afei  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
    Name:
    AfeI
    Description:
    AfeI 1 000 units
    Catalog Number:
    r0652l
    Price:
    290
    Category:
    Restriction Enzymes
    Size:
    1 000 units
    		Buy from Supplier

    Structured Review

    New England Biolabs afei
    AfeI
    AfeI 1 000 units
    https://www.bioz.com/result/afei/product/New England Biolabs
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    afei - by Bioz Stars, 2021-03
    93/100 stars

    Images

    1) Product Images from "The Exported Chaperone PfHsp70x Is Dispensable for the Plasmodium falciparum Intraerythrocytic Life Cycle"

    Article Title: The Exported Chaperone PfHsp70x Is Dispensable for the Plasmodium falciparum Intraerythrocytic Life Cycle

    Journal: mSphere

    doi: 10.1128/mSphere.00363-17

    CRISPR/Cas9-mediated integration of HA-glmS/M9 at the PfHsp70x locus. (A) Diagram showing integration of the HA-ribozyme sequence and GlcN-induced degradation of mRNA. Cas9 introduces a double-stranded break at the beginning of the 3′ UTR of the pfhsp70x locus. The repair plasmid provides homology regions for double-crossover homologous recombination, introducing a triple-hemagglutinin (HA) tag and the ribozyme sequence. Following translation and addition of glucosamine (GlcN), the PfHsp70x- glmS mRNA is cleaved by the ribozyme and is subject to degradation. C-term, C terminus. (B) PCR test confirming integration at the PfHsp70x locus. DNA was purified from transfected, cloned parasites, and primers were used to amplify the region between the C terminus and the 3′ UTR of pfhsp70x . The PCR products were digested with AfeI, further confirming integration. (C) IFA showing export of HA-tagged PfHsp70x. Asynchronous PfHsp70x- glmS parasites were fixed with acetone and stained with specific antibodies. From left to right, the images are phase-contrast micrographs of parasites, parasites stained with DAPI (parasite nucleus) (blue), parasites stained with anti-HA antibody (red), parasites stained with anti-MAHRP1 antibody (green), and fluorescence merge images of the parasites. Abbreviations: R, rings; T, trophozoites; S, schizonts. Bar, 5 µm.
    Figure Legend Snippet: CRISPR/Cas9-mediated integration of HA-glmS/M9 at the PfHsp70x locus. (A) Diagram showing integration of the HA-ribozyme sequence and GlcN-induced degradation of mRNA. Cas9 introduces a double-stranded break at the beginning of the 3′ UTR of the pfhsp70x locus. The repair plasmid provides homology regions for double-crossover homologous recombination, introducing a triple-hemagglutinin (HA) tag and the ribozyme sequence. Following translation and addition of glucosamine (GlcN), the PfHsp70x- glmS mRNA is cleaved by the ribozyme and is subject to degradation. C-term, C terminus. (B) PCR test confirming integration at the PfHsp70x locus. DNA was purified from transfected, cloned parasites, and primers were used to amplify the region between the C terminus and the 3′ UTR of pfhsp70x . The PCR products were digested with AfeI, further confirming integration. (C) IFA showing export of HA-tagged PfHsp70x. Asynchronous PfHsp70x- glmS parasites were fixed with acetone and stained with specific antibodies. From left to right, the images are phase-contrast micrographs of parasites, parasites stained with DAPI (parasite nucleus) (blue), parasites stained with anti-HA antibody (red), parasites stained with anti-MAHRP1 antibody (green), and fluorescence merge images of the parasites. Abbreviations: R, rings; T, trophozoites; S, schizonts. Bar, 5 µm.

    Techniques Used: CRISPR, Sequencing, Plasmid Preparation, Homologous Recombination, Polymerase Chain Reaction, Purification, Transfection, Clone Assay, Immunofluorescence, Staining, Fluorescence

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Differential processing and localization of human Nocturnin controls metabolism of mRNA and nicotinamide dinucleotide metabolites
    Article Snippet: All NOCT inserts generated in pCR4 TOPO were then transferred to pF5A using the Flexi Cloning System (Promega). .. To generate NOCT ( - ) EGFP, the EGFP ORF was PCR amplified from the pEGFPN1 vector (Clontech) with appended 5′ AfeI and 3′ EcoRI restriction sites. pF5A NOCT(1-431) was digested with AfeI and EcoRI to remove NOCT ( -431), which was replaced by the EGFP ORF using T4 DNA ligase (NEB). .. We note that the initiator methionine codon of the EGFP ORF was not included in this construct.

    Article Title: The Exported Chaperone PfHsp70x Is Dispensable for the Plasmodium falciparum Intraerythrocytic Life Cycle
    Article Snippet: .. The C terminus of the pfhsp70x coding region was PCR amplified from genomic DNA using primers 5′ AATTCGCCCTTCCGCGGGCTGTACAAGCAGCCATCTTATCAGGTGATCAATCATC 3′ and 5′ ATCGTATGGGTAAGCGCTATTTACTTCTTCAACGGTTGGTCCATTATTTTGTGCTTC 3′ and inserted into pHA-glmS and pHA-M9 using restriction sites SacII and AfeI (New England Biolabs). .. The 3′ untranslated region (3′ UTR) of pfhsp70x was PCR amplified from genomic DNA using primers 5′ ATGATCTTGCCGGCAAGCTTACGAAAATATACAACAATAATGCATAAAATAATAATAATT 3′ and 5′ CCTTGAGCTCGCTAGCGCAATATAAATGGATTATTCCTTTTGTATATAATTTAAAATAAG 3′ and inserted into pHA-glmS and pHA-M9 (already containing the C-terminal homology region) using restriction sites HindIII and NheI (New England Biolabs).

    Article Title: Slow growth dictates non-heritable antibiotic resistance in Salmonella enterica
    Article Snippet: Phusion® High-Fidelity DNA Polymerase (New England BioLabs) was used in reactions with primers W2990 and W2991 and genomic DNA derived from Salmonella strain MS7953 ( phoP ::Tn 10 ) ( ). .. Polymerase chain reaction (PCR) product was ligated into pKD4 ( ) digested with BglII and AfeI using NEBuilder® HiFi DNA Assembly Cloning Kit (New England BioLabs). .. Plasmid was transformed into EC100D cells (Epicentre).

    Amplification:

    Article Title: Differential processing and localization of human Nocturnin controls metabolism of mRNA and nicotinamide dinucleotide metabolites
    Article Snippet: All NOCT inserts generated in pCR4 TOPO were then transferred to pF5A using the Flexi Cloning System (Promega). .. To generate NOCT ( - ) EGFP, the EGFP ORF was PCR amplified from the pEGFPN1 vector (Clontech) with appended 5′ AfeI and 3′ EcoRI restriction sites. pF5A NOCT(1-431) was digested with AfeI and EcoRI to remove NOCT ( -431), which was replaced by the EGFP ORF using T4 DNA ligase (NEB). .. We note that the initiator methionine codon of the EGFP ORF was not included in this construct.

    Article Title: The Exported Chaperone PfHsp70x Is Dispensable for the Plasmodium falciparum Intraerythrocytic Life Cycle
    Article Snippet: .. The C terminus of the pfhsp70x coding region was PCR amplified from genomic DNA using primers 5′ AATTCGCCCTTCCGCGGGCTGTACAAGCAGCCATCTTATCAGGTGATCAATCATC 3′ and 5′ ATCGTATGGGTAAGCGCTATTTACTTCTTCAACGGTTGGTCCATTATTTTGTGCTTC 3′ and inserted into pHA-glmS and pHA-M9 using restriction sites SacII and AfeI (New England Biolabs). .. The 3′ untranslated region (3′ UTR) of pfhsp70x was PCR amplified from genomic DNA using primers 5′ ATGATCTTGCCGGCAAGCTTACGAAAATATACAACAATAATGCATAAAATAATAATAATT 3′ and 5′ CCTTGAGCTCGCTAGCGCAATATAAATGGATTATTCCTTTTGTATATAATTTAAAATAAG 3′ and inserted into pHA-glmS and pHA-M9 (already containing the C-terminal homology region) using restriction sites HindIII and NheI (New England Biolabs).

    Plasmid Preparation:

    Article Title: Differential processing and localization of human Nocturnin controls metabolism of mRNA and nicotinamide dinucleotide metabolites
    Article Snippet: All NOCT inserts generated in pCR4 TOPO were then transferred to pF5A using the Flexi Cloning System (Promega). .. To generate NOCT ( - ) EGFP, the EGFP ORF was PCR amplified from the pEGFPN1 vector (Clontech) with appended 5′ AfeI and 3′ EcoRI restriction sites. pF5A NOCT(1-431) was digested with AfeI and EcoRI to remove NOCT ( -431), which was replaced by the EGFP ORF using T4 DNA ligase (NEB). .. We note that the initiator methionine codon of the EGFP ORF was not included in this construct.

    Article Title: Regulation of gene expression by altered promoter methylation using a CRISPR/Cas9-mediated epigenetic editing system
    Article Snippet: Homology arms were PCR amplified from genomic DNA extracted from NIH3T3 (ATCC, USA) cells and cloned into EcoRI (R0101S, New England Biolabs) and SalI (R0138S, New England Biolabs) digested pUC19 vector (EZ002S, Enzynomics). .. Then, synthesized a 260-mer oligonucleotide containing altered CpG dinucleotides and reporter sites was cloned into the above donor pUC19 vector following digestion with AfeI (R0652L, New England Biolabs) and BamHI (R0136S, New England Biolabs). .. The dCas9-Tet1 plasmid was constructed based on the parental plasmid PX458.

    Article Title: Restoring the pattern of proteoglycan sulphation in perineuronal nets corrects age-related memory loss
    Article Snippet: .. Generation of adeno-associated viral vectors The plasmid encoding AAV-PGK-chst3 was made by amplifying the mouse chst3 sequence from plasmid MR207541 (OriGene) via the primers 5’ GGAATTCATAGGGCGGCCGGGAA 3’ and 5’ AGCGCTGGCCGGCCGTTTAAAC 3’ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593) between the AfeI (NEB, R0652) and EcoRI (NEB, R0101) sites to substitute the Cre recombinase gene. .. The eGFP sequence of AAV-CMV-eGFP (Addgene plasmid # 67634) was amplified by using the primers 5’ GGAATTCATGGTGAGCAAGGGCGAG 3’ and 5’ AGCGCTTTACTTGTACAGCTCGTCCATG 3’, which was next cloned into the digested AAV-PGK-backbone.

    Synthesized:

    Article Title: Regulation of gene expression by altered promoter methylation using a CRISPR/Cas9-mediated epigenetic editing system
    Article Snippet: Homology arms were PCR amplified from genomic DNA extracted from NIH3T3 (ATCC, USA) cells and cloned into EcoRI (R0101S, New England Biolabs) and SalI (R0138S, New England Biolabs) digested pUC19 vector (EZ002S, Enzynomics). .. Then, synthesized a 260-mer oligonucleotide containing altered CpG dinucleotides and reporter sites was cloned into the above donor pUC19 vector following digestion with AfeI (R0652L, New England Biolabs) and BamHI (R0136S, New England Biolabs). .. The dCas9-Tet1 plasmid was constructed based on the parental plasmid PX458.

    Clone Assay:

    Article Title: Regulation of gene expression by altered promoter methylation using a CRISPR/Cas9-mediated epigenetic editing system
    Article Snippet: Homology arms were PCR amplified from genomic DNA extracted from NIH3T3 (ATCC, USA) cells and cloned into EcoRI (R0101S, New England Biolabs) and SalI (R0138S, New England Biolabs) digested pUC19 vector (EZ002S, Enzynomics). .. Then, synthesized a 260-mer oligonucleotide containing altered CpG dinucleotides and reporter sites was cloned into the above donor pUC19 vector following digestion with AfeI (R0652L, New England Biolabs) and BamHI (R0136S, New England Biolabs). .. The dCas9-Tet1 plasmid was constructed based on the parental plasmid PX458.

    Article Title: Broadly Neutralizing Antibody Mediated Clearance of Human Hepatitis C Virus Infection
    Article Snippet: HCVcc chimeras were generated as previously described ( ; ). .. Briefly, after digestion of the HCVcc backbone with AfeI (New England Biolabs), c110 and c117 E12 genes were inserted in frame using In-Fusion cloning (Clontech). .. Plasmid DNA was linearized using XbaI (New England Biolabs) then used for in vitro RNA transcription using the T7 MEGAscript kit (Ambion).

    Article Title: Restoring the pattern of proteoglycan sulphation in perineuronal nets corrects age-related memory loss
    Article Snippet: .. Generation of adeno-associated viral vectors The plasmid encoding AAV-PGK-chst3 was made by amplifying the mouse chst3 sequence from plasmid MR207541 (OriGene) via the primers 5’ GGAATTCATAGGGCGGCCGGGAA 3’ and 5’ AGCGCTGGCCGGCCGTTTAAAC 3’ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593) between the AfeI (NEB, R0652) and EcoRI (NEB, R0101) sites to substitute the Cre recombinase gene. .. The eGFP sequence of AAV-CMV-eGFP (Addgene plasmid # 67634) was amplified by using the primers 5’ GGAATTCATGGTGAGCAAGGGCGAG 3’ and 5’ AGCGCTTTACTTGTACAGCTCGTCCATG 3’, which was next cloned into the digested AAV-PGK-backbone.

    Article Title: Slow growth dictates non-heritable antibiotic resistance in Salmonella enterica
    Article Snippet: Phusion® High-Fidelity DNA Polymerase (New England BioLabs) was used in reactions with primers W2990 and W2991 and genomic DNA derived from Salmonella strain MS7953 ( phoP ::Tn 10 ) ( ). .. Polymerase chain reaction (PCR) product was ligated into pKD4 ( ) digested with BglII and AfeI using NEBuilder® HiFi DNA Assembly Cloning Kit (New England BioLabs). .. Plasmid was transformed into EC100D cells (Epicentre).

    Sequencing:

    Article Title: Restoring the pattern of proteoglycan sulphation in perineuronal nets corrects age-related memory loss
    Article Snippet: .. Generation of adeno-associated viral vectors The plasmid encoding AAV-PGK-chst3 was made by amplifying the mouse chst3 sequence from plasmid MR207541 (OriGene) via the primers 5’ GGAATTCATAGGGCGGCCGGGAA 3’ and 5’ AGCGCTGGCCGGCCGTTTAAAC 3’ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593) between the AfeI (NEB, R0652) and EcoRI (NEB, R0101) sites to substitute the Cre recombinase gene. .. The eGFP sequence of AAV-CMV-eGFP (Addgene plasmid # 67634) was amplified by using the primers 5’ GGAATTCATGGTGAGCAAGGGCGAG 3’ and 5’ AGCGCTTTACTTGTACAGCTCGTCCATG 3’, which was next cloned into the digested AAV-PGK-backbone.

    Transfection:

    Article Title: Ku Regulates the Non-Homologous End Joining Pathway Choice of DNA Double-Strand Break Repair in Human Somatic Cells
    Article Snippet: .. In brief, 2.5 µg of EcoRV - (NEB) and AfeI - (NEB) digested plasmid pDVG94 were transfected into cells that were ∼60% confluent, in 6 well plates, using Lipofectamine 2000 (Invitrogen) according to manufacturer's instruction. .. The transfection efficiencies of wild-type HCT116 and the derivative mutant cell lines were determined using the plasmid pEGFP-Pem1 as described above.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • afei  (New England Biolabs)
    93
    New England Biolabs afei
    CRISPR/Cas9-mediated integration of <t>HA-glmS/M9</t> at the PfHsp70x locus. (A) Diagram showing integration of the HA-ribozyme sequence and GlcN-induced degradation of mRNA. Cas9 introduces a double-stranded break at the beginning of the 3′ UTR of the pfhsp70x locus. The repair plasmid provides homology regions for double-crossover homologous recombination, introducing a triple-hemagglutinin (HA) tag and the ribozyme sequence. Following translation and addition of glucosamine (GlcN), the PfHsp70x- glmS mRNA is cleaved by the ribozyme and is subject to degradation. C-term, C terminus. (B) PCR test confirming integration at the PfHsp70x locus. DNA was purified from transfected, cloned parasites, and primers were used to amplify the region between the C terminus and the 3′ UTR of pfhsp70x . The PCR products were digested with <t>AfeI,</t> further confirming integration. (C) IFA showing export of HA-tagged PfHsp70x. Asynchronous PfHsp70x- glmS parasites were fixed with acetone and stained with specific antibodies. From left to right, the images are phase-contrast micrographs of parasites, parasites stained with DAPI (parasite nucleus) (blue), parasites stained with anti-HA antibody (red), parasites stained with anti-MAHRP1 antibody (green), and fluorescence merge images of the parasites. Abbreviations: R, rings; T, trophozoites; S, schizonts. Bar, 5 µm.
    Afei, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/afei/product/New England Biolabs
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    afei - by Bioz Stars, 2021-03
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    CRISPR/Cas9-mediated integration of HA-glmS/M9 at the PfHsp70x locus. (A) Diagram showing integration of the HA-ribozyme sequence and GlcN-induced degradation of mRNA. Cas9 introduces a double-stranded break at the beginning of the 3′ UTR of the pfhsp70x locus. The repair plasmid provides homology regions for double-crossover homologous recombination, introducing a triple-hemagglutinin (HA) tag and the ribozyme sequence. Following translation and addition of glucosamine (GlcN), the PfHsp70x- glmS mRNA is cleaved by the ribozyme and is subject to degradation. C-term, C terminus. (B) PCR test confirming integration at the PfHsp70x locus. DNA was purified from transfected, cloned parasites, and primers were used to amplify the region between the C terminus and the 3′ UTR of pfhsp70x . The PCR products were digested with AfeI, further confirming integration. (C) IFA showing export of HA-tagged PfHsp70x. Asynchronous PfHsp70x- glmS parasites were fixed with acetone and stained with specific antibodies. From left to right, the images are phase-contrast micrographs of parasites, parasites stained with DAPI (parasite nucleus) (blue), parasites stained with anti-HA antibody (red), parasites stained with anti-MAHRP1 antibody (green), and fluorescence merge images of the parasites. Abbreviations: R, rings; T, trophozoites; S, schizonts. Bar, 5 µm.

    Journal: mSphere

    Article Title: The Exported Chaperone PfHsp70x Is Dispensable for the Plasmodium falciparum Intraerythrocytic Life Cycle

    doi: 10.1128/mSphere.00363-17

    Figure Lengend Snippet: CRISPR/Cas9-mediated integration of HA-glmS/M9 at the PfHsp70x locus. (A) Diagram showing integration of the HA-ribozyme sequence and GlcN-induced degradation of mRNA. Cas9 introduces a double-stranded break at the beginning of the 3′ UTR of the pfhsp70x locus. The repair plasmid provides homology regions for double-crossover homologous recombination, introducing a triple-hemagglutinin (HA) tag and the ribozyme sequence. Following translation and addition of glucosamine (GlcN), the PfHsp70x- glmS mRNA is cleaved by the ribozyme and is subject to degradation. C-term, C terminus. (B) PCR test confirming integration at the PfHsp70x locus. DNA was purified from transfected, cloned parasites, and primers were used to amplify the region between the C terminus and the 3′ UTR of pfhsp70x . The PCR products were digested with AfeI, further confirming integration. (C) IFA showing export of HA-tagged PfHsp70x. Asynchronous PfHsp70x- glmS parasites were fixed with acetone and stained with specific antibodies. From left to right, the images are phase-contrast micrographs of parasites, parasites stained with DAPI (parasite nucleus) (blue), parasites stained with anti-HA antibody (red), parasites stained with anti-MAHRP1 antibody (green), and fluorescence merge images of the parasites. Abbreviations: R, rings; T, trophozoites; S, schizonts. Bar, 5 µm.

    Article Snippet: The C terminus of the pfhsp70x coding region was PCR amplified from genomic DNA using primers 5′ AATTCGCCCTTCCGCGGGCTGTACAAGCAGCCATCTTATCAGGTGATCAATCATC 3′ and 5′ ATCGTATGGGTAAGCGCTATTTACTTCTTCAACGGTTGGTCCATTATTTTGTGCTTC 3′ and inserted into pHA-glmS and pHA-M9 using restriction sites SacII and AfeI (New England Biolabs).

    Techniques: CRISPR, Sequencing, Plasmid Preparation, Homologous Recombination, Polymerase Chain Reaction, Purification, Transfection, Clone Assay, Immunofluorescence, Staining, Fluorescence