btsimuti  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Name:
    BtsIMutI
    Description:
    BtsIMutI 100 units
    Catalog Number:
    R0664S
    Price:
    105
    Category:
    Restriction Enzymes
    Size:
    100 units
    Buy from Supplier


    Structured Review

    New England Biolabs btsimuti
    BtsIMutI
    BtsIMutI 100 units
    https://www.bioz.com/result/btsimuti/product/New England Biolabs
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    btsimuti - by Bioz Stars, 2021-05
    93/100 stars

    Images

    Related Articles

    Mutagenesis:

    Article Title: Homologous Mutation to Human BRAF V600E is Common in Naturally Occurring Canine Bladder Cancer—Evidence for a Relevant Model System and Urine-based Diagnostic Test
    Article Snippet: An 830 bp region was first amplified using standard PCR protocols and primers F- AATAAATGGGTTTGCATGAGAG and R- TGGCCTCAATTCTTACCATCCAC using 1.8% GC Melt reagent (Clontech Laboratories, Inc., Mountain View, CA). .. The segment was designed to contain two cut sites for the BtsIMutI restriction enzyme (New England Biolabs, Ipswich, MA), one that cuts all canine DNA samples, and one that cuts only wild-type BRAF sequences at the mutation site. .. Wild-type sequences produce three bands of sizes 564/190/76 whereas the mutant sequences produce two bands of sizes 640/190.

    Polymerase Chain Reaction:

    Article Title: Progressive Photoreceptor Dysfunction and Age-Related Macular Degeneration-Like Features in rp1l1 Mutant Zebrafish
    Article Snippet: Once animals with mutant alleles were isolated, they were grown and crossed with AB fish, and their progeny were in-crossed. .. Homozygosity for the 16-base-pair deletion allele used for this work was confirmed in adult animals through finclips, PCR amplification using the same primers, and restriction fragment length polymorphism (RFLP) using BtsIMutI (New England Biolabs, Ipswich, MA, USA). ..

    Article Title: Pronounced Hyperactivity, Cognitive Dysfunctions, and BDNF Dysregulation in Dopamine Transporter Knock-out Rats
    Article Snippet: .. Genotyping was performed by PCR followed by enzymatic digestion with BtsI MutI (New England Biolabs). .. Animals were killed and prefrontal cortex (PFC), dorsolateral striatum (DLStr), and midbrain were dissected and dissociated for 15 min at 37°C with Pronase enzyme (Sigma-Aldrich) in Hank's balanced salt solution (HBSS; Invitrogen).

    Amplification:

    Article Title: Progressive Photoreceptor Dysfunction and Age-Related Macular Degeneration-Like Features in rp1l1 Mutant Zebrafish
    Article Snippet: Once animals with mutant alleles were isolated, they were grown and crossed with AB fish, and their progeny were in-crossed. .. Homozygosity for the 16-base-pair deletion allele used for this work was confirmed in adult animals through finclips, PCR amplification using the same primers, and restriction fragment length polymorphism (RFLP) using BtsIMutI (New England Biolabs, Ipswich, MA, USA). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    New England Biolabs enzyme btsimuti
    Enzyme Btsimuti, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/enzyme btsimuti/product/New England Biolabs
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    enzyme btsimuti - by Bioz Stars, 2021-05
    93/100 stars
      Buy from Supplier

    Image Search Results