pspomi  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Name:
    PspOMI
    Description:
    PspOMI 7 500 units
    Catalog Number:
    R0653L
    Price:
    257
    Category:
    Restriction Enzymes
    Size:
    7 500 units
    Buy from Supplier


    Structured Review

    New England Biolabs pspomi
    PspOMI
    PspOMI 7 500 units
    https://www.bioz.com/result/pspomi/product/New England Biolabs
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pspomi - by Bioz Stars, 2021-04
    93/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Structural basis of keto acid utilization in nonribosomal depsipeptide synthesis.
    Article Snippet: Nonribosomal depsipeptides are natural products composed of amino and hydroxy acid residues. .. Nonribosomal depsipeptides are natural products composed of amino and hydroxy acid residues. ..

    Article Title: Rapid construction of antitumor T-cell receptor vectors from frozen tumors for engineered T-cell therapy
    Article Snippet: .. The linearized destination plasmid (50 ng), which was treated with NotI and PspOMI and gel purified, was mixed with equimolar amounts of Vβ, Cβ-P2A (obtained by PCR using HTTCR#F and HTTCR#G primers from the destination plasmid), and Vα fragments in 10 µl 1×NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) and incubated at 50°C for 60 minutes. .. To clone the TCR-expressing cassette that was amplified from genomic DNA of transduced T cells, linearized plasmid and TCR-expressing cassette insert were mixed at 1:2 molar ratio in 10 µl 1×NEBuilder HiFi DNA Assembly Master Mix and incubated at 50°C for 60 minutes.

    Plasmid Preparation:

    Article Title: Structural basis of keto acid utilization in nonribosomal depsipeptide synthesis.
    Article Snippet: Nonribosomal depsipeptides are natural products composed of amino and hydroxy acid residues. .. Nonribosomal depsipeptides are natural products composed of amino and hydroxy acid residues. ..

    Article Title: An Arabidopsis Stomatin-Like Protein Affects Mitochondrial Respiratory Supercomplex Organization
    Article Snippet: The amplicon was ligated with Nco I restriction sites into an expression cassette with a 35S promoter, a 35S terminator, and enhanced yellow fluorescent protein ( ) at the C terminus of SLP1 ( ). .. The complete expression cassette with AtSLP-eYFP was amplified with primers with Not I overhangs (forward primer, TTTGCGGCCGCATGAACCACCTCGTTCG; reverse primer, TTTGCGGCCGCCTGCGGATCCTTGTTGC), digested with Not I, followed by ligation into the binary vector pTKAN+ ( ) using PspOMI (NEB Biolabs). ..

    Article Title: Rapid construction of antitumor T-cell receptor vectors from frozen tumors for engineered T-cell therapy
    Article Snippet: .. The linearized destination plasmid (50 ng), which was treated with NotI and PspOMI and gel purified, was mixed with equimolar amounts of Vβ, Cβ-P2A (obtained by PCR using HTTCR#F and HTTCR#G primers from the destination plasmid), and Vα fragments in 10 µl 1×NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) and incubated at 50°C for 60 minutes. .. To clone the TCR-expressing cassette that was amplified from genomic DNA of transduced T cells, linearized plasmid and TCR-expressing cassette insert were mixed at 1:2 molar ratio in 10 µl 1×NEBuilder HiFi DNA Assembly Master Mix and incubated at 50°C for 60 minutes.

    Article Title: Cell Size Checkpoint Control by the Retinoblastoma Tumor Suppressor Pathway
    Article Snippet: The aphVIII cassette was a PvuII-SpeI fragment from pSI103 that had been inserted into the HpaI site of pLitmus 38. pE2F1–4 or control plasmid pSI103 was used to transform an mat3–4 strain using paromomycin selection (25 μg/ml), and several suppressed clones were chosen from the pE2F1–4 mat3–4 transformants. .. An approximately 4-kb e2f1–4 genomic fragment was isolated from a positive phage clone by PspOMI digestion and cloned into the vector pLitmus 38 (New England Biolabs) that had an aphVIII cassette encoding paromomycin resistance to generate pE2F1–4. .. The aphVIII cassette was a PvuII-SpeI fragment from pSI103 that had been inserted into the HpaI site of pLitmus 38. pE2F1–4 or control plasmid pSI103 was used to transform an mat3–4 strain using paromomycin selection (25 μg/ml), and several suppressed clones were chosen from the pE2F1–4 mat3–4 transformants.

    Construct:

    Article Title: Structural basis of keto acid utilization in nonribosomal depsipeptide synthesis.
    Article Snippet: Nonribosomal depsipeptides are natural products composed of amino and hydroxy acid residues. .. Nonribosomal depsipeptides are natural products composed of amino and hydroxy acid residues. ..

    Article Title: Highly Active Antiretroviral Therapies Are Effective against HIV-1 Cell-to-Cell Transmission
    Article Snippet: The plasmid encoding the M184V mutation in reverse transcriptase (pNL4-3ΔEnv(M184V)) was kindly donated by Robert Siliciano, Johns Hopkins University. .. To generate a wild type version of the M184V mutant, the construct was digested with PspOMI and AgeI (New England Biolabs). .. The ∼1.5 kb fragment generated was then ligated to the ∼13 kb fragment of wild type NL4-3 after digestion with the same enzymes.

    Article Title: Evaluation of sgRNA Target Sites for CRISPR-Mediated Repression of TP53
    Article Snippet: This step results in a RNA polymerase III U6 promoter-driven sgRNA expression cassette consisting of a 20–25 nucleotide domain complementary to a target DNA region, a Cas9-binding hairpin, and a transcription terminator. .. The U6-sgRNA expression construct was then digested with PspOMI and NotI-HF (New England BioLabs, Ipswich, MA, USA) and ligated into pCru5-1.2.1-BFP-IRES-Blast that was digested with NotI-HF to create pCru5-BFP-IRES-Blast-U6 sgRNA. .. Mammalian codon-optimized Streptococcus pyogenes dCas9 sequence with nuclease-inactivating D10A and H840A substitutions (Addgene plasmid 44246) was fused to three C-terminal NLS (DPKKKRKV) sequences alone or with the KRAB domain sequence.

    Sequencing:

    Article Title: Structural basis of keto acid utilization in nonribosomal depsipeptide synthesis.
    Article Snippet: Nonribosomal depsipeptides are natural products composed of amino and hydroxy acid residues. .. Nonribosomal depsipeptides are natural products composed of amino and hydroxy acid residues. ..

    Article Title: transparent, a gene affecting stripe formation in Zebrafish, encodes the mitochondrial protein Mpv17 that is required for iridophore survival
    Article Snippet: Acridine Orange test: 24 hpf, 48 hpf, 72 hpf and 96 hpf embryos and larvae were stained with Acridine Orange as described previously ( ). .. RNA rescue Mpv17 coding sequence was amplified with the primers mpv17 (see above) and subcloned into pCRII-TOPO (Invitrogen) followed by subcloning into pCS2+ using BamHI and PspOMI (NEB) and sequencing. .. For the mpv17:EGFP fusion construct, EGFP and mpv17 coding sequences were amplified (egfp oligos: 5′- GCT AGC GTG AGC AAG GGC GAG GAG and 5′- CTC GAG TTA CTT GTA CAG CTC GTC C; mpv17 oligos: 5′- GGA TCC CGA GCA TCA CCT TAT GTT G and 5′- GCT AGC CAT CTT GTT GGC TTT CCA G) and ligated into pCS2+ followed by sequencing.

    Ligation:

    Article Title: Selection of high-affinity Centyrin FN3 domains from a simple library diversified at a combination of strand and loop positions.
    Article Snippet: The full-length library was constructed by digesting the three cassettes with BsaI restriction enzyme (NEB, Ipswich, MA, USA) and performing a triple ligation using T4 DNA Ligase (NEB). .. The full-length ligation product was digested with NotI restriction enzyme (NEB) and a digestion and ligation reaction was performed with RepA in the D ow nloaded from https://academ ic.oup.com /peds/article/27/10/419/2330104 by guest on 31 August 2020 presence of NotI and PspOMI (NEB). .. The full-length TACTCL14-RepA CIS display library was amplified by PCR from the digestion/ligation reaction using R1RecFor and DigLigRev (CATGATTACGCCAAGCTCAGAA) as the forward and reverse primers, respectively.

    Article Title: An Arabidopsis Stomatin-Like Protein Affects Mitochondrial Respiratory Supercomplex Organization
    Article Snippet: The amplicon was ligated with Nco I restriction sites into an expression cassette with a 35S promoter, a 35S terminator, and enhanced yellow fluorescent protein ( ) at the C terminus of SLP1 ( ). .. The complete expression cassette with AtSLP-eYFP was amplified with primers with Not I overhangs (forward primer, TTTGCGGCCGCATGAACCACCTCGTTCG; reverse primer, TTTGCGGCCGCCTGCGGATCCTTGTTGC), digested with Not I, followed by ligation into the binary vector pTKAN+ ( ) using PspOMI (NEB Biolabs). ..

    Mutagenesis:

    Article Title: Highly Active Antiretroviral Therapies Are Effective against HIV-1 Cell-to-Cell Transmission
    Article Snippet: The plasmid encoding the M184V mutation in reverse transcriptase (pNL4-3ΔEnv(M184V)) was kindly donated by Robert Siliciano, Johns Hopkins University. .. To generate a wild type version of the M184V mutant, the construct was digested with PspOMI and AgeI (New England Biolabs). .. The ∼1.5 kb fragment generated was then ligated to the ∼13 kb fragment of wild type NL4-3 after digestion with the same enzymes.

    Expressing:

    Article Title: An Arabidopsis Stomatin-Like Protein Affects Mitochondrial Respiratory Supercomplex Organization
    Article Snippet: The amplicon was ligated with Nco I restriction sites into an expression cassette with a 35S promoter, a 35S terminator, and enhanced yellow fluorescent protein ( ) at the C terminus of SLP1 ( ). .. The complete expression cassette with AtSLP-eYFP was amplified with primers with Not I overhangs (forward primer, TTTGCGGCCGCATGAACCACCTCGTTCG; reverse primer, TTTGCGGCCGCCTGCGGATCCTTGTTGC), digested with Not I, followed by ligation into the binary vector pTKAN+ ( ) using PspOMI (NEB Biolabs). ..

    Article Title: Evaluation of sgRNA Target Sites for CRISPR-Mediated Repression of TP53
    Article Snippet: This step results in a RNA polymerase III U6 promoter-driven sgRNA expression cassette consisting of a 20–25 nucleotide domain complementary to a target DNA region, a Cas9-binding hairpin, and a transcription terminator. .. The U6-sgRNA expression construct was then digested with PspOMI and NotI-HF (New England BioLabs, Ipswich, MA, USA) and ligated into pCru5-1.2.1-BFP-IRES-Blast that was digested with NotI-HF to create pCru5-BFP-IRES-Blast-U6 sgRNA. .. Mammalian codon-optimized Streptococcus pyogenes dCas9 sequence with nuclease-inactivating D10A and H840A substitutions (Addgene plasmid 44246) was fused to three C-terminal NLS (DPKKKRKV) sequences alone or with the KRAB domain sequence.

    Amplification:

    Article Title: An Arabidopsis Stomatin-Like Protein Affects Mitochondrial Respiratory Supercomplex Organization
    Article Snippet: The amplicon was ligated with Nco I restriction sites into an expression cassette with a 35S promoter, a 35S terminator, and enhanced yellow fluorescent protein ( ) at the C terminus of SLP1 ( ). .. The complete expression cassette with AtSLP-eYFP was amplified with primers with Not I overhangs (forward primer, TTTGCGGCCGCATGAACCACCTCGTTCG; reverse primer, TTTGCGGCCGCCTGCGGATCCTTGTTGC), digested with Not I, followed by ligation into the binary vector pTKAN+ ( ) using PspOMI (NEB Biolabs). ..

    Article Title: transparent, a gene affecting stripe formation in Zebrafish, encodes the mitochondrial protein Mpv17 that is required for iridophore survival
    Article Snippet: Acridine Orange test: 24 hpf, 48 hpf, 72 hpf and 96 hpf embryos and larvae were stained with Acridine Orange as described previously ( ). .. RNA rescue Mpv17 coding sequence was amplified with the primers mpv17 (see above) and subcloned into pCRII-TOPO (Invitrogen) followed by subcloning into pCS2+ using BamHI and PspOMI (NEB) and sequencing. .. For the mpv17:EGFP fusion construct, EGFP and mpv17 coding sequences were amplified (egfp oligos: 5′- GCT AGC GTG AGC AAG GGC GAG GAG and 5′- CTC GAG TTA CTT GTA CAG CTC GTC C; mpv17 oligos: 5′- GGA TCC CGA GCA TCA CCT TAT GTT G and 5′- GCT AGC CAT CTT GTT GGC TTT CCA G) and ligated into pCS2+ followed by sequencing.

    Purification:

    Article Title: Rapid construction of antitumor T-cell receptor vectors from frozen tumors for engineered T-cell therapy
    Article Snippet: .. The linearized destination plasmid (50 ng), which was treated with NotI and PspOMI and gel purified, was mixed with equimolar amounts of Vβ, Cβ-P2A (obtained by PCR using HTTCR#F and HTTCR#G primers from the destination plasmid), and Vα fragments in 10 µl 1×NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) and incubated at 50°C for 60 minutes. .. To clone the TCR-expressing cassette that was amplified from genomic DNA of transduced T cells, linearized plasmid and TCR-expressing cassette insert were mixed at 1:2 molar ratio in 10 µl 1×NEBuilder HiFi DNA Assembly Master Mix and incubated at 50°C for 60 minutes.

    Incubation:

    Article Title: Rapid construction of antitumor T-cell receptor vectors from frozen tumors for engineered T-cell therapy
    Article Snippet: .. The linearized destination plasmid (50 ng), which was treated with NotI and PspOMI and gel purified, was mixed with equimolar amounts of Vβ, Cβ-P2A (obtained by PCR using HTTCR#F and HTTCR#G primers from the destination plasmid), and Vα fragments in 10 µl 1×NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) and incubated at 50°C for 60 minutes. .. To clone the TCR-expressing cassette that was amplified from genomic DNA of transduced T cells, linearized plasmid and TCR-expressing cassette insert were mixed at 1:2 molar ratio in 10 µl 1×NEBuilder HiFi DNA Assembly Master Mix and incubated at 50°C for 60 minutes.

    Subcloning:

    Article Title: transparent, a gene affecting stripe formation in Zebrafish, encodes the mitochondrial protein Mpv17 that is required for iridophore survival
    Article Snippet: Acridine Orange test: 24 hpf, 48 hpf, 72 hpf and 96 hpf embryos and larvae were stained with Acridine Orange as described previously ( ). .. RNA rescue Mpv17 coding sequence was amplified with the primers mpv17 (see above) and subcloned into pCRII-TOPO (Invitrogen) followed by subcloning into pCS2+ using BamHI and PspOMI (NEB) and sequencing. .. For the mpv17:EGFP fusion construct, EGFP and mpv17 coding sequences were amplified (egfp oligos: 5′- GCT AGC GTG AGC AAG GGC GAG GAG and 5′- CTC GAG TTA CTT GTA CAG CTC GTC C; mpv17 oligos: 5′- GGA TCC CGA GCA TCA CCT TAT GTT G and 5′- GCT AGC CAT CTT GTT GGC TTT CCA G) and ligated into pCS2+ followed by sequencing.

    Isolation:

    Article Title: Cell Size Checkpoint Control by the Retinoblastoma Tumor Suppressor Pathway
    Article Snippet: The aphVIII cassette was a PvuII-SpeI fragment from pSI103 that had been inserted into the HpaI site of pLitmus 38. pE2F1–4 or control plasmid pSI103 was used to transform an mat3–4 strain using paromomycin selection (25 μg/ml), and several suppressed clones were chosen from the pE2F1–4 mat3–4 transformants. .. An approximately 4-kb e2f1–4 genomic fragment was isolated from a positive phage clone by PspOMI digestion and cloned into the vector pLitmus 38 (New England Biolabs) that had an aphVIII cassette encoding paromomycin resistance to generate pE2F1–4. .. The aphVIII cassette was a PvuII-SpeI fragment from pSI103 that had been inserted into the HpaI site of pLitmus 38. pE2F1–4 or control plasmid pSI103 was used to transform an mat3–4 strain using paromomycin selection (25 μg/ml), and several suppressed clones were chosen from the pE2F1–4 mat3–4 transformants.

    Clone Assay:

    Article Title: Cell Size Checkpoint Control by the Retinoblastoma Tumor Suppressor Pathway
    Article Snippet: The aphVIII cassette was a PvuII-SpeI fragment from pSI103 that had been inserted into the HpaI site of pLitmus 38. pE2F1–4 or control plasmid pSI103 was used to transform an mat3–4 strain using paromomycin selection (25 μg/ml), and several suppressed clones were chosen from the pE2F1–4 mat3–4 transformants. .. An approximately 4-kb e2f1–4 genomic fragment was isolated from a positive phage clone by PspOMI digestion and cloned into the vector pLitmus 38 (New England Biolabs) that had an aphVIII cassette encoding paromomycin resistance to generate pE2F1–4. .. The aphVIII cassette was a PvuII-SpeI fragment from pSI103 that had been inserted into the HpaI site of pLitmus 38. pE2F1–4 or control plasmid pSI103 was used to transform an mat3–4 strain using paromomycin selection (25 μg/ml), and several suppressed clones were chosen from the pE2F1–4 mat3–4 transformants.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    New England Biolabs pspomi
    Pspomi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pspomi/product/New England Biolabs
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pspomi - by Bioz Stars, 2021-04
    93/100 stars
      Buy from Supplier

    Image Search Results