers. On day 14 post IR, cells were stained with Commassie solution and colonies with at least 50 cells were counted. Cell survival was calculated as the ratio of the relative plating efficiencies of X-Ray treated versus control cells. ( E ) Analysis of NHEJ fidelity. The method is as previously reported [ 25 ]. At least forty clones were used for junction sequencing. bp: base pairs.

    Techniques Used: Non-Homologous End Joining, Expressing, Over Expression, Transfection, Plasmid Preparation, FACS, Staining, Clone Assay, Sequencing

    POT1 is rapidly recruited to nontelomeric DNA damage sites ( A ) POT1 is recruited to DNA damage sites within 1-second post microirradiation. U2OS cells were microirradiated to generate DSBs in a line pattern using a 405 nm diode laser. ( B ) Diagram of the site for which ChIP primers were designed (arrows). At different time points post I-SceI transfection, NHEJ-I9a cells were harvested and lysed for ChIP assay with an antibody against POT1, followed by quantitative PCR analysis. The procedure for ChIP is as previously described [ 12 ]. ( C ) Schematic depiction of different domains of POT1 tagged with GFP. ( D ) Comparable expression of GFP-tagged different domains of POT1. The U2OS cells were transfected with different amounts of vectors encoding OB1 (0.67 μg), OB2 (0.5 μg), OB12 (1 μg), C-terminal (3 μg). At 48 h post transfection, cells were harvested for FACS analysis. (E) Analysis of recruitment of different POT1 domains.
    Figure Legend Snippet: POT1 is rapidly recruited to nontelomeric DNA damage sites ( A ) POT1 is recruited to DNA damage sites within 1-second post microirradiation. U2OS cells were microirradiated to generate DSBs in a line pattern using a 405 nm diode laser. ( B ) Diagram of the site for which ChIP primers were designed (arrows). At different time points post I-SceI transfection, NHEJ-I9a cells were harvested and lysed for ChIP assay with an antibody against POT1, followed by quantitative PCR analysis. The procedure for ChIP is as previously described [ 12 ]. ( C ) Schematic depiction of different domains of POT1 tagged with GFP. ( D ) Comparable expression of GFP-tagged different domains of POT1. The U2OS cells were transfected with different amounts of vectors encoding OB1 (0.67 μg), OB2 (0.5 μg), OB12 (1 μg), C-terminal (3 μg). At 48 h post transfection, cells were harvested for FACS analysis. (E) Analysis of recruitment of different POT1 domains.

    Techniques Used: Chromatin Immunoprecipitation, Transfection, Non-Homologous End Joining, Real-time Polymerase Chain Reaction, Expressing, FACS

    POT1 inhibits alt-NHEJ efficiency and promotes the degradation of Lig3 ( A ) Schematic diagram of EJ2-GFP for analyzing the alt-NHEJ efficiency. The mechanism of the reporter cassette is as previously described [ 6 ]. ( B ) Overexpression of POT1 inhibits alt-NHEJ efficiency. The reporter construct was digested with I-SceI restriction enzyme in vitro , followed by being transfected to HCA2-hTERT cells together with a control vector or a plasmid encoding POT1. On day 3 post transfection, cells were harvested for FACS analysis. ( C ) and ( D ) Mildly knocking down POT1 in HeLa cells significantly stimulates the alt-NHEJ efficiency. HeLa cells were transfected with siRNA against POT1 twice with two days interval, followed by a transfection of I-SceI linearized EJ2-GFP reporter. On day 3 post transfection, cells were harvested for FACS analysis. ( E ) Expression of important NHEJ factors in the absence or presence of POT1 overexpression. ( F ) Quantification of Lig3 expression using ImageJ software. The relative expression of Lig3 is calculated as the ratio of Lig3 expression versus TUBULIN. ( G ) Lig3 expression was not affected at transcriptional level in POT1 overexpressing cells. At 24 h post POT1 transfection, cells were harvested for mRNA extraction. Then Quantitative PCR analysis was performed with primers indicated. The primers used for q-PCR of Lig3 are as follows: Forward: 5′- TATGGCACGGGACCTAG -3′, Reverse: 5′- CTGTTGCTGCTCATCCTC -3′. The primers used for q-PCR of GAPDH are as follows: Forward: 5′ATGACATCAAGAAGGTGGTG3′, Reverse: 5′CATACCAGGAAATGAGCTTG3′. The transcript level of Lig3 was determined using delta CT method [ 38 ]. ( H ) POT1 overexpression promotes Lig3 degradation. 293FT cells with a control vector or a vector encoding POT1 transfected were treated with cycloheximide (CHX) at 50 μg/ml. At different time points post the treatment, cells were harvested for Western blot analysis. ( I ) The model of POT1 regulating DNA DSB repair at non-telomeric regions.
    Figure Legend Snippet: POT1 inhibits alt-NHEJ efficiency and promotes the degradation of Lig3 ( A ) Schematic diagram of EJ2-GFP for analyzing the alt-NHEJ efficiency. The mechanism of the reporter cassette is as previously described [ 6 ]. ( B ) Overexpression of POT1 inhibits alt-NHEJ efficiency. The reporter construct was digested with I-SceI restriction enzyme in vitro , followed by being transfected to HCA2-hTERT cells together with a control vector or a plasmid encoding POT1. On day 3 post transfection, cells were harvested for FACS analysis. ( C ) and ( D ) Mildly knocking down POT1 in HeLa cells significantly stimulates the alt-NHEJ efficiency. HeLa cells were transfected with siRNA against POT1 twice with two days interval, followed by a transfection of I-SceI linearized EJ2-GFP reporter. On day 3 post transfection, cells were harvested for FACS analysis. ( E ) Expression of important NHEJ factors in the absence or presence of POT1 overexpression. ( F ) Quantification of Lig3 expression using ImageJ software. The relative expression of Lig3 is calculated as the ratio of Lig3 expression versus TUBULIN. ( G ) Lig3 expression was not affected at transcriptional level in POT1 overexpressing cells. At 24 h post POT1 transfection, cells were harvested for mRNA extraction. Then Quantitative PCR analysis was performed with primers indicated. The primers used for q-PCR of Lig3 are as follows: Forward: 5′- TATGGCACGGGACCTAG -3′, Reverse: 5′- CTGTTGCTGCTCATCCTC -3′. The primers used for q-PCR of GAPDH are as follows: Forward: 5′ATGACATCAAGAAGGTGGTG3′, Reverse: 5′CATACCAGGAAATGAGCTTG3′. The transcript level of Lig3 was determined using delta CT method [ 38 ]. ( H ) POT1 overexpression promotes Lig3 degradation. 293FT cells with a control vector or a vector encoding POT1 transfected were treated with cycloheximide (CHX) at 50 μg/ml. At different time points post the treatment, cells were harvested for Western blot analysis. ( I ) The model of POT1 regulating DNA DSB repair at non-telomeric regions.

    Techniques Used: Non-Homologous End Joining, Over Expression, Construct, In Vitro, Transfection, Plasmid Preparation, FACS, Expressing, Software, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Western Blot

    18) Product Images from "Double-Strand Break Repair Assays Determine Pathway Choice and Structure of Gene Conversion Events in Drosophila melanogaster"

    Article Title: Double-Strand Break Repair Assays Determine Pathway Choice and Structure of Gene Conversion Events in Drosophila melanogaster

    Journal: G3: Genes|Genomes|Genetics

    doi: 10.1534/g3.113.010074

    DR- white.mu determines gene conversion tract direction and length. (A) DR- white.mu is similar to DR- white ( Figure 2 ), except it contains 28 silent polymorphisms along the length of the iwhite donor sequence (not to scale). For a list of the polymorphisms and exact location, see Table S1 . After I- Sce I expression and cleavage, homologous recombination using iwhite.mu as the donor sequence results in restoration of the wild-type Sac I sequence and white+ phenotype. Gene conversion tracts include at least the Sac I site (gray) and may or may not include polymorphisms to the left or right of the break (indicated by “?”). To analyze changes to the donor sequence, iwhite was amplified with primers DR- white 3 and iwhite .a (3, iwa) and sequenced. (B) To determine gene conversion direction and length, Sce.white was amplified from y+ w+ isolates with primers 1.3 and 1a, and then sequenced for conversion to the polymorphisms of the iwhite.mu donor sequence. Minimal tract lengths of 41 y+ w+ HR repair events are shown, including the last polymorphism converted. Distance converted to the left and to the right of the Sac I site (0) is given.
    Figure Legend Snippet: DR- white.mu determines gene conversion tract direction and length. (A) DR- white.mu is similar to DR- white ( Figure 2 ), except it contains 28 silent polymorphisms along the length of the iwhite donor sequence (not to scale). For a list of the polymorphisms and exact location, see Table S1 . After I- Sce I expression and cleavage, homologous recombination using iwhite.mu as the donor sequence results in restoration of the wild-type Sac I sequence and white+ phenotype. Gene conversion tracts include at least the Sac I site (gray) and may or may not include polymorphisms to the left or right of the break (indicated by “?”). To analyze changes to the donor sequence, iwhite was amplified with primers DR- white 3 and iwhite .a (3, iwa) and sequenced. (B) To determine gene conversion direction and length, Sce.white was amplified from y+ w+ isolates with primers 1.3 and 1a, and then sequenced for conversion to the polymorphisms of the iwhite.mu donor sequence. Minimal tract lengths of 41 y+ w+ HR repair events are shown, including the last polymorphism converted. Distance converted to the left and to the right of the Sac I site (0) is given.

    Techniques Used: Sequencing, Expressing, Homologous Recombination, Amplification

    DR- white and DR- white.mu measure repair of an induced DSB. (A) To analyze repair of an inducible chromosomal DSB, an I- Sce I recognition sequence is inserted into the wild-type Sac I recognition sequence of white cDNA, resulting in a defective white sequence ( Sce.white ; black). The second white sequence is defective because of 5′ and 3′ truncations ( iwhite ; gray). Integration of DR- white is targeted using the attB sequence and followed with the yellow ( y +) transgene (not to scale). Embryos and larvae containing both DR- white and a heat-shock–inducible I- Sce I transgene are heat-shocked and crossed to y w females to score individual germline repair events. (B) After I- Sce I cleavage, three phenotypes associated with DSB repair outcomes occur. (i) Noncrossover intrachromosomal HR occurs with gene conversion of the I- Sce I sequence to wild-type Sac I sequence (conversion shown in gray), resulting in white+ recombinants. (ii) Retention of the y+ w− parental phenotype occurs after intersister HR, NHEJ without processing, no DSB, or NHEJ with processing. The latter can be identified by amplification of Sce.white with primers DR- white 1 and DR- white 1a (1, 1a), followed by in vitro cleavage of the PCR product with both I- Sce I and Sac I. Junctions of NHEJ with processing events are analyzed by sequencing Sce.white PCR products. (iii) SSA results from extensive resection and annealing of direct repeats and loss of intervening y + sequence. These events are confirmed by 2.0-kb amplification across DR- white with primers DR- white 1.3 and DR- white 4a (1.3, 4a). Phenotypes of the DSB repair events and status of DSB break site sequence are given for all outcomes.
    Figure Legend Snippet: DR- white and DR- white.mu measure repair of an induced DSB. (A) To analyze repair of an inducible chromosomal DSB, an I- Sce I recognition sequence is inserted into the wild-type Sac I recognition sequence of white cDNA, resulting in a defective white sequence ( Sce.white ; black). The second white sequence is defective because of 5′ and 3′ truncations ( iwhite ; gray). Integration of DR- white is targeted using the attB sequence and followed with the yellow ( y +) transgene (not to scale). Embryos and larvae containing both DR- white and a heat-shock–inducible I- Sce I transgene are heat-shocked and crossed to y w females to score individual germline repair events. (B) After I- Sce I cleavage, three phenotypes associated with DSB repair outcomes occur. (i) Noncrossover intrachromosomal HR occurs with gene conversion of the I- Sce I sequence to wild-type Sac I sequence (conversion shown in gray), resulting in white+ recombinants. (ii) Retention of the y+ w− parental phenotype occurs after intersister HR, NHEJ without processing, no DSB, or NHEJ with processing. The latter can be identified by amplification of Sce.white with primers DR- white 1 and DR- white 1a (1, 1a), followed by in vitro cleavage of the PCR product with both I- Sce I and Sac I. Junctions of NHEJ with processing events are analyzed by sequencing Sce.white PCR products. (iii) SSA results from extensive resection and annealing of direct repeats and loss of intervening y + sequence. These events are confirmed by 2.0-kb amplification across DR- white with primers DR- white 1.3 and DR- white 4a (1.3, 4a). Phenotypes of the DSB repair events and status of DSB break site sequence are given for all outcomes.

    Techniques Used: Sequencing, Non-Homologous End Joining, Amplification, In Vitro, Polymerase Chain Reaction

    19) Product Images from "KMT Set7/9 affects genotoxic stress response via the Mdm2 axis"

    Article Title: KMT Set7/9 affects genotoxic stress response via the Mdm2 axis

    Journal: Oncotarget

    doi:

    Set7/9 knockdown impairs DNA Damage response and DNA repair A. U2-OS cells expressing control (Set9+) or Set7/9-specific shRNA (Set9–) were treated with doxorubicin for the indicated periods of time. Cell extracts for each time point were analyzed by western blotting for expression of γ-H2Ax and Rad51. Coomassie staining (loading) was used for normalization. B. U2-OS cells expressing control (Set9+) or Set7/9-specific shRNA (Set9–) were treated with doxorubicin for the indicated periods of time. At each time point the number and intensity of γ-H2Ax foci normalised to the number of cells in the well was determined for both cell lines using an automated microscopy system. Statistical analysis is done by two-way ANOVA. C. A representative experiment of the Comet assay in denaturing conditions on U2-OS control or Set7/9KD cells treated with 5 Grey of gamma-irradiation taken at different time points. Experiments were repeated at least three times with similar trend. U2-OS control cells are labeled with blue and U2-OS Set7/9KD cells are denoted with purple, respectively. D. DNA repair of double strand breaks in U2-OS control and Set7/9KD cells. The GFP reporter plasmids specific either for HR or NHEJ were digested with I-SceI restriction enzyme before being transfected into U2-OS control and Set7/9KD cells for measuring the efficiency of NHEJ or HR by flow cytometry. The efficiency of Set7/9 knockdown in U2-OS cells before the GFP repair experiment was assessed by western blotting (shown in insert).
    Figure Legend Snippet: Set7/9 knockdown impairs DNA Damage response and DNA repair A. U2-OS cells expressing control (Set9+) or Set7/9-specific shRNA (Set9–) were treated with doxorubicin for the indicated periods of time. Cell extracts for each time point were analyzed by western blotting for expression of γ-H2Ax and Rad51. Coomassie staining (loading) was used for normalization. B. U2-OS cells expressing control (Set9+) or Set7/9-specific shRNA (Set9–) were treated with doxorubicin for the indicated periods of time. At each time point the number and intensity of γ-H2Ax foci normalised to the number of cells in the well was determined for both cell lines using an automated microscopy system. Statistical analysis is done by two-way ANOVA. C. A representative experiment of the Comet assay in denaturing conditions on U2-OS control or Set7/9KD cells treated with 5 Grey of gamma-irradiation taken at different time points. Experiments were repeated at least three times with similar trend. U2-OS control cells are labeled with blue and U2-OS Set7/9KD cells are denoted with purple, respectively. D. DNA repair of double strand breaks in U2-OS control and Set7/9KD cells. The GFP reporter plasmids specific either for HR or NHEJ were digested with I-SceI restriction enzyme before being transfected into U2-OS control and Set7/9KD cells for measuring the efficiency of NHEJ or HR by flow cytometry. The efficiency of Set7/9 knockdown in U2-OS cells before the GFP repair experiment was assessed by western blotting (shown in insert).

    Techniques Used: Expressing, shRNA, Western Blot, Staining, Microscopy, Single Cell Gel Electrophoresis, Irradiation, Labeling, Non-Homologous End Joining, Transfection, Flow Cytometry, Cytometry

    20) Product Images from "Aging impairs double‐strand break repair by homologous recombination in Drosophila germ cells"

    Article Title: Aging impairs double‐strand break repair by homologous recombination in Drosophila germ cells

    Journal: Aging Cell

    doi: 10.1111/acel.12556

    HR repair of I‐SceI induced DSB s decreases with age. DSB repair is measured by I‐SceI induced DSB s using the DR ‐ white reporter. (A) The DR ‐ white assay contains two nonfunctional direct repeats of the white gene. The first repeat, Sce.white , is nonfunctional due to the insertion of an I‐SceI recognition sequence into the wild‐type white cDNA . This results in a premature STOP codon. The second repeat, iwhite , is nonfunctional due to 5′ and 3′ truncations, but contains wild‐type white sequence, including a SacI cut site, at the location correspondent to the I‐SceI site in Sce.white . DR ‐ white flies are crossed with flies containing the I ‐ SceI transgene, which results in DSB formation at the I‐SceI recognition sequence. Repair by HR results in restoration of the wild‐type sequence and a red‐eyed fly ( y + w + ) in the progeny. (B) HR repair resulting in gene conversion of the wild‐type SacI sequence can be confirmed molecularly. Sce.white gene is amplified using primers indicated in (A) (gray arrows), followed by digestion of PCR product with SacI or I‐SceI. I‐SceI cleaves only intact Sce.white sequence. SacI cleaves only HR products. (C‐D) Flies containing the DR ‐ white chromosome and the hs‐I‐SceI transgene were heat‐shocked at the indicated ages. Testes were dissected at given time point and stained for γH2Av foci. (C) IF analysis shows more γH2Av foci in spermatogonia of 29‐d.o. flies compared to 1‐d.o. flies, at 24 h after heat shock. Scale bars = 5 μm. (D) Quantification of γH2Av focus number in spermatogonia fixed prior to and at different time points after heat shock shows higher number of γH2Av foci (top) and higher frequency of cells with one or more foci (bottom) in 8‐ and 29‐d.o. flies relative to 1‐d.o. flies, at 24 h after heat shock. Error bars: SEM; * P
    Figure Legend Snippet: HR repair of I‐SceI induced DSB s decreases with age. DSB repair is measured by I‐SceI induced DSB s using the DR ‐ white reporter. (A) The DR ‐ white assay contains two nonfunctional direct repeats of the white gene. The first repeat, Sce.white , is nonfunctional due to the insertion of an I‐SceI recognition sequence into the wild‐type white cDNA . This results in a premature STOP codon. The second repeat, iwhite , is nonfunctional due to 5′ and 3′ truncations, but contains wild‐type white sequence, including a SacI cut site, at the location correspondent to the I‐SceI site in Sce.white . DR ‐ white flies are crossed with flies containing the I ‐ SceI transgene, which results in DSB formation at the I‐SceI recognition sequence. Repair by HR results in restoration of the wild‐type sequence and a red‐eyed fly ( y + w + ) in the progeny. (B) HR repair resulting in gene conversion of the wild‐type SacI sequence can be confirmed molecularly. Sce.white gene is amplified using primers indicated in (A) (gray arrows), followed by digestion of PCR product with SacI or I‐SceI. I‐SceI cleaves only intact Sce.white sequence. SacI cleaves only HR products. (C‐D) Flies containing the DR ‐ white chromosome and the hs‐I‐SceI transgene were heat‐shocked at the indicated ages. Testes were dissected at given time point and stained for γH2Av foci. (C) IF analysis shows more γH2Av foci in spermatogonia of 29‐d.o. flies compared to 1‐d.o. flies, at 24 h after heat shock. Scale bars = 5 μm. (D) Quantification of γH2Av focus number in spermatogonia fixed prior to and at different time points after heat shock shows higher number of γH2Av foci (top) and higher frequency of cells with one or more foci (bottom) in 8‐ and 29‐d.o. flies relative to 1‐d.o. flies, at 24 h after heat shock. Error bars: SEM; * P

    Techniques Used: Sequencing, Amplification, Polymerase Chain Reaction, Staining

    21) Product Images from "RAG1/2 induces genomic insertions by mobilizing DNA into RAG1/2-independent breaks"

    Article Title: RAG1/2 induces genomic insertions by mobilizing DNA into RAG1/2-independent breaks

    Journal: The Journal of Experimental Medicine

    doi: 10.1084/jem.20161638

    RAG1/2 mobilizes DNA from antibody gene segments into RAG1/2-independent DNA breaks. (A–C) Cartoon diagram to illustrate the pathways leading to insertion of RAG1/2-mobilized DNA into I-SceI breaks. Aberrant RAG1/2-mediated DNA excision at Vκ1-110 (A), Vκ3-1 (B), and Jκ1/2 (C) generates signal-end, coding-end, and hybrid-end insertions, respectively. Boxes represent Ig segments (gray) or Myc I (black), triangles indicate RSSs (green) or cRSSs (purple), red lightning points to RAG1/2 cleavage sites, and brown ellipses represent the post-cleavage complex. From top to bottom: first, RAG1/2 induces DNA breaks at paired RSSs/cRSSs. Second, DNA is aberrantly excised, and cleaved ends remain bound to the post-cleavage complex to support their repair by the NHEJ machinery. Third, excised DNA is either circularized and released from the post-cleavage complex as episomal joint (right arrow) or it escapes before end joining as linear fragment (left arrow). For signal-end insertions (A), linear DNA fragments might also originate from recleavage of episomal signal joints by RAG1/2 (dashed arrow). For coding-end and hybrid-end insertions (B and C), recleavage of episomal joints is unlikely because of the absence of paired RSSs (crossed arrows). Finally, mobilized linear DNA fragments reinsert into the genome at the I-SceI break.
    Figure Legend Snippet: RAG1/2 mobilizes DNA from antibody gene segments into RAG1/2-independent DNA breaks. (A–C) Cartoon diagram to illustrate the pathways leading to insertion of RAG1/2-mobilized DNA into I-SceI breaks. Aberrant RAG1/2-mediated DNA excision at Vκ1-110 (A), Vκ3-1 (B), and Jκ1/2 (C) generates signal-end, coding-end, and hybrid-end insertions, respectively. Boxes represent Ig segments (gray) or Myc I (black), triangles indicate RSSs (green) or cRSSs (purple), red lightning points to RAG1/2 cleavage sites, and brown ellipses represent the post-cleavage complex. From top to bottom: first, RAG1/2 induces DNA breaks at paired RSSs/cRSSs. Second, DNA is aberrantly excised, and cleaved ends remain bound to the post-cleavage complex to support their repair by the NHEJ machinery. Third, excised DNA is either circularized and released from the post-cleavage complex as episomal joint (right arrow) or it escapes before end joining as linear fragment (left arrow). For signal-end insertions (A), linear DNA fragments might also originate from recleavage of episomal signal joints by RAG1/2 (dashed arrow). For coding-end and hybrid-end insertions (B and C), recleavage of episomal joints is unlikely because of the absence of paired RSSs (crossed arrows). Finally, mobilized linear DNA fragments reinsert into the genome at the I-SceI break.

    Techniques Used: Non-Homologous End Joining

    Rearrangements between I-SceI and RAG1/2 core -induced DNA breaks at Igκ . (A) Overview of rearrangement breakpoints at the Igκ locus on chromosome 6. Histogram of the number of breakpoints in the presence or absence of RAG2 core (red and black, respectively) in 10-kb intervals. RAG1/2 core -dependent rearrangement breakpoint clusters are indicated by red triangles and labeled with the corresponding Jκ or Vκ gene segment. Asterisks mark breakpoint clusters with biased rearrangements (see B–D). Chromosome coordinates and scale bar are indicated on top. (B–D) Examples of RAG1/2 core -dependent breakpoint clusters at Jκs and Vκs. On top is a diagram of the region, with gray boxes representing Ig segments, triangles indicating 12/23RSSs (green) or cRSSs (purple), and red bars indicating the breakpoint clusters. In the middle is a histogram showing the number and position of breakpoints (Bp, red). At the bottom, each horizontal line indicates a unique rearrangement (Rx), with its breakpoint represented by the vertical line and its sheared end (which determines the uniqueness of the event) shown by the box. Color coding indicates whether rearrangements contain RSSs/cRSSs (green/purple, signal ends) or not (gray, coding ends). Rearrangements in black are undefined. Chromosome coordinates and scale bar are indicated on top. Data analysis was performed with pooled RAG2 core and RAG2 −/− TC-Seq libraries (two independent experiments each). See also Fig. S2 (A–C) and Tables S1 and S2.
    Figure Legend Snippet: Rearrangements between I-SceI and RAG1/2 core -induced DNA breaks at Igκ . (A) Overview of rearrangement breakpoints at the Igκ locus on chromosome 6. Histogram of the number of breakpoints in the presence or absence of RAG2 core (red and black, respectively) in 10-kb intervals. RAG1/2 core -dependent rearrangement breakpoint clusters are indicated by red triangles and labeled with the corresponding Jκ or Vκ gene segment. Asterisks mark breakpoint clusters with biased rearrangements (see B–D). Chromosome coordinates and scale bar are indicated on top. (B–D) Examples of RAG1/2 core -dependent breakpoint clusters at Jκs and Vκs. On top is a diagram of the region, with gray boxes representing Ig segments, triangles indicating 12/23RSSs (green) or cRSSs (purple), and red bars indicating the breakpoint clusters. In the middle is a histogram showing the number and position of breakpoints (Bp, red). At the bottom, each horizontal line indicates a unique rearrangement (Rx), with its breakpoint represented by the vertical line and its sheared end (which determines the uniqueness of the event) shown by the box. Color coding indicates whether rearrangements contain RSSs/cRSSs (green/purple, signal ends) or not (gray, coding ends). Rearrangements in black are undefined. Chromosome coordinates and scale bar are indicated on top. Data analysis was performed with pooled RAG2 core and RAG2 −/− TC-Seq libraries (two independent experiments each). See also Fig. S2 (A–C) and Tables S1 and S2.

    Techniques Used: Labeling

    Insertions of RAG1/2 core -mobilized DNA into the I-SceI site. (A) Overview of insertions originating from the Igκ locus on chromosome 6. Histogram of the number of insertions derived from each site in the presence or absence of RAG2 core (blue and black, respectively) in 10-kb intervals. RAG1/2 core -dependent rearrangement breakpoint clusters at Jκs and Vκs (triangles, same as in Fig. 2 A ) are color coded to indicate whether insertions from these sites are detected (blue) or not (red). Asterisks mark breakpoint clusters with biased rearrangements (see Fig. 2 [B–D] ). No insertions from Igκ were detected in RAG2 −/− cells. Chromosome coordinates and scale bar are indicated on top. (B–D) Examples of insertions derived from RAG1/2 core -dependent breakpoint clusters at Jκs and Vκs. On top is a diagram of the region, with gray boxes representing Ig segments, triangles indicating 12/23RSSs (green) or cRSSs (purple), and red bars indicating the breakpoint clusters (same as in Fig. 2 [B–D] ). In the middle is a histogram showing the number and position of breakpoints (Bp, red). At the bottom, each horizontal line indicates a unique insertion (Ins), with its breakpoints represented by the vertical lines at the ends. Arrows represent insertions for which only one of the two breakpoints could be identified. Chromosome coordinates and scale bar are indicated on top. Data analysis was performed with pooled RAG2 core and RAG2 −/− TC-Seq libraries (two independent experiments each). See also Table S3.
    Figure Legend Snippet: Insertions of RAG1/2 core -mobilized DNA into the I-SceI site. (A) Overview of insertions originating from the Igκ locus on chromosome 6. Histogram of the number of insertions derived from each site in the presence or absence of RAG2 core (blue and black, respectively) in 10-kb intervals. RAG1/2 core -dependent rearrangement breakpoint clusters at Jκs and Vκs (triangles, same as in Fig. 2 A ) are color coded to indicate whether insertions from these sites are detected (blue) or not (red). Asterisks mark breakpoint clusters with biased rearrangements (see Fig. 2 [B–D] ). No insertions from Igκ were detected in RAG2 −/− cells. Chromosome coordinates and scale bar are indicated on top. (B–D) Examples of insertions derived from RAG1/2 core -dependent breakpoint clusters at Jκs and Vκs. On top is a diagram of the region, with gray boxes representing Ig segments, triangles indicating 12/23RSSs (green) or cRSSs (purple), and red bars indicating the breakpoint clusters (same as in Fig. 2 [B–D] ). In the middle is a histogram showing the number and position of breakpoints (Bp, red). At the bottom, each horizontal line indicates a unique insertion (Ins), with its breakpoints represented by the vertical lines at the ends. Arrows represent insertions for which only one of the two breakpoints could be identified. Chromosome coordinates and scale bar are indicated on top. Data analysis was performed with pooled RAG2 core and RAG2 −/− TC-Seq libraries (two independent experiments each). See also Table S3.

    Techniques Used: Derivative Assay

    Landscape of insertions in primary pro–B cells by TC-Seq. (A) Cartoon diagram comparing RAG1/2 core -induced translocations and insertions. In a translocation (red), RAG1/2 core introduces a single DNA break (red lightning) that recombines with the cleaved I-SceI site at Myc I (black lightning) on chromosome 15. The resulting translocation contains Myc I only on one side. In an insertion (blue), RAG1/2 core causes tandem DNA breaks (blue lightning), thereby excising a DNA fragment that subsequently reintegrates into the cleaved I-SceI site. The resulting insertion is flanked by Myc I on both sides. (B) Origin of insertions by chromosome. Events were normalized per megabase to account for different chromosome sizes. (C) Profile of insertions near the I-SceI site in 5-kb intervals. Dashed lines indicate the ±20-kb region excluded from the analysis for D–F because of saturation. (D) Proportion of insertions from genic regions. (E) Frequency of insertions derived from differentially transcribed genes compared with a random model (dashed line). Asterisks indicate values significantly different from random (P
    Figure Legend Snippet: Landscape of insertions in primary pro–B cells by TC-Seq. (A) Cartoon diagram comparing RAG1/2 core -induced translocations and insertions. In a translocation (red), RAG1/2 core introduces a single DNA break (red lightning) that recombines with the cleaved I-SceI site at Myc I (black lightning) on chromosome 15. The resulting translocation contains Myc I only on one side. In an insertion (blue), RAG1/2 core causes tandem DNA breaks (blue lightning), thereby excising a DNA fragment that subsequently reintegrates into the cleaved I-SceI site. The resulting insertion is flanked by Myc I on both sides. (B) Origin of insertions by chromosome. Events were normalized per megabase to account for different chromosome sizes. (C) Profile of insertions near the I-SceI site in 5-kb intervals. Dashed lines indicate the ±20-kb region excluded from the analysis for D–F because of saturation. (D) Proportion of insertions from genic regions. (E) Frequency of insertions derived from differentially transcribed genes compared with a random model (dashed line). Asterisks indicate values significantly different from random (P

    Techniques Used: Translocation Assay, Derivative Assay

    Landscape of chromosomal rearrangements in primary pro–B cells by TC-Seq. (A) Detection of RAG1/2 core -induced chromosomal rearrangements by TC-Seq. Primary RAG2 −/− Myc I/I pro–B cells were infected ex vivo with retroviruses that express either I-SceI alone (RAG2 −/− TC-Seq libraries) or I-SceI together with murine RAG2 core (RAG2 core TC-Seq libraries) by using a “self-cleaving” P2A peptide. DNA breaks, such as those induced by RAG1/2 core at Igκ on chromosome 6 (red lightning), rearrange to the I-SceI break at c- myc on chromosome 15 (black lightning) and are subsequently amplified by PCR, deep-sequenced, and analyzed computationally. RAG2 core and RAG2 −/− TC-Seq libraries were prepared in independent duplicates from infected pro–B cells of 180 mice. (B) Chromosomal distribution of rearrangements. Events were normalized per megabase to account for different chromosome sizes. (C) Profile of rearrangements around the I-SceI site in 5-kb intervals. Dashed lines indicate the ±50-kb region excluded from the analysis for D–F because of saturation. (D) Proportion of genic rearrangements. (E) Frequency of rearrangements derived from differentially transcribed genes compared with a random model (dashed line). Asterisks indicate values significantly different from random (P
    Figure Legend Snippet: Landscape of chromosomal rearrangements in primary pro–B cells by TC-Seq. (A) Detection of RAG1/2 core -induced chromosomal rearrangements by TC-Seq. Primary RAG2 −/− Myc I/I pro–B cells were infected ex vivo with retroviruses that express either I-SceI alone (RAG2 −/− TC-Seq libraries) or I-SceI together with murine RAG2 core (RAG2 core TC-Seq libraries) by using a “self-cleaving” P2A peptide. DNA breaks, such as those induced by RAG1/2 core at Igκ on chromosome 6 (red lightning), rearrange to the I-SceI break at c- myc on chromosome 15 (black lightning) and are subsequently amplified by PCR, deep-sequenced, and analyzed computationally. RAG2 core and RAG2 −/− TC-Seq libraries were prepared in independent duplicates from infected pro–B cells of 180 mice. (B) Chromosomal distribution of rearrangements. Events were normalized per megabase to account for different chromosome sizes. (C) Profile of rearrangements around the I-SceI site in 5-kb intervals. Dashed lines indicate the ±50-kb region excluded from the analysis for D–F because of saturation. (D) Proportion of genic rearrangements. (E) Frequency of rearrangements derived from differentially transcribed genes compared with a random model (dashed line). Asterisks indicate values significantly different from random (P

    Techniques Used: Infection, Ex Vivo, Amplification, Polymerase Chain Reaction, Mouse Assay, Derivative Assay

    Insertions at the I-SceI site induced by wild-type RAG1/2. (A) Detection of chromosomal insertions by IC-Seq. Primary ROSA erISCEI Myc I/I Igh I/I (and ROSA erISCEI Myc I/I Igh I/I AID −/− , see Materials and methods) bone marrow B cells were treated ex vivo with tamoxifen to induce I-SceI breaks at c- myc on chromosome 15 (black lightning). Mobilized DNA fragments, such as those excised by endogenous RAG1/2 from Igκ on chromosome 6 (blue lightning), reinsert into the cleaved I-SceI site and are subsequently amplified by PCR, deep-sequenced, and analyzed computationally. Two RAG1/2 wild-type IC-Seq libraries were independently prepared from tamoxifen-treated bone marrow B cells of 12 mice. (B–D) Qualitative comparison of insertions obtained by TC-Seq (RAG1/2 core ) and IC-Seq (RAG1/2 wild type). On top is a diagram of the region, with gray boxes representing Ig segments and triangles indicating 12/23RSSs (green) or cRSSs (purple). Below, insertions detected by TC-Seq (Ins, same as in Fig. 5 [B–D] ) and IC-Seq (IC). Each horizontal line indicates a unique insertion, with its breakpoints represented by the vertical lines at the ends. Arrows represent insertions for which only one of the two breakpoints could be identified. Chromosome coordinates and scale bar are indicated on top. Data analysis was performed with pooled IC-Seq libraries (two independent experiments). See also Table S3.
    Figure Legend Snippet: Insertions at the I-SceI site induced by wild-type RAG1/2. (A) Detection of chromosomal insertions by IC-Seq. Primary ROSA erISCEI Myc I/I Igh I/I (and ROSA erISCEI Myc I/I Igh I/I AID −/− , see Materials and methods) bone marrow B cells were treated ex vivo with tamoxifen to induce I-SceI breaks at c- myc on chromosome 15 (black lightning). Mobilized DNA fragments, such as those excised by endogenous RAG1/2 from Igκ on chromosome 6 (blue lightning), reinsert into the cleaved I-SceI site and are subsequently amplified by PCR, deep-sequenced, and analyzed computationally. Two RAG1/2 wild-type IC-Seq libraries were independently prepared from tamoxifen-treated bone marrow B cells of 12 mice. (B–D) Qualitative comparison of insertions obtained by TC-Seq (RAG1/2 core ) and IC-Seq (RAG1/2 wild type). On top is a diagram of the region, with gray boxes representing Ig segments and triangles indicating 12/23RSSs (green) or cRSSs (purple). Below, insertions detected by TC-Seq (Ins, same as in Fig. 5 [B–D] ) and IC-Seq (IC). Each horizontal line indicates a unique insertion, with its breakpoints represented by the vertical lines at the ends. Arrows represent insertions for which only one of the two breakpoints could be identified. Chromosome coordinates and scale bar are indicated on top. Data analysis was performed with pooled IC-Seq libraries (two independent experiments). See also Table S3.

    Techniques Used: Ex Vivo, Amplification, Polymerase Chain Reaction, Mouse Assay

    22) Product Images from "Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants"

    Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0190526

    Multigene cloning with Plant X-tender expression vectors. Two expression cassettes were cloned into pCAMBIA_ASX and introduced into N . benthamiana . (A-F) Scheme of cloning procedure. (A) Amplification of expression cassette from template plasmid using primers with appropriate 5’ and 3’ extension homologies in the case of p35S::H2BRFP_tNOS expression cassette. PCR amplification of subunits (pNOS, ECFP, t35S) u sing custom-designed primers with appropriate 5’ extensions to add overlaps between the individual subunits and chosen Level 0 plasmid in the case of pNOS::ECFP_t35S expression cassette. (B) Assembly of subunits into Hin dIII digested Level 0 vectors by NEBuilder HiFi assembly method. Only the restriction of Level 0 vector with A0/A1 homology regions is shown. (C) Assembled cassettes flanked by homology regions were released from the backbone using Pme I. (D) Assembly of expression cassettes into Pac I digested Level 1 vector by TAR or NEBuilder HiFi. (E) Release of the multigene construct from Level 1 vector using I- Sce I homing endonuclease, cutting outside the homology regions A0 and B0. (F) Assembly of two expression cassettes and yeast selection marker ( URA3 ) into Hin dIII digested Plant X-tender expression vectors with SLiCE of NEBuilder HiFi. (G–J) Images of agroinfiltrated N . benthamiana leaves obtained by laser scanning confocal microscopy. Leaves were agroinfiltrated with agrobacteria containing pCAMBIA_ASX_multigene (upper panel) or with empty A . tumefaciens (bottom panel). (G) Nuclear localisation of RFP. Fluorescence is represented as a maximum projection of z-stacks. (H) ECFP is localised in the cytoplasm. Fluorescence is represented as maximum projections of z-stacks. (I) Bright field. (J) Overlay of G, H and I. Scale bars are 100 μm. p35S: cauliflower mosaic virus CaMV 35S promoter, H2BRFP: histon sequence fused to red fluorescence protein (mRFP1), tNOS: nopaline synthase terminator, pNOS: nopaline synthase promoter, ECFP: cyan fluorescent protein, t35S: cauliflower mosaic virus CaMV 35S terminator, A0, A1 AR, B0: homology regions, Rp: selection marker conferring hygromycin resistance in plants, Re: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , LB: left border of T-DNA, RB: right border of T-DNA, Hin dIII, I- Sce I, Pac I, Asc I, Sbf I, Swa I, Fse I, Pme I: restriction enzyme recognition sites, URA3 : yeast selection marker, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method. TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, ASX: Plant X-tender expression vector.
    Figure Legend Snippet: Multigene cloning with Plant X-tender expression vectors. Two expression cassettes were cloned into pCAMBIA_ASX and introduced into N . benthamiana . (A-F) Scheme of cloning procedure. (A) Amplification of expression cassette from template plasmid using primers with appropriate 5’ and 3’ extension homologies in the case of p35S::H2BRFP_tNOS expression cassette. PCR amplification of subunits (pNOS, ECFP, t35S) u sing custom-designed primers with appropriate 5’ extensions to add overlaps between the individual subunits and chosen Level 0 plasmid in the case of pNOS::ECFP_t35S expression cassette. (B) Assembly of subunits into Hin dIII digested Level 0 vectors by NEBuilder HiFi assembly method. Only the restriction of Level 0 vector with A0/A1 homology regions is shown. (C) Assembled cassettes flanked by homology regions were released from the backbone using Pme I. (D) Assembly of expression cassettes into Pac I digested Level 1 vector by TAR or NEBuilder HiFi. (E) Release of the multigene construct from Level 1 vector using I- Sce I homing endonuclease, cutting outside the homology regions A0 and B0. (F) Assembly of two expression cassettes and yeast selection marker ( URA3 ) into Hin dIII digested Plant X-tender expression vectors with SLiCE of NEBuilder HiFi. (G–J) Images of agroinfiltrated N . benthamiana leaves obtained by laser scanning confocal microscopy. Leaves were agroinfiltrated with agrobacteria containing pCAMBIA_ASX_multigene (upper panel) or with empty A . tumefaciens (bottom panel). (G) Nuclear localisation of RFP. Fluorescence is represented as a maximum projection of z-stacks. (H) ECFP is localised in the cytoplasm. Fluorescence is represented as maximum projections of z-stacks. (I) Bright field. (J) Overlay of G, H and I. Scale bars are 100 μm. p35S: cauliflower mosaic virus CaMV 35S promoter, H2BRFP: histon sequence fused to red fluorescence protein (mRFP1), tNOS: nopaline synthase terminator, pNOS: nopaline synthase promoter, ECFP: cyan fluorescent protein, t35S: cauliflower mosaic virus CaMV 35S terminator, A0, A1 AR, B0: homology regions, Rp: selection marker conferring hygromycin resistance in plants, Re: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , LB: left border of T-DNA, RB: right border of T-DNA, Hin dIII, I- Sce I, Pac I, Asc I, Sbf I, Swa I, Fse I, Pme I: restriction enzyme recognition sites, URA3 : yeast selection marker, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method. TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, ASX: Plant X-tender expression vector.

    Techniques Used: Clone Assay, Expressing, Amplification, Plasmid Preparation, Polymerase Chain Reaction, Construct, Selection, Marker, Confocal Microscopy, Fluorescence, Sequencing, Ligation, Transformation Assay

    Design of Plant X-tender expression vectors. Vector pCAMBIA 1300 (A) or Gateway vectors (pK7WG, pH7WG or pB7WG) (B) were used as a backbone. (A) I- Sce I–A0– Hin dIII– ccd B– Hin dIII–B0–I- Sce I cassette was introduced into the MCS region of pCAMBIA1300 by overlap-based cloning methods after backbone digestion with Bam HI and Hin dIII to obtain pCAMBIA_ASX. (B) T35S–AttR2– ccd B–AttR1 cassette was released from the Gateway plasmid backbone by digestion with Xba I and Sac I and replaced with a I- Sce I–A0– Hin dIII– ccd B– Hin dIII–B0–I- Sce I cassette by overlap-based cloning methods to obtain pK7WG_ASX, pH7WG_ASX or pB7WG_ASX. MCS: multiple cloning site, A0/B0: homology regions, Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , Spec: selection marker conferring spectinomycin resistance in E . coli and A . tumefaciens , Hyg: selection marker conferring hygromycin resistance in plants, R: selection marker conferring resistance in plants (kanamycin resistance in pK7WG, hygromycin resistance in pH7WG, herbicide glufosinate-ammonium resistance in pB7WG), LB: left border of T-DNA, RB: right border of T-DNA, ccd B: bacterial suicide gene, Hin dIII, I- Sce I, Bam HI, Xba I, Sac I: restriction enzyme recognition sites, AttR1/AttR2: Gateway cloning recombination sites, T35S: cauliflower mosaic virus CaMV 35S terminator, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method.
    Figure Legend Snippet: Design of Plant X-tender expression vectors. Vector pCAMBIA 1300 (A) or Gateway vectors (pK7WG, pH7WG or pB7WG) (B) were used as a backbone. (A) I- Sce I–A0– Hin dIII– ccd B– Hin dIII–B0–I- Sce I cassette was introduced into the MCS region of pCAMBIA1300 by overlap-based cloning methods after backbone digestion with Bam HI and Hin dIII to obtain pCAMBIA_ASX. (B) T35S–AttR2– ccd B–AttR1 cassette was released from the Gateway plasmid backbone by digestion with Xba I and Sac I and replaced with a I- Sce I–A0– Hin dIII– ccd B– Hin dIII–B0–I- Sce I cassette by overlap-based cloning methods to obtain pK7WG_ASX, pH7WG_ASX or pB7WG_ASX. MCS: multiple cloning site, A0/B0: homology regions, Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , Spec: selection marker conferring spectinomycin resistance in E . coli and A . tumefaciens , Hyg: selection marker conferring hygromycin resistance in plants, R: selection marker conferring resistance in plants (kanamycin resistance in pK7WG, hygromycin resistance in pH7WG, herbicide glufosinate-ammonium resistance in pB7WG), LB: left border of T-DNA, RB: right border of T-DNA, ccd B: bacterial suicide gene, Hin dIII, I- Sce I, Bam HI, Xba I, Sac I: restriction enzyme recognition sites, AttR1/AttR2: Gateway cloning recombination sites, T35S: cauliflower mosaic virus CaMV 35S terminator, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method.

    Techniques Used: Expressing, Plasmid Preparation, Clone Assay, Selection, Marker, Ligation

    Functional evaluation of constructed vectors by cloning expression cassette p35S::H2BRFP_tNOS into Plant X-tender expression vectors. (A-F) Scheme of the cloning procedure. (A) Amplification of expression cassette from template plasmid using primers with appropriate 5’ and 3’ extensions to add A0 and AR homology regions. (B) Expression cassette assembly in Hin dIII restricted pL0A_0-R Level 0 vector by NEBuilder HiFi assembly method. (C) Release of expression cassette with flanking homology regions A0 and AR from Level 0 vector by Pme I digestion. (D) Assembly of expression cassette with flanking homology regions A0 and AR into Pac I digested pL1A-hc / pL1A-lc (A0/AR) Level 1 vector by TAR or NEBuilder HiFi. (E) Release of expression cassette flanked by URA3 yeast selection marker and homology regions A0 and B0 from Level 1 vector by I- Sce I digestion. (F) Assembly of expression cassette flanked by URA3 yeast selection marker and homology regions A0 and B0 into Plant X-tender expression vectors by SLiCE or NEBuilder HiFi. (G-I) Images of agroinfiltrated N . benthamiana leaves obtained by laser scanning confocal microscopy. Leaves were agroinfiltrated with agrobacteria containing pCAMBIA_ASX_cassette, pK7WG_ASX_cassette, pH7WG_ASX_cassette, pB7WG_ASX_cassette or empty agrobacteria (top to bottom). (G) Nuclear localisation of RFP. Fluorescence is represented as maximum projections of z-stacks. (H) Bright field. (I) Overlay of G with H. Scale bars are 100 μm. p35S: cauliflower mosaic virus CaMV 35S promoter, H2BRFP: histon sequence fused to red fluorescence protein (mRFP1), tNOS: nopaline synthase terminator, A0, AR, B0: homology regions, Rp: selection marker conferring resistance in plants (hygromycin in the case of pCAMBIA_ASX and pH7WG_ASX, kanamycin in the case of pK7WG_ASX, glufosinate-ammonium in the case of pB7WG_ASX), Re: selection marker conferring resistance in E . coli and A . tumefaciens (kanamycin in the case of pCAMBIA_ASX, spectinomycinin in the case of pK7WG_ASX, pH7WG_ASX and pB7WG_ASX), Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , LB: left border of T-DNA, RB: right border of T-DNA, Hin dIII, I- Sce I, Pac I, Pme I: restriction enzyme recognition sites, URA3 : yeast selection marker, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method, TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, ASX: Plant X-tender expression vector.
    Figure Legend Snippet: Functional evaluation of constructed vectors by cloning expression cassette p35S::H2BRFP_tNOS into Plant X-tender expression vectors. (A-F) Scheme of the cloning procedure. (A) Amplification of expression cassette from template plasmid using primers with appropriate 5’ and 3’ extensions to add A0 and AR homology regions. (B) Expression cassette assembly in Hin dIII restricted pL0A_0-R Level 0 vector by NEBuilder HiFi assembly method. (C) Release of expression cassette with flanking homology regions A0 and AR from Level 0 vector by Pme I digestion. (D) Assembly of expression cassette with flanking homology regions A0 and AR into Pac I digested pL1A-hc / pL1A-lc (A0/AR) Level 1 vector by TAR or NEBuilder HiFi. (E) Release of expression cassette flanked by URA3 yeast selection marker and homology regions A0 and B0 from Level 1 vector by I- Sce I digestion. (F) Assembly of expression cassette flanked by URA3 yeast selection marker and homology regions A0 and B0 into Plant X-tender expression vectors by SLiCE or NEBuilder HiFi. (G-I) Images of agroinfiltrated N . benthamiana leaves obtained by laser scanning confocal microscopy. Leaves were agroinfiltrated with agrobacteria containing pCAMBIA_ASX_cassette, pK7WG_ASX_cassette, pH7WG_ASX_cassette, pB7WG_ASX_cassette or empty agrobacteria (top to bottom). (G) Nuclear localisation of RFP. Fluorescence is represented as maximum projections of z-stacks. (H) Bright field. (I) Overlay of G with H. Scale bars are 100 μm. p35S: cauliflower mosaic virus CaMV 35S promoter, H2BRFP: histon sequence fused to red fluorescence protein (mRFP1), tNOS: nopaline synthase terminator, A0, AR, B0: homology regions, Rp: selection marker conferring resistance in plants (hygromycin in the case of pCAMBIA_ASX and pH7WG_ASX, kanamycin in the case of pK7WG_ASX, glufosinate-ammonium in the case of pB7WG_ASX), Re: selection marker conferring resistance in E . coli and A . tumefaciens (kanamycin in the case of pCAMBIA_ASX, spectinomycinin in the case of pK7WG_ASX, pH7WG_ASX and pB7WG_ASX), Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , LB: left border of T-DNA, RB: right border of T-DNA, Hin dIII, I- Sce I, Pac I, Pme I: restriction enzyme recognition sites, URA3 : yeast selection marker, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method, TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, ASX: Plant X-tender expression vector.

    Techniques Used: Functional Assay, Construct, Clone Assay, Expressing, Amplification, Plasmid Preparation, Selection, Marker, Confocal Microscopy, Fluorescence, Sequencing, Ligation, Transformation Assay, Polymerase Chain Reaction

    Plant X-tender cloning strategy. Diagram showing example of assembly of two expression cassettes into a plant expression vector using Plant X-tender. Definition of parts and design of Level 0 units is done using GenoCAD. Design of multigene cassettes and computation of primers is performed using the AssemblX webtool. (A-D) Assembly of two expression cassettes into a Level 1 vector. (A) PCR amplification of subunits (e.g. promoter, CDS, terminator) using custom-designed primers with appropriate 5’ extensions to add overlaps between the individual subunits and chosen Level 0 plasmid. (B) Assembly of subunits into Hin dIII digested Level 0 vectors via overlap-based assembly methods. Only the restriction of Level 0 vector with A0/A1 homology regions is shown. (C) Assembled cassettes flanked by homology regions are released from the backbone using one of five rare 8-base cutter recognition sites ( Asc I, Sbf I, Swa I, Fsa I, Pme I) flanking the homology regions. (D) Assembly of expression cassettes into Pac I digested Level 1 vector by of the preferred overlap-based assembly method. (E-G) Multigene assembly into Plant X-tender expression vector. (E) Digestion with I- Sce I allows the release of a multigene construct flanked by homology regions A0 and B0 from the Level 1 AssemblX vector. (F) Hin dIII digestion enables the linearization of Plant X-tender expression vector and the release of ccd B cassette prior the assembly. (G) Assembly of a multigene construct and a yeast selection marker ( URA3 ) flanked by homology regions into Plant X-tender expression vector by overlap-based methods exploiting homologous recombination between the homology regions A0 and B0 of the Plant X-tender expression vector and the homology regions A0 and B0 of the insert. A0, A1, AR, B0: homology regions, Hin dIII, I- Sce I, Pac I, Asc I, Sbf I, Swa I, Fse I, Pme I: restriction enzyme recognition sites, Rp: selection marker conferring resistance in plants, Re: selection marker conferring resistance in E . coli and A . tumefaciens , Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , URA3 : yeast selection marker, LB: left border of T-DNA, RB: right border of T-DNA, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: HiFi DNA assembly method, Gibson: Gibson DNA assembly method, TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, CDS: coding sequence, ASX: Plant X-tender expression vector.
    Figure Legend Snippet: Plant X-tender cloning strategy. Diagram showing example of assembly of two expression cassettes into a plant expression vector using Plant X-tender. Definition of parts and design of Level 0 units is done using GenoCAD. Design of multigene cassettes and computation of primers is performed using the AssemblX webtool. (A-D) Assembly of two expression cassettes into a Level 1 vector. (A) PCR amplification of subunits (e.g. promoter, CDS, terminator) using custom-designed primers with appropriate 5’ extensions to add overlaps between the individual subunits and chosen Level 0 plasmid. (B) Assembly of subunits into Hin dIII digested Level 0 vectors via overlap-based assembly methods. Only the restriction of Level 0 vector with A0/A1 homology regions is shown. (C) Assembled cassettes flanked by homology regions are released from the backbone using one of five rare 8-base cutter recognition sites ( Asc I, Sbf I, Swa I, Fsa I, Pme I) flanking the homology regions. (D) Assembly of expression cassettes into Pac I digested Level 1 vector by of the preferred overlap-based assembly method. (E-G) Multigene assembly into Plant X-tender expression vector. (E) Digestion with I- Sce I allows the release of a multigene construct flanked by homology regions A0 and B0 from the Level 1 AssemblX vector. (F) Hin dIII digestion enables the linearization of Plant X-tender expression vector and the release of ccd B cassette prior the assembly. (G) Assembly of a multigene construct and a yeast selection marker ( URA3 ) flanked by homology regions into Plant X-tender expression vector by overlap-based methods exploiting homologous recombination between the homology regions A0 and B0 of the Plant X-tender expression vector and the homology regions A0 and B0 of the insert. A0, A1, AR, B0: homology regions, Hin dIII, I- Sce I, Pac I, Asc I, Sbf I, Swa I, Fse I, Pme I: restriction enzyme recognition sites, Rp: selection marker conferring resistance in plants, Re: selection marker conferring resistance in E . coli and A . tumefaciens , Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , URA3 : yeast selection marker, LB: left border of T-DNA, RB: right border of T-DNA, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: HiFi DNA assembly method, Gibson: Gibson DNA assembly method, TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, CDS: coding sequence, ASX: Plant X-tender expression vector.

    Techniques Used: Clone Assay, Expressing, Plasmid Preparation, Polymerase Chain Reaction, Amplification, Construct, Selection, Marker, Homologous Recombination, Ligation, Transformation Assay, Sequencing

    23) Product Images from "Aptamer-guided gene targeting in yeast and human cells"

    Article Title: Aptamer-guided gene targeting in yeast and human cells

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gku101

    The I-SceI aptamer stimulates gene targeting at the DsRed2 locus in human cells. ( A ) Flow cytometry analysis of several transfections in HEK-293 cells, the different samples are shown on the X axis with aptamer-containing oligonucleotides in light grey and non-binding control oligonucleotides in dark grey and the number of RFP + cells per 100 000 cells is shown on the Y axis. Negative controls were the cells alone (no DNA, only transfection reagent alone), the I-SceI expression vector alone (pSce), the targeted vector (pLDSLm) that contained the DsRed2 gene disrupted with two stop codons and the I-SceI site alone and the individual oligonucleotides alone. Transfections of oligonucleotides with both pSce and pLDSLm added are bracketed. ( B ) Hand counts of each transfection were done in HEK-293 cells in lieu of flow cytometry, which was overreporting the number of background RFP + cells for the shorter oligonucleotides. The different samples are shown on the X axis and the number of RFP + cells per 150 000 cells seeded is shown on the Y axis. Negative controls did not show any RFP + cells. ( C ) Flow cytometry analysis of transfections of the in vitro digested pLDSLm vector, the different samples shown on the X axis and the number of RFP + cells per 100 000 cells is shown on the Y axis. Negative controls were the cells alone (no DNA), the digested vector alone and the individual oligonucleotides alone. Transfections with both the digested vector and an oligonucleotide are bracketed. Bars correspond to the mean value and error bars represent 95% confidence intervals. Asterisks denote statistical significant difference between the aptamer-containing oligonucleotide and the corresponding non-binding control (* P
    Figure Legend Snippet: The I-SceI aptamer stimulates gene targeting at the DsRed2 locus in human cells. ( A ) Flow cytometry analysis of several transfections in HEK-293 cells, the different samples are shown on the X axis with aptamer-containing oligonucleotides in light grey and non-binding control oligonucleotides in dark grey and the number of RFP + cells per 100 000 cells is shown on the Y axis. Negative controls were the cells alone (no DNA, only transfection reagent alone), the I-SceI expression vector alone (pSce), the targeted vector (pLDSLm) that contained the DsRed2 gene disrupted with two stop codons and the I-SceI site alone and the individual oligonucleotides alone. Transfections of oligonucleotides with both pSce and pLDSLm added are bracketed. ( B ) Hand counts of each transfection were done in HEK-293 cells in lieu of flow cytometry, which was overreporting the number of background RFP + cells for the shorter oligonucleotides. The different samples are shown on the X axis and the number of RFP + cells per 150 000 cells seeded is shown on the Y axis. Negative controls did not show any RFP + cells. ( C ) Flow cytometry analysis of transfections of the in vitro digested pLDSLm vector, the different samples shown on the X axis and the number of RFP + cells per 100 000 cells is shown on the Y axis. Negative controls were the cells alone (no DNA), the digested vector alone and the individual oligonucleotides alone. Transfections with both the digested vector and an oligonucleotide are bracketed. Bars correspond to the mean value and error bars represent 95% confidence intervals. Asterisks denote statistical significant difference between the aptamer-containing oligonucleotide and the corresponding non-binding control (* P

    Techniques Used: Flow Cytometry, Cytometry, Transfection, Binding Assay, Expressing, Plasmid Preparation, In Vitro

    24) Product Images from "Local generation of fumarate promotes DNA repair through inhibition of histone H3 demethylation"

    Article Title: Local generation of fumarate promotes DNA repair through inhibition of histone H3 demethylation

    Journal: Nature cell biology

    doi: 10.1038/ncb3209

    DNA-PK-phosphorylated FH promotes the DNA-PK complex accumulation at DSB regions and NHEJ a , Thymidine double block-synchronized U2OS cells with depleted endogenous FH and reconstituted expression of the indicated FH proteins were exposed to IR (10 Gy) and harvested 1 h after IR. Chromatin extracts or total cell lysates were prepared. b , DR-GFP-expressed U2OS cells with depleted endogenous FH and reconstituted expression of the indicated FH proteins were transfected with a vector with or without expressing I- SceI . ChIP analyses with antibodies that recognize FH (left panel) or Ku70 (right panel) and F1/R1 primers for the PCR were performed at the indicated time points after I- SceI transfection. The y-axis stands for the value of the I- SceI -induced fold increase of specific protein binding (the IP value was normalized to the input). The data represent the mean ± SD (n=3 independent experiments). c, d , DR-GFP-expressed U2OS cells with depleted endogenous FH and reconstituted expression of the indicated FH proteins were transfected with a vector with or without expressing I- SceI . PCR analyses for NHEJ were performed 42 h after transfection. A representative image of PCR products digested by I- SceI and BcgI is shown (left panel). The data represent the mean ± SD (n=3 independent experiments, right panel). * stands for P
    Figure Legend Snippet: DNA-PK-phosphorylated FH promotes the DNA-PK complex accumulation at DSB regions and NHEJ a , Thymidine double block-synchronized U2OS cells with depleted endogenous FH and reconstituted expression of the indicated FH proteins were exposed to IR (10 Gy) and harvested 1 h after IR. Chromatin extracts or total cell lysates were prepared. b , DR-GFP-expressed U2OS cells with depleted endogenous FH and reconstituted expression of the indicated FH proteins were transfected with a vector with or without expressing I- SceI . ChIP analyses with antibodies that recognize FH (left panel) or Ku70 (right panel) and F1/R1 primers for the PCR were performed at the indicated time points after I- SceI transfection. The y-axis stands for the value of the I- SceI -induced fold increase of specific protein binding (the IP value was normalized to the input). The data represent the mean ± SD (n=3 independent experiments). c, d , DR-GFP-expressed U2OS cells with depleted endogenous FH and reconstituted expression of the indicated FH proteins were transfected with a vector with or without expressing I- SceI . PCR analyses for NHEJ were performed 42 h after transfection. A representative image of PCR products digested by I- SceI and BcgI is shown (left panel). The data represent the mean ± SD (n=3 independent experiments, right panel). * stands for P

    Techniques Used: Non-Homologous End Joining, Blocking Assay, Expressing, Transfection, Plasmid Preparation, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Protein Binding

    Related Articles

    Clone Assay:

    Article Title: Optimized transgenesis in Xenopus laevis/gilli isogenetic clones for immunological studies
    Article Snippet: 0.1 ng of SB mRNA was injected per egg together with 15–20 pg of RNase free HSV-GFP in order to generate transgenic LG clones with the SB method. .. Finally for the I-SceI method, the I-SceI-GFP vector was digested with the I-SceI meganuclease (New England Biolabs) for 40 mins at 37°C and 80 pg DNA along with 1×10−3 U I-SceI were injected per egg.

    Article Title: Pharmacological boost of DNA damage response and repair by enhanced biogenesis of DNA damage response RNAs
    Article Snippet: Analysis of NHEJ accuracy gDNA extracted from untreated or enoxacin-treated EJ5-GFP U2OS cells transfected with I-SceI for 3 days was amplified by PCR with Phusion® High-Fidelity DNA Polymerase (NEB) using primers encompassing I-SceI cut sites (EJ5GFP F/R). .. PCR products between 200–300 bp were gel purified, cloned into pCR™II-Blunt-TOPO® vector (Thermo-Fisher) and analysed by Sanger sequencing for insertions and deletions (indels) at the I-SceI junction.

    Centrifugation:

    Article Title: Comprehensive Mapping of Histone Modifications at DNA Double-Strand Breaks Deciphers Repair Pathway Chromatin Signatures
    Article Snippet: Briefly, cells were fixed with 2% formaldehyde to stabilize chromatin and prevent artificial DSBs, plasma membranes were lysed, and intact nuclei were recovered by centrifugation. .. The resulting circular DNA was linearized by I-SceI (NEB) digestion and amplified by PCR.

    Amplification:

    Article Title: Limiting the Persistence of a Chromosome Break Diminishes Its Mutagenic Potential
    Article Snippet: Amplification of PCR products from sorted GFP+ cells, associated restriction digests, and quantification of bands were performed as previously described , , where KNDRF and KNDRR are shown as p3 and p2 respectively, primer p1 is EJ5purF: 5′agcggatcgaaattgatgat , primer p4 is EJ5purR: 5′ cttttgaagcgtgcagaatg , and DRins-GFP amplifications use KNDRF and DRRT6: 5′aggttcagggggaggtgt . .. To ensure complete I-SceI digestion, PCR products were purified using a GFX column (GE), and digested for 1 h (37°C) with 5 U of I-SceI (NEB), followed by an adding another 5 U of I-SceI and 1 h of digestion.

    Article Title: RAG1/2 induces genomic insertions by mobilizing DNA into RAG1/2-independent breaks
    Article Snippet: In the second PCR, 25 ng DNA were amplified in each reaction with Phusion polymerase (New England Biolabs, Inc.) and primers p274a/p275a, p274b/p275b, p274c/p275c, and p274d/p275d with the following conditions: 98°C for 2 min; 3× (98°C for 10 s, 65°C for 30 s, 72°C for 1 min); 32× (98°C for 10 s, 72°C for 1:15 min); and 72°C for 5 min (Table S5). .. Extracted DNA was digested with I-SceI (New England Biolabs, Inc.) and column purified (MACHEREY-NAGEL), and high molecular weight products (300–2,000 bp) were isolated once more by agarose gel electrophoresis.

    Article Title: Comprehensive Mapping of Histone Modifications at DNA Double-Strand Breaks Deciphers Repair Pathway Chromatin Signatures
    Article Snippet: .. The resulting circular DNA was linearized by I-SceI (NEB) digestion and amplified by PCR. .. Sequencing libraries were prepared using TruSeq Nano DNA LT Library Preparation Kit (Illumina).

    Article Title: SLIC-CAGE: high-resolution transcription start site mapping using nanogram-levels of total RNA
    Article Snippet: To degrade the carrier, 14 µL of sample were mixed with I-SceI (5 U) and I-CeuI (5 U) in 1× CutSmart buffer (NEB) and incubated at 37°C for 3 h. The enzymes were heat-inactivated at 65°C for 20 min and the samples purified using AMPure XP beads (1.8× AMPure XP volume per reaction volume, as described in ). .. The number of cycles for PCR amplification of the library corresponded to the C t .

    Article Title: Pharmacological boost of DNA damage response and repair by enhanced biogenesis of DNA damage response RNAs
    Article Snippet: .. Analysis of NHEJ accuracy gDNA extracted from untreated or enoxacin-treated EJ5-GFP U2OS cells transfected with I-SceI for 3 days was amplified by PCR with Phusion® High-Fidelity DNA Polymerase (NEB) using primers encompassing I-SceI cut sites (EJ5GFP F/R). .. PCR products between 200–300 bp were gel purified, cloned into pCR™II-Blunt-TOPO® vector (Thermo-Fisher) and analysed by Sanger sequencing for insertions and deletions (indels) at the I-SceI junction.

    Construct:

    Article Title: The newt reprograms mature RPE cells into a unique multipotent state for retinal regeneration
    Article Snippet: .. Preparation of single-cell embryos, microinjection of the construct [injection volume: 10 µl/embryo; contents: 200 ng of the DNA construct, 0.5 U of I-SceI (R0694S; New England Biolabs Japan, Tokyo, Japan), 1x I-SceI buffer, and 0.01% phenol red], and rearing of the injected animals were performed according to previously published protocols . ..

    Article Title: Adaptation of the GoldenBraid modular cloning system and creation of a toolkit for the expression of heterologous proteins in yeast mitochondria
    Article Snippet: .. S. cerevisiae Transformation The final plasmids containing the GB-assembled TU constructs were digested with I-SceI (NEB) to generate a linear DNA fragment that was used for S. cerevisiae transformation and genome integration, as described in reference [ ]. .. G418 (200 μg/ml, Santa Cruz Biotechnology) and Hygromycin B (200μg/ml, Formedium) were used for selection.

    Incubation:

    Article Title: High resolution, plasmid-driven cell lineage tracing reveals developmental variability in leech
    Article Snippet: 116 ng/ul of plasmid was preincubated with 0.5 units/ul of I-SceI in 1× buffer (New England Biolabs, Ipswich, MA) at 37° C for 40 minutes in a volume of 5 ul. .. After incubation, 1 ul of 18 mg/ml RDA solution was added to the digest and the resultant mixture (with a final plasmid concentration of 96 ng/ul) was loaded into glass micropipets for injection.

    Article Title: Optimized transgenesis in Xenopus laevis/gilli isogenetic clones for immunological studies
    Article Snippet: Finally for the I-SceI method, the I-SceI-GFP vector was digested with the I-SceI meganuclease (New England Biolabs) for 40 mins at 37°C and 80 pg DNA along with 1×10−3 U I-SceI were injected per egg. .. After injection all embryos were incubated at 13°C for four hours in order to delay cell division providing extended time for transgene integration.

    Article Title: Translocation Capture Sequencing: A Method for High Throughput Mapping of Chromosomal Rearrangements
    Article Snippet: 100uL of washed T1 magnetic streptavidin beads (Invitrogen) were resuspended in 400ul 2x B & W buffer (10mM Tris pH7.5, 1mM EDTA, 2M NaCl), 200ul was added to each forward and reverse PCR1 products and the mixture was incubated for 1hr with gentle nutation at room temperature. .. Beads were magnetically isolated, washed 3x in 500uL 1x B & W buffer, 1x in H2 O and resuspended in 87ul H2 O. Unrearranged loci were further eliminated by adding 10ul 10x NEB I-Sce1 buffer, 1ul 100x BSA and 2uL of 5,000U/mL I-SceI (NEB), then incubating for 2 hours at 37C.

    Article Title: SLIC-CAGE: high-resolution transcription start site mapping using nanogram-levels of total RNA
    Article Snippet: .. To degrade the carrier, 14 µL of sample were mixed with I-SceI (5 U) and I-CeuI (5 U) in 1× CutSmart buffer (NEB) and incubated at 37°C for 3 h. The enzymes were heat-inactivated at 65°C for 20 min and the samples purified using AMPure XP beads (1.8× AMPure XP volume per reaction volume, as described in ). ..

    Immunocytochemistry:

    Article Title: Oligodendrocyte Specification in Zebrafish Requires Notch-Regulated Cyclin-Dependent Kinase Inhibitor Function
    Article Snippet: The final plasmid was injected into one-cell stage embryos at a concentration of 30 ng/μl with 1 U/μl I-SceI (New England Biolabs, Beverly, MA), 0.5× I-SceI buffer, and 0.05% phenol red. .. To identify transgenic embryos and, consequently, germ-line-transformed founders, we heat shocked embryos by incubating them at 40°C for 30 min and, after a recovery period, fixed them and performed anti-Myc immunocytochemistry.

    Expressing:

    Article Title: SLIC-CAGE: high-resolution transcription start site mapping using nanogram-levels of total RNA
    Article Snippet: For the standard cap analysis of gene expression, the latest nAnT-iCAGE protocol was followed ( ). .. To degrade the carrier, 14 µL of sample were mixed with I-SceI (5 U) and I-CeuI (5 U) in 1× CutSmart buffer (NEB) and incubated at 37°C for 3 h. The enzymes were heat-inactivated at 65°C for 20 min and the samples purified using AMPure XP beads (1.8× AMPure XP volume per reaction volume, as described in ).

    Transformation Assay:

    Article Title: rec-YnH enables simultaneous many-by-many detection of direct protein–protein and protein–RNA interactions
    Article Snippet: Selected baits (pBWH-ORF-X) and preys (pAWH-ORF-Y) from the X76 screen (see Supplementary Data ) were individually linearised by I-SceI and I-CeuI (New England Biolabs) digestion for 16 h at 37 °C followed by 20 min at 65 °C. .. Competent Y2HGold cells were prepared with the Frozen-EZ Yeast Transformation II Kit™ (Zymo Research) and aliquots (10 μl) were prepared in 96-deep-well plates.

    Article Title: Adaptation of the GoldenBraid modular cloning system and creation of a toolkit for the expression of heterologous proteins in yeast mitochondria
    Article Snippet: .. S. cerevisiae Transformation The final plasmids containing the GB-assembled TU constructs were digested with I-SceI (NEB) to generate a linear DNA fragment that was used for S. cerevisiae transformation and genome integration, as described in reference [ ]. .. G418 (200 μg/ml, Santa Cruz Biotechnology) and Hygromycin B (200μg/ml, Formedium) were used for selection.

    Gel Purification:

    Article Title: Translocation Capture Sequencing: A Method for High Throughput Mapping of Chromosomal Rearrangements
    Article Snippet: DNA was purified in Qiagen gel purification columns, gel-based size selection and purification was repeated once. .. Beads were magnetically isolated, washed 3x in 500uL 1x B & W buffer, 1x in H2 O and resuspended in 87ul H2 O. Unrearranged loci were further eliminated by adding 10ul 10x NEB I-Sce1 buffer, 1ul 100x BSA and 2uL of 5,000U/mL I-SceI (NEB), then incubating for 2 hours at 37C.

    Countercurrent Chromatography:

    Article Title: The BRCA2-Interacting Protein BCCIP Functions in RAD51 and BRCA2 Focus Formation and Homologous Recombinational Repair
    Article Snippet: To distinguish gene conversion and deletion products, the TripleMaster PCR system (Eppendorf, Hamburg, Germany) was used to amplify the entire 7.5-kbp HR substrate with the following primers: 5′-CGC CAT CCC GTC TCC GCT CGT CAC and 5′-CTC ATG AGC GGA TAC ATA TTT GAA TGT ATT TAG. .. PCR products were digested with I-SceI (New England BioLabs, Beverly, Mass.) to confirm the loss of the I-SceI site.

    Flow Cytometry:

    Article Title: Limiting the Persistence of a Chromosome Break Diminishes Its Mutagenic Potential
    Article Snippet: The percentage of GFP positive cells was quantified by flow cytometric analysis (FACS) 3 d after transfection on a Cyan ADP (Dako), from cells suspended and fixed in phosphate-buffered formaldehyde. .. To ensure complete I-SceI digestion, PCR products were purified using a GFX column (GE), and digested for 1 h (37°C) with 5 U of I-SceI (NEB), followed by an adding another 5 U of I-SceI and 1 h of digestion.

    Non-Homologous End Joining:

    Article Title: Pharmacological boost of DNA damage response and repair by enhanced biogenesis of DNA damage response RNAs
    Article Snippet: .. Analysis of NHEJ accuracy gDNA extracted from untreated or enoxacin-treated EJ5-GFP U2OS cells transfected with I-SceI for 3 days was amplified by PCR with Phusion® High-Fidelity DNA Polymerase (NEB) using primers encompassing I-SceI cut sites (EJ5GFP F/R). .. PCR products between 200–300 bp were gel purified, cloned into pCR™II-Blunt-TOPO® vector (Thermo-Fisher) and analysed by Sanger sequencing for insertions and deletions (indels) at the I-SceI junction.

    Sequencing:

    Article Title: The newt reprograms mature RPE cells into a unique multipotent state for retinal regeneration
    Article Snippet: A transgene construct pCAGGs-mCherry-shRNA (Sce) ( ) was prepared by modifying pCAGGs-EGFP (Sce) with conventional molecular cloning techniques; a reporter EGFP was replaced with mCherry to minimise autofluorescence, and then a sequence encoding shRNA was inserted, with restriction enzymes Mun I (5′ end) and Hpa I (3′ end), in between the mCherry and the polyA signal. .. Preparation of single-cell embryos, microinjection of the construct [injection volume: 10 µl/embryo; contents: 200 ng of the DNA construct, 0.5 U of I-SceI (R0694S; New England Biolabs Japan, Tokyo, Japan), 1x I-SceI buffer, and 0.01% phenol red], and rearing of the injected animals were performed according to previously published protocols .

    Article Title: RAG1/2 induces genomic insertions by mobilizing DNA into RAG1/2-independent breaks
    Article Snippet: To add index adapters for sequencing, the PCR was similar to the second PCR but with primers pNextflex common/pNextflex index5 or pNextflex common/pNextflex index6 with the following conditions: 98°C for 2 min; 3× (98°C for 10 s, 67°C for 30 s, 72°C for 1 min); 32× (98°C for 10 s, 72°C for 1:15 min); and 72°C for 5 min (Table S5). .. Extracted DNA was digested with I-SceI (New England Biolabs, Inc.) and column purified (MACHEREY-NAGEL), and high molecular weight products (300–2,000 bp) were isolated once more by agarose gel electrophoresis.

    Article Title: Oligodendrocyte Specification in Zebrafish Requires Notch-Regulated Cyclin-Dependent Kinase Inhibitor Function
    Article Snippet: Next, we inserted cdkn1c cDNA sequence so that it created a reading frame fusion to sequence encoding the Myc epitope tag at the 3′ end of cdkn1c , creating pCS2hsp70:cdkn1c-myc. .. The final plasmid was injected into one-cell stage embryos at a concentration of 30 ng/μl with 1 U/μl I-SceI (New England Biolabs, Beverly, MA), 0.5× I-SceI buffer, and 0.05% phenol red.

    Article Title: Comprehensive Mapping of Histone Modifications at DNA Double-Strand Breaks Deciphers Repair Pathway Chromatin Signatures
    Article Snippet: The resulting circular DNA was linearized by I-SceI (NEB) digestion and amplified by PCR. .. Sequencing libraries were prepared using TruSeq Nano DNA LT Library Preparation Kit (Illumina).

    Article Title: SLIC-CAGE: high-resolution transcription start site mapping using nanogram-levels of total RNA
    Article Snippet: Further library preparation steps were followed as described in with several exceptions: (1) Samples were pooled only prior to sequencing to allow individual quality control steps; (2) samples were never completely dried using the centrifugal concentrator and then redissolved as in nAnT-iCAGE; instead, the leftover volume was monitored to avoid complete drying and adjusted with water to achieve the required volume; and (3) after the final AMPure purification in the nAnT-iCAGE protocol, each sample was concentrated using the centrifugal concentrator and its volume adjusted to 15 µL, out of which 1 µL was used for quality control on the Agilent Bioanalyzer HS DNA chip. .. To degrade the carrier, 14 µL of sample were mixed with I-SceI (5 U) and I-CeuI (5 U) in 1× CutSmart buffer (NEB) and incubated at 37°C for 3 h. The enzymes were heat-inactivated at 65°C for 20 min and the samples purified using AMPure XP beads (1.8× AMPure XP volume per reaction volume, as described in ).

    Article Title: Pharmacological boost of DNA damage response and repair by enhanced biogenesis of DNA damage response RNAs
    Article Snippet: Analysis of NHEJ accuracy gDNA extracted from untreated or enoxacin-treated EJ5-GFP U2OS cells transfected with I-SceI for 3 days was amplified by PCR with Phusion® High-Fidelity DNA Polymerase (NEB) using primers encompassing I-SceI cut sites (EJ5GFP F/R). .. PCR products between 200–300 bp were gel purified, cloned into pCR™II-Blunt-TOPO® vector (Thermo-Fisher) and analysed by Sanger sequencing for insertions and deletions (indels) at the I-SceI junction.

    Sonication:

    Article Title: Comprehensive Mapping of Histone Modifications at DNA Double-Strand Breaks Deciphers Repair Pathway Chromatin Signatures
    Article Snippet: Total DNA was extracted by precipitation with isopropanol and fragmented by sonication using a Covaris S220 to create ∼400 bp fragments. .. The resulting circular DNA was linearized by I-SceI (NEB) digestion and amplified by PCR.

    Injection:

    Article Title: High resolution, plasmid-driven cell lineage tracing reveals developmental variability in leech
    Article Snippet: 116 ng/ul of plasmid was preincubated with 0.5 units/ul of I-SceI in 1× buffer (New England Biolabs, Ipswich, MA) at 37° C for 40 minutes in a volume of 5 ul. .. After incubation, 1 ul of 18 mg/ml RDA solution was added to the digest and the resultant mixture (with a final plasmid concentration of 96 ng/ul) was loaded into glass micropipets for injection.

    Article Title: The newt reprograms mature RPE cells into a unique multipotent state for retinal regeneration
    Article Snippet: .. Preparation of single-cell embryos, microinjection of the construct [injection volume: 10 µl/embryo; contents: 200 ng of the DNA construct, 0.5 U of I-SceI (R0694S; New England Biolabs Japan, Tokyo, Japan), 1x I-SceI buffer, and 0.01% phenol red], and rearing of the injected animals were performed according to previously published protocols . ..

    Article Title: Oligodendrocyte Specification in Zebrafish Requires Notch-Regulated Cyclin-Dependent Kinase Inhibitor Function
    Article Snippet: .. The final plasmid was injected into one-cell stage embryos at a concentration of 30 ng/μl with 1 U/μl I-SceI (New England Biolabs, Beverly, MA), 0.5× I-SceI buffer, and 0.05% phenol red. .. To identify transgenic embryos and, consequently, germ-line-transformed founders, we heat shocked embryos by incubating them at 40°C for 30 min and, after a recovery period, fixed them and performed anti-Myc immunocytochemistry.

    Article Title: Optimized transgenesis in Xenopus laevis/gilli isogenetic clones for immunological studies
    Article Snippet: .. Finally for the I-SceI method, the I-SceI-GFP vector was digested with the I-SceI meganuclease (New England Biolabs) for 40 mins at 37°C and 80 pg DNA along with 1×10−3 U I-SceI were injected per egg. .. After injection all embryos were incubated at 13°C for four hours in order to delay cell division providing extended time for transgene integration.

    Article Title: Turning the fate of reprogramming cells from retinal disorder to regeneration by Pax6 in newts
    Article Snippet: .. Components of the injected solution (4 nl per embryo) were as follows: pRPE65 > CreERT2 -CAGGs > YFP (I-SceI), 40 ng μl−1 ; pCAGGs > [AmCyan]mCherry-shRNA (I-SceI), 40 ng μl−1 ; I-SceI, 1 U μl−1 ; I-SceI buffer (New England Biolabs), 1X; phenol red, 0.01%. ..

    Hybridization:

    Article Title: Oligodendrocyte Specification in Zebrafish Requires Notch-Regulated Cyclin-Dependent Kinase Inhibitor Function
    Article Snippet: The final plasmid was injected into one-cell stage embryos at a concentration of 30 ng/μl with 1 U/μl I-SceI (New England Biolabs, Beverly, MA), 0.5× I-SceI buffer, and 0.05% phenol red. .. Bromodeoxyuridine labeling, in situ RNA hybridization, and immunocytochemistry.

    Molecular Weight:

    Article Title: RAG1/2 induces genomic insertions by mobilizing DNA into RAG1/2-independent breaks
    Article Snippet: .. Extracted DNA was digested with I-SceI (New England Biolabs, Inc.) and column purified (MACHEREY-NAGEL), and high molecular weight products (300–2,000 bp) were isolated once more by agarose gel electrophoresis. .. Extracted DNA was sequenced twice using Illumina NextSeq (150 cycles, paired-end).

    Article Title: RAG1/2 induces genomic insertions by mobilizing DNA into RAG1/2-independent breaks
    Article Snippet: PCR products were pooled, and high molecular weight amplicons (280–3,000 bp) were isolated by agarose gel electrophoresis. .. Extracted DNA was digested with I-SceI (New England Biolabs, Inc.) and column purified (MACHEREY-NAGEL).

    DNA Extraction:

    Article Title: Adaptation of the GoldenBraid modular cloning system and creation of a toolkit for the expression of heterologous proteins in yeast mitochondria
    Article Snippet: S. cerevisiae Transformation The final plasmids containing the GB-assembled TU constructs were digested with I-SceI (NEB) to generate a linear DNA fragment that was used for S. cerevisiae transformation and genome integration, as described in reference [ ]. .. Verification of genomic integration was performed for each strain by extracting genomic DNA using the Bust n’ Grab Genomic DNA Isolation Protocol [ ] and by carrying out PCR reactions for the YPRC∆15 or YORW∆22 integration loci using primers specific to sequences flanking the integration arms of homology together with internal primers specific to each construct.

    Molecular Cloning:

    Article Title: The newt reprograms mature RPE cells into a unique multipotent state for retinal regeneration
    Article Snippet: A transgene construct pCAGGs-mCherry-shRNA (Sce) ( ) was prepared by modifying pCAGGs-EGFP (Sce) with conventional molecular cloning techniques; a reporter EGFP was replaced with mCherry to minimise autofluorescence, and then a sequence encoding shRNA was inserted, with restriction enzymes Mun I (5′ end) and Hpa I (3′ end), in between the mCherry and the polyA signal. .. Preparation of single-cell embryos, microinjection of the construct [injection volume: 10 µl/embryo; contents: 200 ng of the DNA construct, 0.5 U of I-SceI (R0694S; New England Biolabs Japan, Tokyo, Japan), 1x I-SceI buffer, and 0.01% phenol red], and rearing of the injected animals were performed according to previously published protocols .

    Fluorescence:

    Article Title: Turning the fate of reprogramming cells from retinal disorder to regeneration by Pax6 in newts
    Article Snippet: Components of the injected solution (4 nl per embryo) were as follows: pRPE65 > CreERT2 -CAGGs > YFP (I-SceI), 40 ng μl−1 ; pCAGGs > [AmCyan]mCherry-shRNA (I-SceI), 40 ng μl−1 ; I-SceI, 1 U μl−1 ; I-SceI buffer (New England Biolabs), 1X; phenol red, 0.01%. .. When the embryos reached the blastula stage (St. 10), the animals that expressed both YFP and AmCyan in their entire body almost evenly were screened under a fluorescence dissecting microscope (M165 FC; Leica Microsystems, Wetzlar, Germany) ( ).

    Isolation:

    Article Title: RAG1/2 induces genomic insertions by mobilizing DNA into RAG1/2-independent breaks
    Article Snippet: .. Extracted DNA was digested with I-SceI (New England Biolabs, Inc.) and column purified (MACHEREY-NAGEL), and high molecular weight products (300–2,000 bp) were isolated once more by agarose gel electrophoresis. .. Extracted DNA was sequenced twice using Illumina NextSeq (150 cycles, paired-end).

    Article Title: RAG1/2 induces genomic insertions by mobilizing DNA into RAG1/2-independent breaks
    Article Snippet: PCR products were pooled, and high molecular weight amplicons (280–3,000 bp) were isolated by agarose gel electrophoresis. .. Extracted DNA was digested with I-SceI (New England Biolabs, Inc.) and column purified (MACHEREY-NAGEL).

    Article Title: Translocation Capture Sequencing: A Method for High Throughput Mapping of Chromosomal Rearrangements
    Article Snippet: .. Beads were magnetically isolated, washed 3x in 500uL 1x B & W buffer, 1x in H2 O and resuspended in 87ul H2 O. Unrearranged loci were further eliminated by adding 10ul 10x NEB I-Sce1 buffer, 1ul 100x BSA and 2uL of 5,000U/mL I-SceI (NEB), then incubating for 2 hours at 37C. ..

    Transfection:

    Article Title: Limiting the Persistence of a Chromosome Break Diminishes Its Mutagenic Potential
    Article Snippet: The percentage of GFP positive cells was quantified by flow cytometric analysis (FACS) 3 d after transfection on a Cyan ADP (Dako), from cells suspended and fixed in phosphate-buffered formaldehyde. .. To ensure complete I-SceI digestion, PCR products were purified using a GFX column (GE), and digested for 1 h (37°C) with 5 U of I-SceI (NEB), followed by an adding another 5 U of I-SceI and 1 h of digestion.

    Article Title: The BRCA2-Interacting Protein BCCIP Functions in RAD51 and BRCA2 Focus Formation and Homologous Recombinational Repair
    Article Snippet: Background HR levels were estimated in parallel experiments, except that cells were transfected with an empty pCMV vector. .. PCR products were digested with I-SceI (New England BioLabs, Beverly, Mass.) to confirm the loss of the I-SceI site.

    Article Title: Pharmacological boost of DNA damage response and repair by enhanced biogenesis of DNA damage response RNAs
    Article Snippet: .. Analysis of NHEJ accuracy gDNA extracted from untreated or enoxacin-treated EJ5-GFP U2OS cells transfected with I-SceI for 3 days was amplified by PCR with Phusion® High-Fidelity DNA Polymerase (NEB) using primers encompassing I-SceI cut sites (EJ5GFP F/R). .. PCR products between 200–300 bp were gel purified, cloned into pCR™II-Blunt-TOPO® vector (Thermo-Fisher) and analysed by Sanger sequencing for insertions and deletions (indels) at the I-SceI junction.

    Labeling:

    Article Title: Oligodendrocyte Specification in Zebrafish Requires Notch-Regulated Cyclin-Dependent Kinase Inhibitor Function
    Article Snippet: The final plasmid was injected into one-cell stage embryos at a concentration of 30 ng/μl with 1 U/μl I-SceI (New England Biolabs, Beverly, MA), 0.5× I-SceI buffer, and 0.05% phenol red. .. Bromodeoxyuridine labeling, in situ RNA hybridization, and immunocytochemistry.

    Article Title: Comprehensive Mapping of Histone Modifications at DNA Double-Strand Breaks Deciphers Repair Pathway Chromatin Signatures
    Article Snippet: Labeled fragments were captured by streptavidin beads (Invitrogen) and once again blunted and phosphorylated using the Quick Blunting Kit (NEB), and ligated to a second linker (distal). .. The resulting circular DNA was linearized by I-SceI (NEB) digestion and amplified by PCR.

    Purification:

    Article Title: Limiting the Persistence of a Chromosome Break Diminishes Its Mutagenic Potential
    Article Snippet: .. To ensure complete I-SceI digestion, PCR products were purified using a GFX column (GE), and digested for 1 h (37°C) with 5 U of I-SceI (NEB), followed by an adding another 5 U of I-SceI and 1 h of digestion. .. With this protocol, we always ensure complete cutting with a control PCR template that contains an intact I-SceI site (see ), and further ensure that our experimental samples contain less or equal amounts of PCR product as these controls, to avoid any possibility of problems with excess substrate affecting complete cutting .

    Article Title: RAG1/2 induces genomic insertions by mobilizing DNA into RAG1/2-independent breaks
    Article Snippet: .. Extracted DNA was digested with I-SceI (New England Biolabs, Inc.) and column purified (MACHEREY-NAGEL), and high molecular weight products (300–2,000 bp) were isolated once more by agarose gel electrophoresis. .. Extracted DNA was sequenced twice using Illumina NextSeq (150 cycles, paired-end).

    Article Title: RAG1/2 induces genomic insertions by mobilizing DNA into RAG1/2-independent breaks
    Article Snippet: .. Extracted DNA was digested with I-SceI (New England Biolabs, Inc.) and column purified (MACHEREY-NAGEL). .. To add index adapters for sequencing, the PCR was similar to the second PCR but with primers pNextflex common/pNextflex index5 or pNextflex common/pNextflex index6 with the following conditions: 98°C for 2 min; 3× (98°C for 10 s, 67°C for 30 s, 72°C for 1 min); 32× (98°C for 10 s, 72°C for 1:15 min); and 72°C for 5 min (Table S5).

    Article Title: Translocation Capture Sequencing: A Method for High Throughput Mapping of Chromosomal Rearrangements
    Article Snippet: DNA was purified in Qiagen gel purification columns, gel-based size selection and purification was repeated once. .. Beads were magnetically isolated, washed 3x in 500uL 1x B & W buffer, 1x in H2 O and resuspended in 87ul H2 O. Unrearranged loci were further eliminated by adding 10ul 10x NEB I-Sce1 buffer, 1ul 100x BSA and 2uL of 5,000U/mL I-SceI (NEB), then incubating for 2 hours at 37C.

    Article Title: SLIC-CAGE: high-resolution transcription start site mapping using nanogram-levels of total RNA
    Article Snippet: .. To degrade the carrier, 14 µL of sample were mixed with I-SceI (5 U) and I-CeuI (5 U) in 1× CutSmart buffer (NEB) and incubated at 37°C for 3 h. The enzymes were heat-inactivated at 65°C for 20 min and the samples purified using AMPure XP beads (1.8× AMPure XP volume per reaction volume, as described in ). ..

    Article Title: Adaptation of the GoldenBraid modular cloning system and creation of a toolkit for the expression of heterologous proteins in yeast mitochondria
    Article Snippet: S. cerevisiae Transformation The final plasmids containing the GB-assembled TU constructs were digested with I-SceI (NEB) to generate a linear DNA fragment that was used for S. cerevisiae transformation and genome integration, as described in reference [ ]. .. Transformants were purified by restreaking on YPAUD plates containing 2% glucose and the appropriate antibiotic, and only colonies growing with normal morphology were selected for further experimentation.

    Article Title: Pharmacological boost of DNA damage response and repair by enhanced biogenesis of DNA damage response RNAs
    Article Snippet: Analysis of NHEJ accuracy gDNA extracted from untreated or enoxacin-treated EJ5-GFP U2OS cells transfected with I-SceI for 3 days was amplified by PCR with Phusion® High-Fidelity DNA Polymerase (NEB) using primers encompassing I-SceI cut sites (EJ5GFP F/R). .. PCR products between 200–300 bp were gel purified, cloned into pCR™II-Blunt-TOPO® vector (Thermo-Fisher) and analysed by Sanger sequencing for insertions and deletions (indels) at the I-SceI junction.

    Polymerase Chain Reaction:

    Article Title: Limiting the Persistence of a Chromosome Break Diminishes Its Mutagenic Potential
    Article Snippet: .. To ensure complete I-SceI digestion, PCR products were purified using a GFX column (GE), and digested for 1 h (37°C) with 5 U of I-SceI (NEB), followed by an adding another 5 U of I-SceI and 1 h of digestion. .. With this protocol, we always ensure complete cutting with a control PCR template that contains an intact I-SceI site (see ), and further ensure that our experimental samples contain less or equal amounts of PCR product as these controls, to avoid any possibility of problems with excess substrate affecting complete cutting .

    Article Title: The BRCA2-Interacting Protein BCCIP Functions in RAD51 and BRCA2 Focus Formation and Homologous Recombinational Repair
    Article Snippet: .. PCR products were digested with I-SceI (New England BioLabs, Beverly, Mass.) to confirm the loss of the I-SceI site. .. Gene conversions result in 7.5-kbp PCR products, and deletions result in 2.5-kbp PCR products.

    Article Title: RAG1/2 induces genomic insertions by mobilizing DNA into RAG1/2-independent breaks
    Article Snippet: PCR products were pooled, and high molecular weight amplicons (350–2,000 bp) were isolated by agarose gel electrophoresis. .. Extracted DNA was digested with I-SceI (New England Biolabs, Inc.) and column purified (MACHEREY-NAGEL), and high molecular weight products (300–2,000 bp) were isolated once more by agarose gel electrophoresis.

    Article Title: Comprehensive Mapping of Histone Modifications at DNA Double-Strand Breaks Deciphers Repair Pathway Chromatin Signatures
    Article Snippet: .. The resulting circular DNA was linearized by I-SceI (NEB) digestion and amplified by PCR. .. Sequencing libraries were prepared using TruSeq Nano DNA LT Library Preparation Kit (Illumina).

    Article Title: RAG1/2 induces genomic insertions by mobilizing DNA into RAG1/2-independent breaks
    Article Snippet: PCR products were pooled, and high molecular weight amplicons (280–3,000 bp) were isolated by agarose gel electrophoresis. .. Extracted DNA was digested with I-SceI (New England Biolabs, Inc.) and column purified (MACHEREY-NAGEL).

    Article Title: Translocation Capture Sequencing: A Method for High Throughput Mapping of Chromosomal Rearrangements
    Article Snippet: Paragraph title: 2.4.3. Round 1 PCR ... Beads were magnetically isolated, washed 3x in 500uL 1x B & W buffer, 1x in H2 O and resuspended in 87ul H2 O. Unrearranged loci were further eliminated by adding 10ul 10x NEB I-Sce1 buffer, 1ul 100x BSA and 2uL of 5,000U/mL I-SceI (NEB), then incubating for 2 hours at 37C.

    Article Title: SLIC-CAGE: high-resolution transcription start site mapping using nanogram-levels of total RNA
    Article Snippet: To degrade the carrier, 14 µL of sample were mixed with I-SceI (5 U) and I-CeuI (5 U) in 1× CutSmart buffer (NEB) and incubated at 37°C for 3 h. The enzymes were heat-inactivated at 65°C for 20 min and the samples purified using AMPure XP beads (1.8× AMPure XP volume per reaction volume, as described in ). .. The number of cycles for PCR amplification of the library corresponded to the C t .

    Article Title: Adaptation of the GoldenBraid modular cloning system and creation of a toolkit for the expression of heterologous proteins in yeast mitochondria
    Article Snippet: S. cerevisiae Transformation The final plasmids containing the GB-assembled TU constructs were digested with I-SceI (NEB) to generate a linear DNA fragment that was used for S. cerevisiae transformation and genome integration, as described in reference [ ]. .. Verification of genomic integration was performed for each strain by extracting genomic DNA using the Bust n’ Grab Genomic DNA Isolation Protocol [ ] and by carrying out PCR reactions for the YPRC∆15 or YORW∆22 integration loci using primers specific to sequences flanking the integration arms of homology together with internal primers specific to each construct.

    Article Title: Pharmacological boost of DNA damage response and repair by enhanced biogenesis of DNA damage response RNAs
    Article Snippet: .. Analysis of NHEJ accuracy gDNA extracted from untreated or enoxacin-treated EJ5-GFP U2OS cells transfected with I-SceI for 3 days was amplified by PCR with Phusion® High-Fidelity DNA Polymerase (NEB) using primers encompassing I-SceI cut sites (EJ5GFP F/R). .. PCR products between 200–300 bp were gel purified, cloned into pCR™II-Blunt-TOPO® vector (Thermo-Fisher) and analysed by Sanger sequencing for insertions and deletions (indels) at the I-SceI junction.

    shRNA:

    Article Title: The newt reprograms mature RPE cells into a unique multipotent state for retinal regeneration
    Article Snippet: A control shRNA was designed using a region (319–342) in the newt crystallin promoter (DDBJ/GenBank Accession #: AB113881). .. Preparation of single-cell embryos, microinjection of the construct [injection volume: 10 µl/embryo; contents: 200 ng of the DNA construct, 0.5 U of I-SceI (R0694S; New England Biolabs Japan, Tokyo, Japan), 1x I-SceI buffer, and 0.01% phenol red], and rearing of the injected animals were performed according to previously published protocols .

    Microscopy:

    Article Title: Turning the fate of reprogramming cells from retinal disorder to regeneration by Pax6 in newts
    Article Snippet: Components of the injected solution (4 nl per embryo) were as follows: pRPE65 > CreERT2 -CAGGs > YFP (I-SceI), 40 ng μl−1 ; pCAGGs > [AmCyan]mCherry-shRNA (I-SceI), 40 ng μl−1 ; I-SceI, 1 U μl−1 ; I-SceI buffer (New England Biolabs), 1X; phenol red, 0.01%. .. When the embryos reached the blastula stage (St. 10), the animals that expressed both YFP and AmCyan in their entire body almost evenly were screened under a fluorescence dissecting microscope (M165 FC; Leica Microsystems, Wetzlar, Germany) ( ).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: The BRCA2-Interacting Protein BCCIP Functions in RAD51 and BRCA2 Focus Formation and Homologous Recombinational Repair
    Article Snippet: To distinguish gene conversion and deletion products, the TripleMaster PCR system (Eppendorf, Hamburg, Germany) was used to amplify the entire 7.5-kbp HR substrate with the following primers: 5′-CGC CAT CCC GTC TCC GCT CGT CAC and 5′-CTC ATG AGC GGA TAC ATA TTT GAA TGT ATT TAG. .. PCR products were digested with I-SceI (New England BioLabs, Beverly, Mass.) to confirm the loss of the I-SceI site.

    Chromatin Immunoprecipitation:

    Article Title: SLIC-CAGE: high-resolution transcription start site mapping using nanogram-levels of total RNA
    Article Snippet: Further library preparation steps were followed as described in with several exceptions: (1) Samples were pooled only prior to sequencing to allow individual quality control steps; (2) samples were never completely dried using the centrifugal concentrator and then redissolved as in nAnT-iCAGE; instead, the leftover volume was monitored to avoid complete drying and adjusted with water to achieve the required volume; and (3) after the final AMPure purification in the nAnT-iCAGE protocol, each sample was concentrated using the centrifugal concentrator and its volume adjusted to 15 µL, out of which 1 µL was used for quality control on the Agilent Bioanalyzer HS DNA chip. .. To degrade the carrier, 14 µL of sample were mixed with I-SceI (5 U) and I-CeuI (5 U) in 1× CutSmart buffer (NEB) and incubated at 37°C for 3 h. The enzymes were heat-inactivated at 65°C for 20 min and the samples purified using AMPure XP beads (1.8× AMPure XP volume per reaction volume, as described in ).

    Spot Test:

    Article Title: rec-YnH enables simultaneous many-by-many detection of direct protein–protein and protein–RNA interactions
    Article Snippet: Paragraph title: Yeast two-hybrid spot test ... Selected baits (pBWH-ORF-X) and preys (pAWH-ORF-Y) from the X76 screen (see Supplementary Data ) were individually linearised by I-SceI and I-CeuI (New England Biolabs) digestion for 16 h at 37 °C followed by 20 min at 65 °C.

    Plasmid Preparation:

    Article Title: Limiting the Persistence of a Chromosome Break Diminishes Its Mutagenic Potential
    Article Snippet: Repair assays To measure repair, 105 cells were plated onto 12 well plates, and transfected the next day with 3.6 µl of Lipofectamine 2000 (Invitrogen) mixed with 0.8 µg of pCBASce, along with 0.4 µg of either empty vector (pCAGGS-BSKX), or the relevant complementation/expression vector. .. To ensure complete I-SceI digestion, PCR products were purified using a GFX column (GE), and digested for 1 h (37°C) with 5 U of I-SceI (NEB), followed by an adding another 5 U of I-SceI and 1 h of digestion.

    Article Title: The BRCA2-Interacting Protein BCCIP Functions in RAD51 and BRCA2 Focus Formation and Homologous Recombinational Repair
    Article Snippet: Background HR levels were estimated in parallel experiments, except that cells were transfected with an empty pCMV vector. .. PCR products were digested with I-SceI (New England BioLabs, Beverly, Mass.) to confirm the loss of the I-SceI site.

    Article Title: High resolution, plasmid-driven cell lineage tracing reveals developmental variability in leech
    Article Snippet: .. 116 ng/ul of plasmid was preincubated with 0.5 units/ul of I-SceI in 1× buffer (New England Biolabs, Ipswich, MA) at 37° C for 40 minutes in a volume of 5 ul. .. After incubation, 1 ul of 18 mg/ml RDA solution was added to the digest and the resultant mixture (with a final plasmid concentration of 96 ng/ul) was loaded into glass micropipets for injection.

    Article Title: Oligodendrocyte Specification in Zebrafish Requires Notch-Regulated Cyclin-Dependent Kinase Inhibitor Function
    Article Snippet: .. The final plasmid was injected into one-cell stage embryos at a concentration of 30 ng/μl with 1 U/μl I-SceI (New England Biolabs, Beverly, MA), 0.5× I-SceI buffer, and 0.05% phenol red. .. To identify transgenic embryos and, consequently, germ-line-transformed founders, we heat shocked embryos by incubating them at 40°C for 30 min and, after a recovery period, fixed them and performed anti-Myc immunocytochemistry.

    Article Title: Optimized transgenesis in Xenopus laevis/gilli isogenetic clones for immunological studies
    Article Snippet: .. Finally for the I-SceI method, the I-SceI-GFP vector was digested with the I-SceI meganuclease (New England Biolabs) for 40 mins at 37°C and 80 pg DNA along with 1×10−3 U I-SceI were injected per egg. .. After injection all embryos were incubated at 13°C for four hours in order to delay cell division providing extended time for transgene integration.

    Article Title: rec-YnH enables simultaneous many-by-many detection of direct protein–protein and protein–RNA interactions
    Article Snippet: Selected baits (pBWH-ORF-X) and preys (pAWH-ORF-Y) from the X76 screen (see Supplementary Data ) were individually linearised by I-SceI and I-CeuI (New England Biolabs) digestion for 16 h at 37 °C followed by 20 min at 65 °C. .. Cells were transformed with 4 fmol of linearised bait and 4 fmol of linearised prey plasmid following the manufacturer's instructions.

    Article Title: Pharmacological boost of DNA damage response and repair by enhanced biogenesis of DNA damage response RNAs
    Article Snippet: Analysis of NHEJ accuracy gDNA extracted from untreated or enoxacin-treated EJ5-GFP U2OS cells transfected with I-SceI for 3 days was amplified by PCR with Phusion® High-Fidelity DNA Polymerase (NEB) using primers encompassing I-SceI cut sites (EJ5GFP F/R). .. PCR products between 200–300 bp were gel purified, cloned into pCR™II-Blunt-TOPO® vector (Thermo-Fisher) and analysed by Sanger sequencing for insertions and deletions (indels) at the I-SceI junction.

    In Situ:

    Article Title: Oligodendrocyte Specification in Zebrafish Requires Notch-Regulated Cyclin-Dependent Kinase Inhibitor Function
    Article Snippet: The final plasmid was injected into one-cell stage embryos at a concentration of 30 ng/μl with 1 U/μl I-SceI (New England Biolabs, Beverly, MA), 0.5× I-SceI buffer, and 0.05% phenol red. .. Bromodeoxyuridine labeling, in situ RNA hybridization, and immunocytochemistry.

    Irradiation:

    Article Title: Optimized transgenesis in Xenopus laevis/gilli isogenetic clones for immunological studies
    Article Snippet: Eggs were squeezed into a Petri dish and fertilized in vitro with 500 µl of the irradiated sperm. .. Finally for the I-SceI method, the I-SceI-GFP vector was digested with the I-SceI meganuclease (New England Biolabs) for 40 mins at 37°C and 80 pg DNA along with 1×10−3 U I-SceI were injected per egg.

    Functional Assay:

    Article Title: Turning the fate of reprogramming cells from retinal disorder to regeneration by Pax6 in newts
    Article Snippet: The chicken β-globin HS4 2× core insulator was inserted into the cassette to minimize possible cis interactions within the cassette and between the cassette and functional elements on the chromosome. .. Components of the injected solution (4 nl per embryo) were as follows: pRPE65 > CreERT2 -CAGGs > YFP (I-SceI), 40 ng μl−1 ; pCAGGs > [AmCyan]mCherry-shRNA (I-SceI), 40 ng μl−1 ; I-SceI, 1 U μl−1 ; I-SceI buffer (New England Biolabs), 1X; phenol red, 0.01%.

    Selection:

    Article Title: Translocation Capture Sequencing: A Method for High Throughput Mapping of Chromosomal Rearrangements
    Article Snippet: DNA was purified in Qiagen gel purification columns, gel-based size selection and purification was repeated once. .. Beads were magnetically isolated, washed 3x in 500uL 1x B & W buffer, 1x in H2 O and resuspended in 87ul H2 O. Unrearranged loci were further eliminated by adding 10ul 10x NEB I-Sce1 buffer, 1ul 100x BSA and 2uL of 5,000U/mL I-SceI (NEB), then incubating for 2 hours at 37C.

    Article Title: Adaptation of the GoldenBraid modular cloning system and creation of a toolkit for the expression of heterologous proteins in yeast mitochondria
    Article Snippet: S. cerevisiae Transformation The final plasmids containing the GB-assembled TU constructs were digested with I-SceI (NEB) to generate a linear DNA fragment that was used for S. cerevisiae transformation and genome integration, as described in reference [ ]. .. G418 (200 μg/ml, Santa Cruz Biotechnology) and Hygromycin B (200μg/ml, Formedium) were used for selection.

    Agarose Gel Electrophoresis:

    Article Title: RAG1/2 induces genomic insertions by mobilizing DNA into RAG1/2-independent breaks
    Article Snippet: .. Extracted DNA was digested with I-SceI (New England Biolabs, Inc.) and column purified (MACHEREY-NAGEL), and high molecular weight products (300–2,000 bp) were isolated once more by agarose gel electrophoresis. .. Extracted DNA was sequenced twice using Illumina NextSeq (150 cycles, paired-end).

    Article Title: RAG1/2 induces genomic insertions by mobilizing DNA into RAG1/2-independent breaks
    Article Snippet: PCR products were pooled, and high molecular weight amplicons (280–3,000 bp) were isolated by agarose gel electrophoresis. .. Extracted DNA was digested with I-SceI (New England Biolabs, Inc.) and column purified (MACHEREY-NAGEL).

    Article Title: Translocation Capture Sequencing: A Method for High Throughput Mapping of Chromosomal Rearrangements
    Article Snippet: All 200ul of each sample was run on a 2% agarose gel until well separated and appropriately sized fragments (0.3–1 kb) were excised ( ). .. Beads were magnetically isolated, washed 3x in 500uL 1x B & W buffer, 1x in H2 O and resuspended in 87ul H2 O. Unrearranged loci were further eliminated by adding 10ul 10x NEB I-Sce1 buffer, 1ul 100x BSA and 2uL of 5,000U/mL I-SceI (NEB), then incubating for 2 hours at 37C.

    In Vitro:

    Article Title: Optimized transgenesis in Xenopus laevis/gilli isogenetic clones for immunological studies
    Article Snippet: Eggs were squeezed into a Petri dish and fertilized in vitro with 500 µl of the irradiated sperm. .. Finally for the I-SceI method, the I-SceI-GFP vector was digested with the I-SceI meganuclease (New England Biolabs) for 40 mins at 37°C and 80 pg DNA along with 1×10−3 U I-SceI were injected per egg.

    Transgenic Assay:

    Article Title: The newt reprograms mature RPE cells into a unique multipotent state for retinal regeneration
    Article Snippet: Transgenesis An I-SceI transgenic protocol for the newt was applied to knockdown Pax6. .. Preparation of single-cell embryos, microinjection of the construct [injection volume: 10 µl/embryo; contents: 200 ng of the DNA construct, 0.5 U of I-SceI (R0694S; New England Biolabs Japan, Tokyo, Japan), 1x I-SceI buffer, and 0.01% phenol red], and rearing of the injected animals were performed according to previously published protocols .

    Article Title: Oligodendrocyte Specification in Zebrafish Requires Notch-Regulated Cyclin-Dependent Kinase Inhibitor Function
    Article Snippet: Transgenic lines were obtained essentially as described previously ( ). .. The final plasmid was injected into one-cell stage embryos at a concentration of 30 ng/μl with 1 U/μl I-SceI (New England Biolabs, Beverly, MA), 0.5× I-SceI buffer, and 0.05% phenol red.

    Article Title: Optimized transgenesis in Xenopus laevis/gilli isogenetic clones for immunological studies
    Article Snippet: 0.1 ng of SB mRNA was injected per egg together with 15–20 pg of RNase free HSV-GFP in order to generate transgenic LG clones with the SB method. .. Finally for the I-SceI method, the I-SceI-GFP vector was digested with the I-SceI meganuclease (New England Biolabs) for 40 mins at 37°C and 80 pg DNA along with 1×10−3 U I-SceI were injected per egg.

    Concentration Assay:

    Article Title: High resolution, plasmid-driven cell lineage tracing reveals developmental variability in leech
    Article Snippet: 116 ng/ul of plasmid was preincubated with 0.5 units/ul of I-SceI in 1× buffer (New England Biolabs, Ipswich, MA) at 37° C for 40 minutes in a volume of 5 ul. .. After incubation, 1 ul of 18 mg/ml RDA solution was added to the digest and the resultant mixture (with a final plasmid concentration of 96 ng/ul) was loaded into glass micropipets for injection.

    Article Title: Oligodendrocyte Specification in Zebrafish Requires Notch-Regulated Cyclin-Dependent Kinase Inhibitor Function
    Article Snippet: .. The final plasmid was injected into one-cell stage embryos at a concentration of 30 ng/μl with 1 U/μl I-SceI (New England Biolabs, Beverly, MA), 0.5× I-SceI buffer, and 0.05% phenol red. .. To identify transgenic embryos and, consequently, germ-line-transformed founders, we heat shocked embryos by incubating them at 40°C for 30 min and, after a recovery period, fixed them and performed anti-Myc immunocytochemistry.

    Standard Deviation:

    Article Title: Limiting the Persistence of a Chromosome Break Diminishes Its Mutagenic Potential
    Article Snippet: To ensure complete I-SceI digestion, PCR products were purified using a GFX column (GE), and digested for 1 h (37°C) with 5 U of I-SceI (NEB), followed by an adding another 5 U of I-SceI and 1 h of digestion. .. Repair frequencies are the mean of a minimum of four transfections where error bars represent the standard deviation from the mean.

    FACS:

    Article Title: Limiting the Persistence of a Chromosome Break Diminishes Its Mutagenic Potential
    Article Snippet: The percentage of GFP positive cells was quantified by flow cytometric analysis (FACS) 3 d after transfection on a Cyan ADP (Dako), from cells suspended and fixed in phosphate-buffered formaldehyde. .. To ensure complete I-SceI digestion, PCR products were purified using a GFX column (GE), and digested for 1 h (37°C) with 5 U of I-SceI (NEB), followed by an adding another 5 U of I-SceI and 1 h of digestion.

    Variant Assay:

    Article Title: SLIC-CAGE: high-resolution transcription start site mapping using nanogram-levels of total RNA
    Article Snippet: In the SLIC-CAGE variant, the carrier was mixed with the RNA of interest to the total amount of 5 µg; e.g., 10 ng of RNA of interest were mixed with 4990 ng of carrier mix and subjected to reverse transcription as in the nAnT-iCAGE protocol ( ). .. To degrade the carrier, 14 µL of sample were mixed with I-SceI (5 U) and I-CeuI (5 U) in 1× CutSmart buffer (NEB) and incubated at 37°C for 3 h. The enzymes were heat-inactivated at 65°C for 20 min and the samples purified using AMPure XP beads (1.8× AMPure XP volume per reaction volume, as described in ).

    Fluorescence In Situ Hybridization:

    Article Title: Oligodendrocyte Specification in Zebrafish Requires Notch-Regulated Cyclin-Dependent Kinase Inhibitor Function
    Article Snippet: To produce Tg(hsp70:cdkn1c-myc ) fish, we first exchanged the cytomegalovirus promoter of pCS2+MT ( ) for the zebrafish heat shock 70 ( hsp70 ) promoter ( ) to produce pCS2hsp70+MT. .. The final plasmid was injected into one-cell stage embryos at a concentration of 30 ng/μl with 1 U/μl I-SceI (New England Biolabs, Beverly, MA), 0.5× I-SceI buffer, and 0.05% phenol red.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs i sce i
    Enhanced HDR of chromosomal DSBs in cell lines expressing RAD51 G151D. A. RAD51 WT and G151D were stably expressed in MCF7 cells harboring the I- <t>Sce</t> I reporter construct using the pRVY TET-OFF inducible expression vector. The addition of doxycycline to the media turns off exogenous RAD51 expression (repressed, abbreviated R; endogenous RAD51 protein levels only), with expression induced upon removal of DOX (induced, abbreviated I; endogenous levels + exogenous protein levels). Western blot with an antisera raised against RAD51 protein demonstrates equivalent expression of exogenous WT and G151D (I) in their respective MCF-7 DR-GFP pools (RAD51/tubulin), as well as the fold increase in expression over endogenous RAD51 (I/R). B. The percentage of GFP positive cells was measured by flow cytometry 72hrs after nucleofection with an I- Sce I expression vector. The percentage of GFP-positive cells from MCF-7 DR-GFP parental cells was normalized to 1 and the relative change of percent GFP-positive cells from MCF-7 DR-GFP RAD51 WT and G151D cells was calculated. Data are graphed as mean ± SD from 3 independent experiments ** p
    I Sce I, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/i sce i/product/New England Biolabs
    Average 95 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    i sce i - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results


    Enhanced HDR of chromosomal DSBs in cell lines expressing RAD51 G151D. A. RAD51 WT and G151D were stably expressed in MCF7 cells harboring the I- Sce I reporter construct using the pRVY TET-OFF inducible expression vector. The addition of doxycycline to the media turns off exogenous RAD51 expression (repressed, abbreviated R; endogenous RAD51 protein levels only), with expression induced upon removal of DOX (induced, abbreviated I; endogenous levels + exogenous protein levels). Western blot with an antisera raised against RAD51 protein demonstrates equivalent expression of exogenous WT and G151D (I) in their respective MCF-7 DR-GFP pools (RAD51/tubulin), as well as the fold increase in expression over endogenous RAD51 (I/R). B. The percentage of GFP positive cells was measured by flow cytometry 72hrs after nucleofection with an I- Sce I expression vector. The percentage of GFP-positive cells from MCF-7 DR-GFP parental cells was normalized to 1 and the relative change of percent GFP-positive cells from MCF-7 DR-GFP RAD51 WT and G151D cells was calculated. Data are graphed as mean ± SD from 3 independent experiments ** p

    Journal: PLoS Genetics

    Article Title: The Tumor-Associated Variant RAD51 G151D Induces a Hyper-Recombination Phenotype

    doi: 10.1371/journal.pgen.1006208

    Figure Lengend Snippet: Enhanced HDR of chromosomal DSBs in cell lines expressing RAD51 G151D. A. RAD51 WT and G151D were stably expressed in MCF7 cells harboring the I- Sce I reporter construct using the pRVY TET-OFF inducible expression vector. The addition of doxycycline to the media turns off exogenous RAD51 expression (repressed, abbreviated R; endogenous RAD51 protein levels only), with expression induced upon removal of DOX (induced, abbreviated I; endogenous levels + exogenous protein levels). Western blot with an antisera raised against RAD51 protein demonstrates equivalent expression of exogenous WT and G151D (I) in their respective MCF-7 DR-GFP pools (RAD51/tubulin), as well as the fold increase in expression over endogenous RAD51 (I/R). B. The percentage of GFP positive cells was measured by flow cytometry 72hrs after nucleofection with an I- Sce I expression vector. The percentage of GFP-positive cells from MCF-7 DR-GFP parental cells was normalized to 1 and the relative change of percent GFP-positive cells from MCF-7 DR-GFP RAD51 WT and G151D cells was calculated. Data are graphed as mean ± SD from 3 independent experiments ** p

    Article Snippet: Signals of the +I-Sce I and–I-Sce I bands were quantified using Quantity One software version 4.6.5.

    Techniques: Expressing, Stable Transfection, Construct, Plasmid Preparation, Western Blot, Flow Cytometry, Cytometry

    Schematic of the gene cluster assembly in the yTREX vector. A. The yTREX vector backbone comprises replication elements and selection markers for E. coli (ori, pMB 1 origin of replication; Km R , kanamycin resistance gene) and yeast ( CEN 4 / ARS 1 , S. cerevisiae centromere region and autonomously replicating sequence; URA 3 , orotidine 5′‐phosphate decarboxylase gene) and the yTREX cassettes. L‐ yTREX (orange): oriT, origin of transfer; OE , outside end of transposon Tn5; P T 7 , T7 bacteriophage promoter, R‐ yTREX (green): tnp , Tn5 transposase gene; OE ; Tc R , tetracycline resistance gene; P T 7 . The vector is linearized by hydrolysis with restriction endonuclease I‐ Sce I, thereby exposing the partial I‐ Sce I recognition site and the sequences of the CIS (cluster integration site) at the termini. At the respective CIS 1 and CIS 2 sequences, insert fragments with appropriate homology arms to the CIS sequences and to one another can be integrated via yeast recombineering. Depiction is not drawn to scale. The complete vector sequence is available at the NCBI database (GenBank MK416190) and in the Table S1 in GenBank format. Right panel: Creation of homologous regions for recombination can generally be achieved by PCR and appropriate positioning of fully binding primers. Accordingly, designed primers can be used to re‐assemble large gene clusters in their native organization from freely defined PCR fragments (B). Alternatively, the use of primers with 5′‐elongations adding sequences to match new adjacent fragments enables re‐arrangements of genes or the addition of new parts (C). In this case, primer positions are defined by the ends of the fragments that are to be connected. Find further information under section Generation of gene cluster DNA fragments yeast assembly cloning in the yTREX vector , step 3b.

    Journal: Microbial Biotechnology

    Article Title: Protocols for yTREX/Tn5‐based gene cluster expression in Pseudomonas putida

    doi: 10.1111/1751-7915.13402

    Figure Lengend Snippet: Schematic of the gene cluster assembly in the yTREX vector. A. The yTREX vector backbone comprises replication elements and selection markers for E. coli (ori, pMB 1 origin of replication; Km R , kanamycin resistance gene) and yeast ( CEN 4 / ARS 1 , S. cerevisiae centromere region and autonomously replicating sequence; URA 3 , orotidine 5′‐phosphate decarboxylase gene) and the yTREX cassettes. L‐ yTREX (orange): oriT, origin of transfer; OE , outside end of transposon Tn5; P T 7 , T7 bacteriophage promoter, R‐ yTREX (green): tnp , Tn5 transposase gene; OE ; Tc R , tetracycline resistance gene; P T 7 . The vector is linearized by hydrolysis with restriction endonuclease I‐ Sce I, thereby exposing the partial I‐ Sce I recognition site and the sequences of the CIS (cluster integration site) at the termini. At the respective CIS 1 and CIS 2 sequences, insert fragments with appropriate homology arms to the CIS sequences and to one another can be integrated via yeast recombineering. Depiction is not drawn to scale. The complete vector sequence is available at the NCBI database (GenBank MK416190) and in the Table S1 in GenBank format. Right panel: Creation of homologous regions for recombination can generally be achieved by PCR and appropriate positioning of fully binding primers. Accordingly, designed primers can be used to re‐assemble large gene clusters in their native organization from freely defined PCR fragments (B). Alternatively, the use of primers with 5′‐elongations adding sequences to match new adjacent fragments enables re‐arrangements of genes or the addition of new parts (C). In this case, primer positions are defined by the ends of the fragments that are to be connected. Find further information under section Generation of gene cluster DNA fragments yeast assembly cloning in the yTREX vector , step 3b.

    Article Snippet: Step 1: To linearize the yTREX vector by hydrolyzation using I‐Sce I restriction endonuclease, prepare a 30 μl reaction mixture with 1 μl I‐Sce I (5 U), the manufacturer's buffer (New England Biolabs GmbH, Ipswich, USA) as well as ˜2 μg vector DNA, and incubate for 16 h at 37°C (according to the manufacturer's specifications, a lower amount of enzyme (1–2 U) would also be sufficient for this step).

    Techniques: Plasmid Preparation, Selection, Sequencing, Polymerase Chain Reaction, Binding Assay, Clone Assay

    Reporter knock-in/knock-out alleles at the kcnh6a locus (A) Schematic representation of the genomic structure of the kcnh6a gene, indicating the kcnh6a-int1 TALEN target, and the structures of the donor DNAs (composed in pKH4 vector), highlighting the reporter coding sequences (colored) and translation/transcription termination signal sequences (grey) that are introduced by the donor. Left and right homology arms are bordered by I-Sce I recognition sites in head-to-head orientation (red arrows). Diagnostic primers are depicted: the rP1/kR1 pair specifically amplifies edited alleles, whereas the kF3/kR1 pair amplifies edited and unedited forms of the kcnh6a gene. (B) In vivo I-Sce I-digestion of donor plasmids stimulates genome editing. Individual embryos were injected with kcnh6a (eGFP) or kcnh6a (mCherry) donor DNAs with or without the I-Sce I meganuclease. Edited alleles were detected by PCR with diagnostic primers. (C) Genome editing is enhanced following I-Sce I digestion of donor plasmids, performed either in vivo or in vitro , prior to injection. Zygotes were injected with TALEN RNA and donor plasmid DNA mixed with differing amounts of I-Sce I enzyme on ice until injection (no pre-digestion) or digested in vitro prior to injection (pre-digestion). As a control, in vitro -digested donor plasmid was injected alone. The fraction of edited alleles (detected with the rP1/kR1 primer pair) relative to total kcnh6a alleles (detected with the kF3/kR1 primer pair) present in injected 2 dpf embryos was determined by qPCR. The relative recombination efficiency was determined by normalizing to 1.0 the mean fraction of edited alleles following injection of TALEN RNA and undigested donor plasmid DNA. For each condition, six individual embryos were analyzed (circles) and the mean relative recombination efficiency is indicated (horizontal dash). Unpaired t-test analysis indicated that in vivo or in vitro digestion of donor DNA with 1mU enzyme significantly stimulated the production of edited alleles as compared with untreated donor DNA (p

    Journal: Developmental cell

    Article Title: Precise Editing of the Zebrafish Genome Made Simple and Efficient

    doi: 10.1016/j.devcel.2016.02.015

    Figure Lengend Snippet: Reporter knock-in/knock-out alleles at the kcnh6a locus (A) Schematic representation of the genomic structure of the kcnh6a gene, indicating the kcnh6a-int1 TALEN target, and the structures of the donor DNAs (composed in pKH4 vector), highlighting the reporter coding sequences (colored) and translation/transcription termination signal sequences (grey) that are introduced by the donor. Left and right homology arms are bordered by I-Sce I recognition sites in head-to-head orientation (red arrows). Diagnostic primers are depicted: the rP1/kR1 pair specifically amplifies edited alleles, whereas the kF3/kR1 pair amplifies edited and unedited forms of the kcnh6a gene. (B) In vivo I-Sce I-digestion of donor plasmids stimulates genome editing. Individual embryos were injected with kcnh6a (eGFP) or kcnh6a (mCherry) donor DNAs with or without the I-Sce I meganuclease. Edited alleles were detected by PCR with diagnostic primers. (C) Genome editing is enhanced following I-Sce I digestion of donor plasmids, performed either in vivo or in vitro , prior to injection. Zygotes were injected with TALEN RNA and donor plasmid DNA mixed with differing amounts of I-Sce I enzyme on ice until injection (no pre-digestion) or digested in vitro prior to injection (pre-digestion). As a control, in vitro -digested donor plasmid was injected alone. The fraction of edited alleles (detected with the rP1/kR1 primer pair) relative to total kcnh6a alleles (detected with the kF3/kR1 primer pair) present in injected 2 dpf embryos was determined by qPCR. The relative recombination efficiency was determined by normalizing to 1.0 the mean fraction of edited alleles following injection of TALEN RNA and undigested donor plasmid DNA. For each condition, six individual embryos were analyzed (circles) and the mean relative recombination efficiency is indicated (horizontal dash). Unpaired t-test analysis indicated that in vivo or in vitro digestion of donor DNA with 1mU enzyme significantly stimulated the production of edited alleles as compared with untreated donor DNA (p

    Article Snippet: For co-injection with I-Sce I, 0.25mU or 1mU I-Sc eI enzyme was mixed with 50pg donor DNA and 100pg total TALEN mRNA in 0.5× I-Sce I buffer (NEB).

    Techniques: Knock-In, Knock-Out, Plasmid Preparation, Diagnostic Assay, In Vivo, Injection, Polymerase Chain Reaction, In Vitro, Real-time Polymerase Chain Reaction

    Retinal regeneration in control condition. ( a ) Time schedule of experiments. One-cell stage embryos were microinjected with a solution containing both a Cre driver construct (RPE65 > CreER T2 -CAGGs > YFP) and a loxP reporter/shRNA construct (CAGGs > [AmCyan]mCherry-shRNA). On the sixth day after injection, blastula embryos (St. 10) that uniformly expressed intense fluorescence of both YFP and AmCyan were screened. Swimming larvae at St. 58–59 (~4 months old) were incubated in a rearing solution containing 4 μM (Z)-4-Hydroxytamoxifen (4-OHT) for 48 h. Juvenile newts around 7 months old (1–2 months after metamorphosis) were subjected to surgical removal of both the lens and the neural retina under anesthesia and then allowed to recover for the study of retinal regeneration. ( b,c ) Representative of regenerated retinas at Stage L-2 (n = 4). mCherry fluorescence was observed in the central retina (box). The image is enlarged in ( c ). mCherry fluorescence was localized in both RPE cells and cells in the regenerated NR. In the regenerated NR, the mCherry+ cells composed a column structure similar to those observed in embryonic retinal development 7 8 9 . The column structure was comprised of all kinds of retinal neurons and glia. Interestingly, as in retinal development 9 , cell bodies of the horizontal cells were located distant from the body of the column. Note that in mCherry+ NR cells fluorescence of AmCyan was decreased (Cyan), indicating that Cre-mediated recombination successfully took place in parental RPE cells. Br: brain; ONL: outer nuclear layer; OPL: outer plexiform layer; INL: inner nuclear layer; IPL: inner plexiform layer; GCL: ganglion cell layer. Scale bars: 100 μm. ( d–f ) Contribution of the endogenous retinal stem/progenitor cells in the CMZ during retinal regeneration. Nuclei were counterstained with DAPI. Regenerating NR originating from the CMZ (arrow heads) had covered a large area of the RPE before the central RPE cells reached Stage E1 (right-hand box) to E2 (left-hand box) (n = 7). The images in these boxes are enlarged in ( e , f ) respectively. Dotted line in ( e ) shows Bruch’s membrane and that in ( f ) shows the outer margin of the regenerating NR. The arrow in ( f ) indicates a junction (called the Splayed-joint 1 ) between the CMZ-originating (non-pigmented; left-hand) and RPE-originating regenerating NR (partially pigmented; right-hand). Scale bars: 100 μm. ( g ) Summary of results.

    Journal: Scientific Reports

    Article Title: Turning the fate of reprogramming cells from retinal disorder to regeneration by Pax6 in newts

    doi: 10.1038/srep33761

    Figure Lengend Snippet: Retinal regeneration in control condition. ( a ) Time schedule of experiments. One-cell stage embryos were microinjected with a solution containing both a Cre driver construct (RPE65 > CreER T2 -CAGGs > YFP) and a loxP reporter/shRNA construct (CAGGs > [AmCyan]mCherry-shRNA). On the sixth day after injection, blastula embryos (St. 10) that uniformly expressed intense fluorescence of both YFP and AmCyan were screened. Swimming larvae at St. 58–59 (~4 months old) were incubated in a rearing solution containing 4 μM (Z)-4-Hydroxytamoxifen (4-OHT) for 48 h. Juvenile newts around 7 months old (1–2 months after metamorphosis) were subjected to surgical removal of both the lens and the neural retina under anesthesia and then allowed to recover for the study of retinal regeneration. ( b,c ) Representative of regenerated retinas at Stage L-2 (n = 4). mCherry fluorescence was observed in the central retina (box). The image is enlarged in ( c ). mCherry fluorescence was localized in both RPE cells and cells in the regenerated NR. In the regenerated NR, the mCherry+ cells composed a column structure similar to those observed in embryonic retinal development 7 8 9 . The column structure was comprised of all kinds of retinal neurons and glia. Interestingly, as in retinal development 9 , cell bodies of the horizontal cells were located distant from the body of the column. Note that in mCherry+ NR cells fluorescence of AmCyan was decreased (Cyan), indicating that Cre-mediated recombination successfully took place in parental RPE cells. Br: brain; ONL: outer nuclear layer; OPL: outer plexiform layer; INL: inner nuclear layer; IPL: inner plexiform layer; GCL: ganglion cell layer. Scale bars: 100 μm. ( d–f ) Contribution of the endogenous retinal stem/progenitor cells in the CMZ during retinal regeneration. Nuclei were counterstained with DAPI. Regenerating NR originating from the CMZ (arrow heads) had covered a large area of the RPE before the central RPE cells reached Stage E1 (right-hand box) to E2 (left-hand box) (n = 7). The images in these boxes are enlarged in ( e , f ) respectively. Dotted line in ( e ) shows Bruch’s membrane and that in ( f ) shows the outer margin of the regenerating NR. The arrow in ( f ) indicates a junction (called the Splayed-joint 1 ) between the CMZ-originating (non-pigmented; left-hand) and RPE-originating regenerating NR (partially pigmented; right-hand). Scale bars: 100 μm. ( g ) Summary of results.

    Article Snippet: Components of the injected solution (4 nl per embryo) were as follows: pRPE65 > CreERT2 -CAGGs > YFP (I-SceI), 40 ng μl−1 ; pCAGGs > [AmCyan]mCherry-shRNA (I-SceI), 40 ng μl−1 ; I-SceI, 1 U μl−1 ; I-SceI buffer (New England Biolabs), 1X; phenol red, 0.01%.

    Techniques: Construct, shRNA, Injection, Fluorescence, Incubation