bpu10i  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    Bpu10I
    Description:
    Bpu10I 1 000 units
    Catalog Number:
    r0649l
    Price:
    277
    Size:
    1 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs bpu10i
    Bpu10I
    Bpu10I 1 000 units
    https://www.bioz.com/result/bpu10i/product/New England Biolabs
    Average 90 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    bpu10i - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Exogenous Transposable Elements Circumvent Identity-Based Silencing, Permitting the Dissection of Expression-Dependent Silencing [OPEN]
    Article Snippet: To generate the Tto LTR+term construct, the 35S terminator from pB2GW7 was amplified using Phusion polymerase and cloned into the Pst I site of the solo Tto LTR construct using In-Fusion cloning (Clontech). .. To generate the full Tto construct, iTto was digested with Bpu10I (NEB) and the resulting portion was gel extracted and purified.

    Article Title: CDC25AQ110del: A Novel Cell Division Cycle 25A Isoform Aberrantly Expressed in Non-Small Cell Lung Cancer
    Article Snippet: The cDNA clones used for the functional assays were amplified from NSCLC cell lines ( ). .. For enzymatic digestion analysis, a 292 bp fragment of CDC25A cDNA was amplified using primers: forward 5′-CACTGGAGGTGAAGAACAACAG-3′ and reverse 5′-CAGCCACGAGATACAGGTCTTA-3′ , digested with the restriction endonuclease Bpu10I (New England Biolabs, Ipswich, MA) then separated on agarose gel.

    Article Title: An Evolutionarily Conserved Arginine Is Essential for Tre1 G Protein-Coupled Receptor Function During Germ Cell Migration in Drosophila melanogaster
    Article Snippet: A 1700 base pair fragment containing the target sequence for nucleotide replacement was excised by digesting with SphI and StuI restriction endonucleases (NEB) and cloned into a modified pSP72 vector containing an inserted StuI restriction site and lacking a PstI site. .. The resulting pSP72 vector containing the 1700bp tre1 insert was subsequently digested using PstI and Bpu10I (NEB) to excise a 160 base pair fragment of tre1 genomic DNA that housed the target sequence.

    Amplification:

    Article Title: Exogenous Transposable Elements Circumvent Identity-Based Silencing, Permitting the Dissection of Expression-Dependent Silencing [OPEN]
    Article Snippet: To generate the Tto LTR+term construct, the 35S terminator from pB2GW7 was amplified using Phusion polymerase and cloned into the Pst I site of the solo Tto LTR construct using In-Fusion cloning (Clontech). .. To generate the full Tto construct, iTto was digested with Bpu10I (NEB) and the resulting portion was gel extracted and purified.

    Article Title: CDC25AQ110del: A Novel Cell Division Cycle 25A Isoform Aberrantly Expressed in Non-Small Cell Lung Cancer
    Article Snippet: .. For enzymatic digestion analysis, a 292 bp fragment of CDC25A cDNA was amplified using primers: forward 5′-CACTGGAGGTGAAGAACAACAG-3′ and reverse 5′-CAGCCACGAGATACAGGTCTTA-3′ , digested with the restriction endonuclease Bpu10I (New England Biolabs, Ipswich, MA) then separated on agarose gel. .. UV irradiation For UV treatment of cultured cells, the media was removed, cells were washed twice with phosphate-buffered saline and then irradiated in uncovered tissue culture dishes with 254 nm UV light (UVC) in Stratalinker UV Crosslinker (Stratagene, La Jolla, CA).

    Article Title: Post-Transcriptional Regulation of Toll-Interacting Protein in the Intestinal Epithelium
    Article Snippet: The amplified product was inserted into the pGL3-Control Vector (Promega, Madison, WI) between BamHI and blunted XbaI (Takara Bio, Shiga, Japan) sites downstream of the luciferase gene and verified for the sequence. .. Luc-mTollip_3´-UTR Δ550–1876 was constructed by self-ligation of the blunt-ended product treated with Bpu10I (New England Biolabs, Ipswich, MA).

    Article Title: A Mutation in the Mouse Ttc26 Gene Leads to Impaired Hedgehog Signaling
    Article Snippet: .. In brief, a 618-bp long genomic segment containing the hop mutation site was PCR amplified using the PCR primers 5′-dTACTGCTTTTGAGGAGACTAGGG-3′ and 5′-dGGATGATGGAACTAGTCACGGG-3′ , the reactions were digested with Bpu10I (New England BioLabs), and the digestion products were resolved on 1% agarose gels ( ). .. Kidneys and eyes from ∼1 year old mice were fixed, paraffin-embedded, sectioned, and stained with hematoxylin and eosin.

    Article Title: Association of the programmed cell death 1 (PDCD1) gene polymorphism with ankylosing spondylitis in the Korean population
    Article Snippet: The samples were subjected to 35 amplification cycles in an icycler™ Thermal Cycler (Bio-Rad, Hercules, CA, USA). .. The subsequent restriction-fragment-length polymorphism (RFLP) analysis was performed to determine the PD-1.5 C/T (dbSNP rs#cluster id. rs2227981) and PD-1.9 C/T (dbSNP rs#cluster id. rs2227982) SNPs using Alu I (New England Biolabs Inc., Beverly, MA, USA) and Bpu 10I (New England Biolabs Inc), respectively (Table ) [ ].

    Synthesized:

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: The de novo synthesized genes encoding for the active processed form of each CXC chemokine were subsequently inserted into a previously modified yeast-display pCT vector containing a DNA sequence encoding for a secretory leader sequence, a three amino-acid flexible spacer (N GGGC ), a sequence encoding for c-myc epitope tag (c-myc; N EQKLISEEDLQC ) followed by a sequence encoding for the Aga2p protein to obtain N CXCL-(G3 )-c-myc-Aga2pC fusion proteins. .. Genes encoding N CXCL-(G3 )-c-myc-Aga2pC fusion proteins were further sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes except for mCXCL2 for which Pst I-HF and Xho I (New England BioLabs) restriction enzymes were used.

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: The de novo synthesized genes encoding for the active processed form of each CXC chemokine were subsequently inserted into a previously modified yeast-display pCT vector containing a DNA sequence encoding for a secretory leader sequence, a three amino-acid flexible spacer (N GGGC ), a sequence encoding for c-myc epitope tag (c-myc; N EQKLISEEDLQC ) followed by a sequence encoding for the Aga2p protein to obtain N CXCL-(G3 )-c-myc-Aga2pC fusion proteins. .. Genes encoding N CXCL-(G3 )-c-myc-Aga2pC fusion proteins were further sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes except for mCXCL2 for which Pst I-HF and Xho I (New England BioLabs) restriction enzymes were used.

    Cytometry:

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: Gene encoding N hCXCL1WT -(G3 )-c-myc-Aga2pC fusion protein was sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes. .. Binding of hCXCL1WT and single alanine mutants (hCXCL1ALAn ) displayed on the surface of yeast toward soluble SA129, SA138, and SA157* SA–antibody fusions was assessed by using flow cytometry.

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: Gene encoding N hCXCL1WT -(G3 )-c-myc-Aga2pC fusion protein was sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes. .. Binding of hCXCL1WT and single alanine mutants (hCXCL1ALAn ) displayed on the surface of yeast toward soluble SA129, SA138, and SA157* SA–antibody fusions was assessed by using flow cytometry.

    Construct:

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: Constructs for surface display of N CXCL-Aga2C fusion proteins were generated using DNA assembly methods and enzymes described above. .. Genes encoding N CXCL-(G3 )-c-myc-Aga2pC fusion proteins were further sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes except for mCXCL2 for which Pst I-HF and Xho I (New England BioLabs) restriction enzymes were used.

    Article Title: Exogenous Transposable Elements Circumvent Identity-Based Silencing, Permitting the Dissection of Expression-Dependent Silencing [OPEN]
    Article Snippet: .. To generate the full Tto construct, iTto was digested with Bpu10I (NEB) and the resulting portion was gel extracted and purified. .. The solo Tto LTR construct was linearized with Bpu10I and treated with Shrimp Alkaline Phosphatase (NEB).

    Article Title: Exogenous Transposable Elements Circumvent Identity-Based Silencing, Permitting the Dissection of Expression-Dependent Silencing [OPEN]
    Article Snippet: .. The solo Tto LTR construct was linearized with Bpu10I and treated with Shrimp Alkaline Phosphatase (NEB). .. These two products were then ligated together using T4 DNA ligase, and colonies were screened for the appropriate direction of ligation.

    Article Title: Post-Transcriptional Regulation of Toll-Interacting Protein in the Intestinal Epithelium
    Article Snippet: .. Luc-mTollip_3´-UTR Δ550–1876 was constructed by self-ligation of the blunt-ended product treated with Bpu10I (New England Biolabs, Ipswich, MA). .. For the construction of Luc-mTollip_3´-UTR Δ1–2572 and Δ1–2646, each deletion fragment of the 3´-UTR of the mouse Tollip gene was obtained by PCR and inserted into the BamHI and XbaI sites.

    Article Title: An Evolutionarily Conserved Arginine Is Essential for Tre1 G Protein-Coupled Receptor Function During Germ Cell Migration in Drosophila melanogaster
    Article Snippet: Engineering of the amino acid substitution cassettes The T+ G+ vector containing a 10 kb genomic fragment coding for both tre1 and Gr5a was used in the generation of the amino acid-substituted constructs . .. The resulting pSP72 vector containing the 1700bp tre1 insert was subsequently digested using PstI and Bpu10I (NEB) to excise a 160 base pair fragment of tre1 genomic DNA that housed the target sequence.

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: Constructs for surface display of N CXCL-Aga2C fusion proteins were generated using DNA assembly methods and enzymes described above. .. Genes encoding N CXCL-(G3 )-c-myc-Aga2pC fusion proteins were further sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes except for mCXCL2 for which Pst I-HF and Xho I (New England BioLabs) restriction enzymes were used.

    Knock-In:

    Article Title: Retinal pathology and skin barrier defect in mice carrying a Stargardt disease-3 mutation in elongase of very long chain fatty acids-4
    Article Snippet: .. Southern blot analysis of knockin mice Tail DNA samples were digested with Nsi I or Bpu 10I (New England Biolabs, Beverly, MA), separated on an agarose gel, transferred to Hybond N+ membrane (GE Healthcare, Piscataway, NJ), and subjected to Southern blot analysis using P32-labeled DNA probes: a 453-bp 5'-external probe, a 284-bp Neo probe, or a 1.2-kb 3'-internal probe ( ). .. Polymerase chain reaction genotyping of mice After founder mice were characterized by Southern blot analysis, further genotyping of their progenies was performed by PCR using tail DNA.

    Luciferase:

    Article Title: Post-Transcriptional Regulation of Toll-Interacting Protein in the Intestinal Epithelium
    Article Snippet: The amplified product was inserted into the pGL3-Control Vector (Promega, Madison, WI) between BamHI and blunted XbaI (Takara Bio, Shiga, Japan) sites downstream of the luciferase gene and verified for the sequence. .. Luc-mTollip_3´-UTR Δ550–1876 was constructed by self-ligation of the blunt-ended product treated with Bpu10I (New England Biolabs, Ipswich, MA).

    Activity Assay:

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: The process of the leader sequence during the secretory pathway allows for a precisely cleaved N-terminus that is crucial for the activity of the mature chemokines. .. Genes encoding N CXCL-(G3 )-c-myc-Aga2pC fusion proteins were further sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes except for mCXCL2 for which Pst I-HF and Xho I (New England BioLabs) restriction enzymes were used.

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: The process of the leader sequence during the secretory pathway allows for a precisely cleaved N-terminus that is crucial for the activity of the mature chemokines. .. Genes encoding N CXCL-(G3 )-c-myc-Aga2pC fusion proteins were further sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes except for mCXCL2 for which Pst I-HF and Xho I (New England BioLabs) restriction enzymes were used.

    Expressing:

    Article Title: Exogenous Transposable Elements Circumvent Identity-Based Silencing, Permitting the Dissection of Expression-Dependent Silencing [OPEN]
    Article Snippet: Paragraph title: Transgene Generation and Expression ... To generate the full Tto construct, iTto was digested with Bpu10I (NEB) and the resulting portion was gel extracted and purified.

    Modification:

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: The de novo synthesized genes encoding for the active processed form of each CXC chemokine were subsequently inserted into a previously modified yeast-display pCT vector containing a DNA sequence encoding for a secretory leader sequence, a three amino-acid flexible spacer (N GGGC ), a sequence encoding for c-myc epitope tag (c-myc; N EQKLISEEDLQC ) followed by a sequence encoding for the Aga2p protein to obtain N CXCL-(G3 )-c-myc-Aga2pC fusion proteins. .. Genes encoding N CXCL-(G3 )-c-myc-Aga2pC fusion proteins were further sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes except for mCXCL2 for which Pst I-HF and Xho I (New England BioLabs) restriction enzymes were used.

    Article Title: An Evolutionarily Conserved Arginine Is Essential for Tre1 G Protein-Coupled Receptor Function During Germ Cell Migration in Drosophila melanogaster
    Article Snippet: A 1700 base pair fragment containing the target sequence for nucleotide replacement was excised by digesting with SphI and StuI restriction endonucleases (NEB) and cloned into a modified pSP72 vector containing an inserted StuI restriction site and lacking a PstI site. .. The resulting pSP72 vector containing the 1700bp tre1 insert was subsequently digested using PstI and Bpu10I (NEB) to excise a 160 base pair fragment of tre1 genomic DNA that housed the target sequence.

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: The de novo synthesized genes encoding for the active processed form of each CXC chemokine were subsequently inserted into a previously modified yeast-display pCT vector containing a DNA sequence encoding for a secretory leader sequence, a three amino-acid flexible spacer (N GGGC ), a sequence encoding for c-myc epitope tag (c-myc; N EQKLISEEDLQC ) followed by a sequence encoding for the Aga2p protein to obtain N CXCL-(G3 )-c-myc-Aga2pC fusion proteins. .. Genes encoding N CXCL-(G3 )-c-myc-Aga2pC fusion proteins were further sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes except for mCXCL2 for which Pst I-HF and Xho I (New England BioLabs) restriction enzymes were used.

    Transformation Assay:

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: Genes encoding N CXCL-(G3 )-c-myc-Aga2pC fusion proteins were further sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes except for mCXCL2 for which Pst I-HF and Xho I (New England BioLabs) restriction enzymes were used. .. EBY100 cells were transformed with pCT vectors encoding N CXCL-Aga2pC fusion proteins using Frozen-EZ Yeast Transformation II Kit.

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: Genes encoding N CXCL-(G3 )-c-myc-Aga2pC fusion proteins were further sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes except for mCXCL2 for which Pst I-HF and Xho I (New England BioLabs) restriction enzymes were used. .. EBY100 cells were transformed with pCT vectors encoding N CXCL-Aga2pC fusion proteins using Frozen-EZ Yeast Transformation II Kit.

    Derivative Assay:

    Article Title: Exogenous Transposable Elements Circumvent Identity-Based Silencing, Permitting the Dissection of Expression-Dependent Silencing [OPEN]
    Article Snippet: This method was also used to delete the neomycin resistance from the Tf1 sequence derived from pHL414 before cloning the iTf1 construct. .. To generate the full Tto construct, iTto was digested with Bpu10I (NEB) and the resulting portion was gel extracted and purified.

    Flow Cytometry:

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: Gene encoding N hCXCL1WT -(G3 )-c-myc-Aga2pC fusion protein was sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes. .. Binding of hCXCL1WT and single alanine mutants (hCXCL1ALAn ) displayed on the surface of yeast toward soluble SA129, SA138, and SA157* SA–antibody fusions was assessed by using flow cytometry.

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: Gene encoding N hCXCL1WT -(G3 )-c-myc-Aga2pC fusion protein was sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes. .. Binding of hCXCL1WT and single alanine mutants (hCXCL1ALAn ) displayed on the surface of yeast toward soluble SA129, SA138, and SA157* SA–antibody fusions was assessed by using flow cytometry.

    Inverse PCR:

    Article Title: Exogenous Transposable Elements Circumvent Identity-Based Silencing, Permitting the Dissection of Expression-Dependent Silencing [OPEN]
    Article Snippet: The promoter deletion constructs ( Athila LTR Δpro and Tto LTR Δpro) were generated by performing inverse PCR on their respective parent constructs with primers upstream of the TATA box and downstream of the (primers in ). .. To generate the full Tto construct, iTto was digested with Bpu10I (NEB) and the resulting portion was gel extracted and purified.

    Southern Blot:

    Article Title: Retinal pathology and skin barrier defect in mice carrying a Stargardt disease-3 mutation in elongase of very long chain fatty acids-4
    Article Snippet: .. Southern blot analysis of knockin mice Tail DNA samples were digested with Nsi I or Bpu 10I (New England Biolabs, Beverly, MA), separated on an agarose gel, transferred to Hybond N+ membrane (GE Healthcare, Piscataway, NJ), and subjected to Southern blot analysis using P32-labeled DNA probes: a 453-bp 5'-external probe, a 284-bp Neo probe, or a 1.2-kb 3'-internal probe ( ). .. Polymerase chain reaction genotyping of mice After founder mice were characterized by Southern blot analysis, further genotyping of their progenies was performed by PCR using tail DNA.

    Ligation:

    Article Title: Exogenous Transposable Elements Circumvent Identity-Based Silencing, Permitting the Dissection of Expression-Dependent Silencing [OPEN]
    Article Snippet: To generate the full Tto construct, iTto was digested with Bpu10I (NEB) and the resulting portion was gel extracted and purified. .. These two products were then ligated together using T4 DNA ligase, and colonies were screened for the appropriate direction of ligation.

    Introduce:

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: Gene encoding N hCXCL1WT -(G3 )-c-myc-Aga2pC fusion protein was sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes. .. Mutagenic oligonucleotides were designed to introduce single point mutations at the desired sites and generate 54 hCXCL1 variants (pCT-hCXCL1ALAn -Aga2, N hCXCL1ALAn -Aga2pC ; see Supplementary Data for information about hCXCL1 mutants, oligonucleotide primers, DNA, and amino-acid sequences).

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: Gene encoding N hCXCL1WT -(G3 )-c-myc-Aga2pC fusion protein was sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes. .. Mutagenic oligonucleotides were designed to introduce single point mutations at the desired sites and generate 54 hCXCL1 variants (pCT-hCXCL1ALAn -Aga2, N hCXCL1ALAn -Aga2pC ; see Supplementary Data for information about hCXCL1 mutants, oligonucleotide primers, DNA, and amino-acid sequences).

    Generated:

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: Constructs for surface display of N CXCL-Aga2C fusion proteins were generated using DNA assembly methods and enzymes described above. .. Genes encoding N CXCL-(G3 )-c-myc-Aga2pC fusion proteins were further sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes except for mCXCL2 for which Pst I-HF and Xho I (New England BioLabs) restriction enzymes were used.

    Article Title: Exogenous Transposable Elements Circumvent Identity-Based Silencing, Permitting the Dissection of Expression-Dependent Silencing [OPEN]
    Article Snippet: The promoter deletion constructs ( Athila LTR Δpro and Tto LTR Δpro) were generated by performing inverse PCR on their respective parent constructs with primers upstream of the TATA box and downstream of the (primers in ). .. To generate the full Tto construct, iTto was digested with Bpu10I (NEB) and the resulting portion was gel extracted and purified.

    Article Title: Multiple Interactions between Cytoplasmic Domains Regulate Slow Deactivation of Kv11.1 Channels *
    Article Snippet: To generate chimeric Kv11.1 channels with the N-Cap/PAS domains replaced with those of Kv10.1 channels (residues 1–135 of Kv10.1 + residues 136–1159 of Kv11.1), a mega-primer was generated using Kv10.1 cDNA as a template, with a forward primer containing a Bpu10I restriction site followed by residues 1–9 of Kv10.1 (5′-CCGCTCAGGATGACCATGGCTGGGGGCAGGAGGGGA-3′) and a reverse primer containing the overlap region at the end of the PAS domain (SDITAFK (Kv10.1)-DMVGSPA (Kv11.1)) (5′-AGCCGGGGACCCCACCATGTCTTTGAAAGCTGTTATGTCACT-3′). .. This fragment was then inserted into the Kv11.1 backbone using Bpu10I and BstEII restriction enzymes (New England Biolabs).

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: Constructs for surface display of N CXCL-Aga2C fusion proteins were generated using DNA assembly methods and enzymes described above. .. Genes encoding N CXCL-(G3 )-c-myc-Aga2pC fusion proteins were further sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes except for mCXCL2 for which Pst I-HF and Xho I (New England BioLabs) restriction enzymes were used.

    Polymerase Chain Reaction:

    Article Title: A plasmid-based lacZα gene assay for DNA polymerase fidelity measurement
    Article Snippet: Taq-Pol, for use in routine PCR applications, was also purchased from Fermentas. .. The nicking enzymes Nt.Bpu10I and Nt.BbvCI and the restriction enzyme BbvCI were purchased from New England Biolabs (Ipswich, MA, USA).

    Article Title: Post-Transcriptional Regulation of Toll-Interacting Protein in the Intestinal Epithelium
    Article Snippet: Plasmid construction The full length 3´ UTR of mouse Tollip mRNA (RefSeq ID: NM_023764.3) was obtained by PCR using reverse transcripts of large IECs as a template. .. Luc-mTollip_3´-UTR Δ550–1876 was constructed by self-ligation of the blunt-ended product treated with Bpu10I (New England Biolabs, Ipswich, MA).

    Article Title: A Mutation in the Mouse Ttc26 Gene Leads to Impaired Hedgehog Signaling
    Article Snippet: .. In brief, a 618-bp long genomic segment containing the hop mutation site was PCR amplified using the PCR primers 5′-dTACTGCTTTTGAGGAGACTAGGG-3′ and 5′-dGGATGATGGAACTAGTCACGGG-3′ , the reactions were digested with Bpu10I (New England BioLabs), and the digestion products were resolved on 1% agarose gels ( ). .. Kidneys and eyes from ∼1 year old mice were fixed, paraffin-embedded, sectioned, and stained with hematoxylin and eosin.

    Article Title: Association of the programmed cell death 1 (PDCD1) gene polymorphism with ankylosing spondylitis in the Korean population
    Article Snippet: PCR amplification was performed with 50 ng of the genomic DNA in a 25 μl reaction volume containing 10 pmol of sense primer in 0.5 μl, 10 pmol of antisense primer in 0.5 μl, 0.5 μl of 2.5 mmol/l dNTP (Takara, Shiga, Japan), 1 U of tag DNA polymerase (Takara), and a buffer provided by the manufacturer. .. The subsequent restriction-fragment-length polymorphism (RFLP) analysis was performed to determine the PD-1.5 C/T (dbSNP rs#cluster id. rs2227981) and PD-1.9 C/T (dbSNP rs#cluster id. rs2227982) SNPs using Alu I (New England Biolabs Inc., Beverly, MA, USA) and Bpu 10I (New England Biolabs Inc), respectively (Table ) [ ].

    DNA Sequencing:

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: Genes encoding N CXCL-(G3 )-c-myc-Aga2pC fusion proteins were further sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes except for mCXCL2 for which Pst I-HF and Xho I (New England BioLabs) restriction enzymes were used. .. All constructs were verified by DNA sequencing and termed N CXCL-Aga2pC fusion proteins (see Supplementary Data for information about protein accession numbers, oligonucleotide primers, DNA, and amino-acid sequences).

    Article Title: Multiple Interactions between Cytoplasmic Domains Regulate Slow Deactivation of Kv11.1 Channels *
    Article Snippet: Mutagenesis of Kv11.1 cDNA was performed using the QuikChange method (Agilent Technologies, Santa Clara, CA) and confirmed by DNA sequencing. .. This fragment was then inserted into the Kv11.1 backbone using Bpu10I and BstEII restriction enzymes (New England Biolabs).

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: Genes encoding N CXCL-(G3 )-c-myc-Aga2pC fusion proteins were further sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes except for mCXCL2 for which Pst I-HF and Xho I (New England BioLabs) restriction enzymes were used. .. All constructs were verified by DNA sequencing and termed N CXCL-Aga2pC fusion proteins (see Supplementary Data for information about protein accession numbers, oligonucleotide primers, DNA, and amino-acid sequences).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: A Mutation in the Mouse Ttc26 Gene Leads to Impaired Hedgehog Signaling
    Article Snippet: The transcripts of candidate genes were RT-PCR amplified from testis RNA, using the PCR primers listed in , and sequenced without subcloning. .. In brief, a 618-bp long genomic segment containing the hop mutation site was PCR amplified using the PCR primers 5′-dTACTGCTTTTGAGGAGACTAGGG-3′ and 5′-dGGATGATGGAACTAGTCACGGG-3′ , the reactions were digested with Bpu10I (New England BioLabs), and the digestion products were resolved on 1% agarose gels ( ).

    Binding Assay:

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: Gene encoding N hCXCL1WT -(G3 )-c-myc-Aga2pC fusion protein was sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes. .. Binding of hCXCL1WT and single alanine mutants (hCXCL1ALAn ) displayed on the surface of yeast toward soluble SA129, SA138, and SA157* SA–antibody fusions was assessed by using flow cytometry.

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: Gene encoding N hCXCL1WT -(G3 )-c-myc-Aga2pC fusion protein was sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes. .. Binding of hCXCL1WT and single alanine mutants (hCXCL1ALAn ) displayed on the surface of yeast toward soluble SA129, SA138, and SA157* SA–antibody fusions was assessed by using flow cytometry.

    Mutagenesis:

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: Gene encoding N hCXCL1WT -(G3 )-c-myc-Aga2pC fusion protein was sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes. .. The obtained pCT-hCXCL1WT -Aga2 vector was used as the template for the site-directed mutagenesis.

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: Gene encoding N hCXCL1WT -(G3 )-c-myc-Aga2pC fusion protein was sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes. .. The obtained pCT-hCXCL1WT -Aga2 vector was used as the template for the site-directed mutagenesis.

    Article Title: Multiple Interactions between Cytoplasmic Domains Regulate Slow Deactivation of Kv11.1 Channels *
    Article Snippet: Mutagenesis of Kv11.1 cDNA was performed using the QuikChange method (Agilent Technologies, Santa Clara, CA) and confirmed by DNA sequencing. .. This fragment was then inserted into the Kv11.1 backbone using Bpu10I and BstEII restriction enzymes (New England Biolabs).

    Article Title: A Mutation in the Mouse Ttc26 Gene Leads to Impaired Hedgehog Signaling
    Article Snippet: .. In brief, a 618-bp long genomic segment containing the hop mutation site was PCR amplified using the PCR primers 5′-dTACTGCTTTTGAGGAGACTAGGG-3′ and 5′-dGGATGATGGAACTAGTCACGGG-3′ , the reactions were digested with Bpu10I (New England BioLabs), and the digestion products were resolved on 1% agarose gels ( ). .. Kidneys and eyes from ∼1 year old mice were fixed, paraffin-embedded, sectioned, and stained with hematoxylin and eosin.

    Subcloning:

    Article Title: A Mutation in the Mouse Ttc26 Gene Leads to Impaired Hedgehog Signaling
    Article Snippet: The transcripts of candidate genes were RT-PCR amplified from testis RNA, using the PCR primers listed in , and sequenced without subcloning. .. In brief, a 618-bp long genomic segment containing the hop mutation site was PCR amplified using the PCR primers 5′-dTACTGCTTTTGAGGAGACTAGGG-3′ and 5′-dGGATGATGGAACTAGTCACGGG-3′ , the reactions were digested with Bpu10I (New England BioLabs), and the digestion products were resolved on 1% agarose gels ( ).

    Purification:

    Article Title: Exogenous Transposable Elements Circumvent Identity-Based Silencing, Permitting the Dissection of Expression-Dependent Silencing [OPEN]
    Article Snippet: .. To generate the full Tto construct, iTto was digested with Bpu10I (NEB) and the resulting portion was gel extracted and purified. .. The solo Tto LTR construct was linearized with Bpu10I and treated with Shrimp Alkaline Phosphatase (NEB).

    Article Title: Exogenous Transposable Elements Circumvent Identity-Based Silencing, Permitting the Dissection of Expression-Dependent Silencing [OPEN]
    Article Snippet: To generate the full Tto construct, iTto was digested with Bpu10I (NEB) and the resulting portion was gel extracted and purified. .. The solo Tto LTR construct was linearized with Bpu10I and treated with Shrimp Alkaline Phosphatase (NEB).

    Sequencing:

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: The process of the leader sequence during the secretory pathway allows for a precisely cleaved N-terminus that is crucial for the activity of the mature chemokines. .. Genes encoding N CXCL-(G3 )-c-myc-Aga2pC fusion proteins were further sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes except for mCXCL2 for which Pst I-HF and Xho I (New England BioLabs) restriction enzymes were used.

    Article Title: Exogenous Transposable Elements Circumvent Identity-Based Silencing, Permitting the Dissection of Expression-Dependent Silencing [OPEN]
    Article Snippet: This method was also used to delete the neomycin resistance from the Tf1 sequence derived from pHL414 before cloning the iTf1 construct. .. To generate the full Tto construct, iTto was digested with Bpu10I (NEB) and the resulting portion was gel extracted and purified.

    Article Title: CDC25AQ110del: A Novel Cell Division Cycle 25A Isoform Aberrantly Expressed in Non-Small Cell Lung Cancer
    Article Snippet: Paragraph title: Sequence analysis and restriction enzyme digestion ... For enzymatic digestion analysis, a 292 bp fragment of CDC25A cDNA was amplified using primers: forward 5′-CACTGGAGGTGAAGAACAACAG-3′ and reverse 5′-CAGCCACGAGATACAGGTCTTA-3′ , digested with the restriction endonuclease Bpu10I (New England Biolabs, Ipswich, MA) then separated on agarose gel.

    Article Title: Post-Transcriptional Regulation of Toll-Interacting Protein in the Intestinal Epithelium
    Article Snippet: The amplified product was inserted into the pGL3-Control Vector (Promega, Madison, WI) between BamHI and blunted XbaI (Takara Bio, Shiga, Japan) sites downstream of the luciferase gene and verified for the sequence. .. Luc-mTollip_3´-UTR Δ550–1876 was constructed by self-ligation of the blunt-ended product treated with Bpu10I (New England Biolabs, Ipswich, MA).

    Article Title: Multiple Interactions between Cytoplasmic Domains Regulate Slow Deactivation of Kv11.1 Channels *
    Article Snippet: Similarly, to generate the Kv11.1 channel chimera with only the PAS domain of Kv10.1 (residues 1–25 of Kv11.1 + 26–135 of Kv101.1 + 136–1159 of Kv11.1), the above N-Cap/PAS Kv10.1/Kv11.1 chimera cDNA was used as the template, with a forward primer containing a Bpu10I restriction site followed by Kv11.1 sequence to the overlap region at the end of the N-Cap domain (MPV…EGQ(Kv11.1)-DTNFVL(Kv10.1)) (5′-CCGCTCAGGATGCCGGTGCGGAGGGGCCACGTCGCGCCGCAGAACACCTTCCTGGACACCATCATCCGCAAGTTTGAGGGCCAGGATACTAATTTTGTGTTG-3′) and a reverse primer that started from the BstEII restriction site of Kv11.1, to generate a fragment containing a Bpu10I restriction site followed by Kv11.1 (1–25) + Kv10.1 (26–135) + Kv11.1 up to the BstEII restriction site. .. This fragment was then inserted into the Kv11.1 backbone using Bpu10I and BstEII restriction enzymes (New England Biolabs).

    Article Title: A Mutation in the Mouse Ttc26 Gene Leads to Impaired Hedgehog Signaling
    Article Snippet: The hop allele was mapped by sequencing 15 PCR-amplified genomic regions that contain BALB/c specific SNPs (SNP accession numbers and PCR primers are listed in ). .. In brief, a 618-bp long genomic segment containing the hop mutation site was PCR amplified using the PCR primers 5′-dTACTGCTTTTGAGGAGACTAGGG-3′ and 5′-dGGATGATGGAACTAGTCACGGG-3′ , the reactions were digested with Bpu10I (New England BioLabs), and the digestion products were resolved on 1% agarose gels ( ).

    Article Title: An Evolutionarily Conserved Arginine Is Essential for Tre1 G Protein-Coupled Receptor Function During Germ Cell Migration in Drosophila melanogaster
    Article Snippet: .. The resulting pSP72 vector containing the 1700bp tre1 insert was subsequently digested using PstI and Bpu10I (NEB) to excise a 160 base pair fragment of tre1 genomic DNA that housed the target sequence. .. Phosphorylated oligonucleotides were designed to reconstitute the 160 base pair fragment and insert an AloI restriction site directly into the target sequence region.

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: The process of the leader sequence during the secretory pathway allows for a precisely cleaved N-terminus that is crucial for the activity of the mature chemokines. .. Genes encoding N CXCL-(G3 )-c-myc-Aga2pC fusion proteins were further sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes except for mCXCL2 for which Pst I-HF and Xho I (New England BioLabs) restriction enzymes were used.

    Mouse Assay:

    Article Title: A Mutation in the Mouse Ttc26 Gene Leads to Impaired Hedgehog Signaling
    Article Snippet: Paragraph title: Genetic, histological, and ABR analysis of hop mice ... In brief, a 618-bp long genomic segment containing the hop mutation site was PCR amplified using the PCR primers 5′-dTACTGCTTTTGAGGAGACTAGGG-3′ and 5′-dGGATGATGGAACTAGTCACGGG-3′ , the reactions were digested with Bpu10I (New England BioLabs), and the digestion products were resolved on 1% agarose gels ( ).

    Article Title: Retinal pathology and skin barrier defect in mice carrying a Stargardt disease-3 mutation in elongase of very long chain fatty acids-4
    Article Snippet: .. Southern blot analysis of knockin mice Tail DNA samples were digested with Nsi I or Bpu 10I (New England Biolabs, Beverly, MA), separated on an agarose gel, transferred to Hybond N+ membrane (GE Healthcare, Piscataway, NJ), and subjected to Southern blot analysis using P32-labeled DNA probes: a 453-bp 5'-external probe, a 284-bp Neo probe, or a 1.2-kb 3'-internal probe ( ). .. Polymerase chain reaction genotyping of mice After founder mice were characterized by Southern blot analysis, further genotyping of their progenies was performed by PCR using tail DNA.

    Plasmid Preparation:

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: .. Genes encoding N CXCL-(G3 )-c-myc-Aga2pC fusion proteins were further sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes except for mCXCL2 for which Pst I-HF and Xho I (New England BioLabs) restriction enzymes were used. .. All constructs were verified by DNA sequencing and termed N CXCL-Aga2pC fusion proteins (see Supplementary Data for information about protein accession numbers, oligonucleotide primers, DNA, and amino-acid sequences).

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: .. Gene encoding N hCXCL1WT -(G3 )-c-myc-Aga2pC fusion protein was sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes. .. The obtained pCT-hCXCL1WT -Aga2 vector was used as the template for the site-directed mutagenesis.

    Article Title: A plasmid-based lacZα gene assay for DNA polymerase fidelity measurement
    Article Snippet: The nicking enzymes Nt.Bpu10I and Nt.BbvCI and the restriction enzyme BbvCI were purchased from New England Biolabs (Ipswich, MA, USA). .. Plasmid-safe DNase was supplied by Cambio (Cambridge, UK).

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: .. Gene encoding N hCXCL1WT -(G3 )-c-myc-Aga2pC fusion protein was sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes. .. The obtained pCT-hCXCL1WT -Aga2 vector was used as the template for the site-directed mutagenesis.

    Article Title: Post-Transcriptional Regulation of Toll-Interacting Protein in the Intestinal Epithelium
    Article Snippet: Paragraph title: Plasmid construction ... Luc-mTollip_3´-UTR Δ550–1876 was constructed by self-ligation of the blunt-ended product treated with Bpu10I (New England Biolabs, Ipswich, MA).

    Article Title: An Evolutionarily Conserved Arginine Is Essential for Tre1 G Protein-Coupled Receptor Function During Germ Cell Migration in Drosophila melanogaster
    Article Snippet: .. The resulting pSP72 vector containing the 1700bp tre1 insert was subsequently digested using PstI and Bpu10I (NEB) to excise a 160 base pair fragment of tre1 genomic DNA that housed the target sequence. .. Phosphorylated oligonucleotides were designed to reconstitute the 160 base pair fragment and insert an AloI restriction site directly into the target sequence region.

    Article Title: Multiple Interactions between Cytoplasmic Domains Regulate Slow Deactivation of Kv11.1 Channels *
    Article Snippet: The cDNA of Kv11.1 (a gift from G. Robertson, University of Wisconsin, Madison, WI) was subcloned into a pBluescript vector containing the 5′-UTR and 3′-UTR of the Xenopus laevis β-globin gene (a gift from R. Vandenberg, University of Sydney). .. This fragment was then inserted into the Kv11.1 backbone using Bpu10I and BstEII restriction enzymes (New England Biolabs, Ipswich, MA).

    Article Title: Directed evolution of broadly crossreactive chemokine-blocking antibodies efficacious in arthritis
    Article Snippet: .. Genes encoding N CXCL-(G3 )-c-myc-Aga2pC fusion proteins were further sub-cloned into a new pCT vector via Bpu 10I and Xho I (New England BioLabs) restriction enzymes except for mCXCL2 for which Pst I-HF and Xho I (New England BioLabs) restriction enzymes were used. .. All constructs were verified by DNA sequencing and termed N CXCL-Aga2pC fusion proteins (see Supplementary Data for information about protein accession numbers, oligonucleotide primers, DNA, and amino-acid sequences).

    Functional Assay:

    Article Title: CDC25AQ110del: A Novel Cell Division Cycle 25A Isoform Aberrantly Expressed in Non-Small Cell Lung Cancer
    Article Snippet: The cDNA clones used for the functional assays were amplified from NSCLC cell lines ( ). .. For enzymatic digestion analysis, a 292 bp fragment of CDC25A cDNA was amplified using primers: forward 5′-CACTGGAGGTGAAGAACAACAG-3′ and reverse 5′-CAGCCACGAGATACAGGTCTTA-3′ , digested with the restriction endonuclease Bpu10I (New England Biolabs, Ipswich, MA) then separated on agarose gel.

    Agarose Gel Electrophoresis:

    Article Title: CDC25AQ110del: A Novel Cell Division Cycle 25A Isoform Aberrantly Expressed in Non-Small Cell Lung Cancer
    Article Snippet: .. For enzymatic digestion analysis, a 292 bp fragment of CDC25A cDNA was amplified using primers: forward 5′-CACTGGAGGTGAAGAACAACAG-3′ and reverse 5′-CAGCCACGAGATACAGGTCTTA-3′ , digested with the restriction endonuclease Bpu10I (New England Biolabs, Ipswich, MA) then separated on agarose gel. .. UV irradiation For UV treatment of cultured cells, the media was removed, cells were washed twice with phosphate-buffered saline and then irradiated in uncovered tissue culture dishes with 254 nm UV light (UVC) in Stratalinker UV Crosslinker (Stratagene, La Jolla, CA).

    Article Title: Association of the programmed cell death 1 (PDCD1) gene polymorphism with ankylosing spondylitis in the Korean population
    Article Snippet: The subsequent restriction-fragment-length polymorphism (RFLP) analysis was performed to determine the PD-1.5 C/T (dbSNP rs#cluster id. rs2227981) and PD-1.9 C/T (dbSNP rs#cluster id. rs2227982) SNPs using Alu I (New England Biolabs Inc., Beverly, MA, USA) and Bpu 10I (New England Biolabs Inc), respectively (Table ) [ ]. .. Figure shows the agarose gel electrophoresis results after RFLP.

    Article Title: Retinal pathology and skin barrier defect in mice carrying a Stargardt disease-3 mutation in elongase of very long chain fatty acids-4
    Article Snippet: .. Southern blot analysis of knockin mice Tail DNA samples were digested with Nsi I or Bpu 10I (New England Biolabs, Beverly, MA), separated on an agarose gel, transferred to Hybond N+ membrane (GE Healthcare, Piscataway, NJ), and subjected to Southern blot analysis using P32-labeled DNA probes: a 453-bp 5'-external probe, a 284-bp Neo probe, or a 1.2-kb 3'-internal probe ( ). .. Polymerase chain reaction genotyping of mice After founder mice were characterized by Southern blot analysis, further genotyping of their progenies was performed by PCR using tail DNA.

    In Vitro:

    Article Title: Multiple Interactions between Cytoplasmic Domains Regulate Slow Deactivation of Kv11.1 Channels *
    Article Snippet: This fragment was then inserted into the Kv11.1 backbone using Bpu10I and BstEII restriction enzymes (New England Biolabs). .. Linearization of DNA plasmids was performed using BamHI-HF (New England Biolabs), and the cRNA was transcribed in vitro using the mMessage mMachine kit (Ambion, Austin, TX).

    DNA Purification:

    Article Title: Association of the programmed cell death 1 (PDCD1) gene polymorphism with ankylosing spondylitis in the Korean population
    Article Snippet: The genomic DNA was extracted from the EDTA-treated whole blood with the Wizard® Genomic DNA Purification Kit (Promega, San Luis Obispo, CA, USA). .. The subsequent restriction-fragment-length polymorphism (RFLP) analysis was performed to determine the PD-1.5 C/T (dbSNP rs#cluster id. rs2227981) and PD-1.9 C/T (dbSNP rs#cluster id. rs2227982) SNPs using Alu I (New England Biolabs Inc., Beverly, MA, USA) and Bpu 10I (New England Biolabs Inc), respectively (Table ) [ ].

    Staining:

    Article Title: A Mutation in the Mouse Ttc26 Gene Leads to Impaired Hedgehog Signaling
    Article Snippet: In brief, a 618-bp long genomic segment containing the hop mutation site was PCR amplified using the PCR primers 5′-dTACTGCTTTTGAGGAGACTAGGG-3′ and 5′-dGGATGATGGAACTAGTCACGGG-3′ , the reactions were digested with Bpu10I (New England BioLabs), and the digestion products were resolved on 1% agarose gels ( ). .. Kidneys and eyes from ∼1 year old mice were fixed, paraffin-embedded, sectioned, and stained with hematoxylin and eosin.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs bpu10i
    Bpu10i, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bpu10i/product/New England Biolabs
    Average 90 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    bpu10i - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results