sbfi  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    SbfI
    Description:
    SbfI 2 500 units
    Catalog Number:
    r0642l
    Price:
    302
    Size:
    2 500 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs sbfi
    SbfI
    SbfI 2 500 units
    https://www.bioz.com/result/sbfi/product/New England Biolabs
    Average 95 stars, based on 43 article reviews
    Price from $9.99 to $1999.99
    sbfi - by Bioz Stars, 2020-02
    95/100 stars

    Images

    1) Product Images from "Functional metagenomics identifies an exosialidase with an inverting catalytic mechanism that defines a new glycoside hydrolase family (GH156)"

    Article Title: Functional metagenomics identifies an exosialidase with an inverting catalytic mechanism that defines a new glycoside hydrolase family (GH156)

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.RA118.003302

    Screening for sialidase activity from a hot spring metagenomic library. A , restriction fragment analysis of 12 randomly selected clones from the hot spring metagenomic library were isolated and digested with the rare-cutting endonuclease SbfI. Digested fosmids were separated overnight on a 1% agarose gel along with a λHindIII size marker and a linearized pSMART FOS empty vector control ( lane 14 ; contains one SbfI site). Each clone showed a unique banding pattern, with fragments whose combined sizes indicated the presence of an insert of at least 30–40 kb. B , E. coli cells harboring individual fosmid clones were assayed for sialidase activity with X-Neu5Ac incorporated into agar medium. A single positive clone forming a blue colony is denoted with an arrow. C , lysate from microcultures of E. coli cells harboring individual fosmid clones were assayed for sialidase activity with 4MU-α-Neu5Ac. A single positive clone is denoted with an arrow .
    Figure Legend Snippet: Screening for sialidase activity from a hot spring metagenomic library. A , restriction fragment analysis of 12 randomly selected clones from the hot spring metagenomic library were isolated and digested with the rare-cutting endonuclease SbfI. Digested fosmids were separated overnight on a 1% agarose gel along with a λHindIII size marker and a linearized pSMART FOS empty vector control ( lane 14 ; contains one SbfI site). Each clone showed a unique banding pattern, with fragments whose combined sizes indicated the presence of an insert of at least 30–40 kb. B , E. coli cells harboring individual fosmid clones were assayed for sialidase activity with X-Neu5Ac incorporated into agar medium. A single positive clone forming a blue colony is denoted with an arrow. C , lysate from microcultures of E. coli cells harboring individual fosmid clones were assayed for sialidase activity with 4MU-α-Neu5Ac. A single positive clone is denoted with an arrow .

    Techniques Used: Activity Assay, Clone Assay, Isolation, Agarose Gel Electrophoresis, Marker, Plasmid Preparation

    2) Product Images from "Amplification Biases and Consistent Recovery of Loci in a Double-Digest RAD-seq Protocol"

    Article Title: Amplification Biases and Consistent Recovery of Loci in a Double-Digest RAD-seq Protocol

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0106713

    Sequencing depth for single copy ddRAD loci in relation to the corresponding sequence in the zebra finch reference genome. Categories from top to bottom include: loci mapping as expected to predicted SbfI-EcoRI restriction fragments≤328 bp in length; all loci beginning at a genomic location similar but not identical to the canonical SbfI recognition sequence (1–4 mismatches); subset of loci with one mismatch in position 1 or 8 of the SbfI recognition sequence; subset of loci with one mismatch in positions 2 through 7 of the SbfI recognition sequence; loci mapping to a genomic SbfI site without an EcoRI site within 328 bp; and loci mapping to a predicted SbfI-SbfI restriction fragment less than 328 bp in length.
    Figure Legend Snippet: Sequencing depth for single copy ddRAD loci in relation to the corresponding sequence in the zebra finch reference genome. Categories from top to bottom include: loci mapping as expected to predicted SbfI-EcoRI restriction fragments≤328 bp in length; all loci beginning at a genomic location similar but not identical to the canonical SbfI recognition sequence (1–4 mismatches); subset of loci with one mismatch in position 1 or 8 of the SbfI recognition sequence; subset of loci with one mismatch in positions 2 through 7 of the SbfI recognition sequence; loci mapping to a genomic SbfI site without an EcoRI site within 328 bp; and loci mapping to a predicted SbfI-SbfI restriction fragment less than 328 bp in length.

    Techniques Used: Sequencing

    Recovery and sequencing depth for predicted, single-copy ddRAD loci in the empirical zebra finch data. (A) Proportion of predicted loci recovered at three different minimum depth thresholds as a function of predicted fragment length. Each data point represents the proportion of ∼140–220 predicted loci recovered in a given 10 bp size range. Dashed vertical lines represent the upper and lower bounds of the size range isolated from the agarose gel. (B) Sequencing depth for recovered (depth ≥1), single-copy loci in the 32–500 bp size range (includes 5,232 of 5,783 predicted loci in the 38–328 bp size range). (C) The relationship between GC content and sequencing depth for zebra finch ddRAD loci. Data are shown for predicted, single-copy loci recovered at a depth ≥1 in three selected subsets of the overall size range ( n = 502, 466, and 445 loci in the 100–125, 200–225, and 300–325 bp size ranges, respectively). The predicted length and GC content of each locus are based on the full-length fragment in the reference genome, inclusive of the SbfI and EcoRI restriction sites on either end. Note that the y-axis is on a logarithmic scale in (B) and (C).
    Figure Legend Snippet: Recovery and sequencing depth for predicted, single-copy ddRAD loci in the empirical zebra finch data. (A) Proportion of predicted loci recovered at three different minimum depth thresholds as a function of predicted fragment length. Each data point represents the proportion of ∼140–220 predicted loci recovered in a given 10 bp size range. Dashed vertical lines represent the upper and lower bounds of the size range isolated from the agarose gel. (B) Sequencing depth for recovered (depth ≥1), single-copy loci in the 32–500 bp size range (includes 5,232 of 5,783 predicted loci in the 38–328 bp size range). (C) The relationship between GC content and sequencing depth for zebra finch ddRAD loci. Data are shown for predicted, single-copy loci recovered at a depth ≥1 in three selected subsets of the overall size range ( n = 502, 466, and 445 loci in the 100–125, 200–225, and 300–325 bp size ranges, respectively). The predicted length and GC content of each locus are based on the full-length fragment in the reference genome, inclusive of the SbfI and EcoRI restriction sites on either end. Note that the y-axis is on a logarithmic scale in (B) and (C).

    Techniques Used: Sequencing, Isolation, Agarose Gel Electrophoresis

    3) Product Images from "Functional metagenomics identifies an exosialidase with an inverting catalytic mechanism that defines a new glycoside hydrolase family (GH156)"

    Article Title: Functional metagenomics identifies an exosialidase with an inverting catalytic mechanism that defines a new glycoside hydrolase family (GH156)

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.RA118.003302

    Screening for sialidase activity from a hot spring metagenomic library. A , restriction fragment analysis of 12 randomly selected clones from the hot spring metagenomic library were isolated and digested with the rare-cutting endonuclease SbfI. Digested fosmids were separated overnight on a 1% agarose gel along with a λHindIII size marker and a linearized pSMART FOS empty vector control ( lane 14 ; contains one SbfI site). Each clone showed a unique banding pattern, with fragments whose combined sizes indicated the presence of an insert of at least 30–40 kb. B , E. coli cells harboring individual fosmid clones were assayed for sialidase activity with X-Neu5Ac incorporated into agar medium. A single positive clone forming a blue colony is denoted with an arrow. C , lysate from microcultures of E. coli cells harboring individual fosmid clones were assayed for sialidase activity with 4MU-α-Neu5Ac. A single positive clone is denoted with an arrow .
    Figure Legend Snippet: Screening for sialidase activity from a hot spring metagenomic library. A , restriction fragment analysis of 12 randomly selected clones from the hot spring metagenomic library were isolated and digested with the rare-cutting endonuclease SbfI. Digested fosmids were separated overnight on a 1% agarose gel along with a λHindIII size marker and a linearized pSMART FOS empty vector control ( lane 14 ; contains one SbfI site). Each clone showed a unique banding pattern, with fragments whose combined sizes indicated the presence of an insert of at least 30–40 kb. B , E. coli cells harboring individual fosmid clones were assayed for sialidase activity with X-Neu5Ac incorporated into agar medium. A single positive clone forming a blue colony is denoted with an arrow. C , lysate from microcultures of E. coli cells harboring individual fosmid clones were assayed for sialidase activity with 4MU-α-Neu5Ac. A single positive clone is denoted with an arrow .

    Techniques Used: Activity Assay, Clone Assay, Isolation, Agarose Gel Electrophoresis, Marker, Plasmid Preparation

    Related Articles

    Clone Assay:

    Article Title: Characterization of the Rat Oncostatin M Receptor Complex Which Resembles the Human, but Differs from the Murine Cytokine Receptor
    Article Snippet: To generate tetracycline-inducible bidirectional promoter driven expression plasmids encoding the rgp130/rLIFR combination or the rgp130/rOSMR combination, we first cloned the cDNAs for each receptor using total RNA extractions from JTC-27 rat hepatoma cells. .. The rOSMR and rLIFR amplicons were digested with Sbf I and Fse I (New England Biolabs) for 4 hours at 37°C.

    Amplification:

    Article Title: Characterization of the Rat Oncostatin M Receptor Complex Which Resembles the Human, but Differs from the Murine Cytokine Receptor
    Article Snippet: The rgp130 amplicon was digested with Age I and Not I fast digest enzymes (Fermentas) for 30 minutes at 37°C. .. The rOSMR and rLIFR amplicons were digested with Sbf I and Fse I (New England Biolabs) for 4 hours at 37°C.

    Article Title: Mapping and Validation of the Major Sex-Determining Region in Nile Tilapia (Oreochromis niloticus L.) Using RAD Sequencing
    Article Snippet: The RAD specific P1 and P2 paired-end adapters and library amplification PCR primer sequences used in this study are detailed in Baxter et al. . .. Each sample (0.72 µg parental DNA/0.24 µg offspring DNA) was digested at 37°C for 40 minutes with Sbf I (recognising the CCTGCA|GG motif) high fidelity restriction enzyme (New England Biolabs; NEB) using 6 U Sbf I per µg genomic DNA in 1× Reaction Buffer 4 (NEB) at a final concentration of c. 1 µg DNA per 50 µL reaction volume.

    Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
    Article Snippet: The RAD-specific P1 and P2 paired-end adapters and library amplification PCR primer sequences used in this study are detailed in . .. Briefly, each sample (0.72 μg parental DNA/0.24 μg offspring DNA) was digested at 37°C for 60 min with Sbf I (recognizing the CCTGCA| GG motif) high fidelity restriction enzyme (New England Biolabs, NEB).

    Article Title: Mapping the sex determination locus in the Atlantic halibut (Hippoglossus hippoglossus) using RAD sequencing
    Article Snippet: The RAD-specific P1 and P2 paired-end adapters and library amplification PCR primer sequences used in this study are detailed in Baxter et al. [ ]. .. Each sample (1.5 μg parental DNA / 0.5 μg offspring DNA) was digested at 37°C for 30 minutes with Sbf I (recognising the CCTGCA|GG motif) high fidelity restriction enzyme (New England Biolabs; NEB) using 6U Sbf I per μg genomic DNA in 1× Reaction Buffer 4 (NEB) at a final concentration of c. 1 μg DNA per 50 μL reaction volume.

    Article Title: Genome-wide signatures of local adaptation among seven stoneflies species along a nationwide latitudinal gradient in Japan
    Article Snippet: Briefly, 100 ng genomic DNA per sample was digested with restriction endonucleases, Sbf I (NEB) and Hae III (Takara) at 37 °C for 3 h. Restriction fragments of each sample were ligated to a unique 6-mer adaptor. .. Purified DNA samples were PCR amplified using two sequential PCRs.

    Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
    Article Snippet: The RAD-specific P1 and P2 paired-end adapters and library amplification PCR primer sequences used in this study are detailed in . .. Briefly, each sample (0.72 μg parental DNA/0.24 μg offspring DNA) was digested at 37°C for 60 min with Sbf I (recognizing the CCTGCA| GG motif) high fidelity restriction enzyme (New England Biolabs, NEB).

    Stable Transfection:

    Article Title: Characterization of the Rat Oncostatin M Receptor Complex Which Resembles the Human, but Differs from the Murine Cytokine Receptor
    Article Snippet: The rOSMR and rLIFR amplicons were digested with Sbf I and Fse I (New England Biolabs) for 4 hours at 37°C. .. After gel purification the fragments were ligated stepwise into the plasmid pBO (kindly provided by Dr. C. Haan, Luxembourg) which contains a tetracycline responsive bidirectional promoter to allow simultaneous transcription of two receptor cDNAs and a hygromycin B resistance cassette to allow selection of stable cell lines .

    Construct:

    Article Title: Characterization of the Rat Oncostatin M Receptor Complex Which Resembles the Human, but Differs from the Murine Cytokine Receptor
    Article Snippet: The rOSMR and rLIFR amplicons were digested with Sbf I and Fse I (New England Biolabs) for 4 hours at 37°C. .. The integrity of all constructs was verified by DNA sequence analyses (Eurofins MWG).

    Article Title: Long-term live imaging reveals cytosolic immune responses of host hepatocytes against Plasmodium infection and parasite escape mechanisms
    Article Snippet: .. Construct pL1720 was made as follows: first the selectable marker (SM) cassette from pL1661 (containing both 5′hsp70 and 3′hsp70 sequences, tgdhfr/ts SM, and 230p targeting regions) was removed by digesting the plasmid with Sna BI (Roche, 10997480001) and Sbf I (New England Biolabs, R06425) followed by treatment of the DNA fragment with Klenow (Roche, 11008404001) and religation resulting in a plasmid that contains only the 5′hsp70 –3′hsp70 sequences and the 230 p (PBANKA_030600) targeting regions; the mCherry coding sequences (excised from pL0047 which contains the 5′pbeef1 α-mCherry- 3′pbdhfr cassette) was then introduced into this plasmid using sites Bam HI (Roche, 10220612001) and Not I (Roche, 11014706001). .. Next a luciferase expression cassette (5′pbeef1a-LucIAV-3′pbdhfr) excised from pL1098 using Kpn I (Roche 11198939001) and Afl II (Roche, 11198939001) was introduced into this vector using the same restriction sites.

    Article Title: Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1 [W]Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1 [W] [OA]
    Article Snippet: .. Complementation of the ebi-1 mutation was obtained by using the Myc-tagged CaMV 35S:EBI coding sequence in pRT104 plasmid (as described below), the construct was digested with Sbf I (New England Biolabs), and the resulting fragment was ligated into Pst I-digested and dephosphorylated promoterless binary vector pGREEN0229. .. The resulting plasmid was introduced into ebi-1 using Agrobacterium tumefaciens -mediated floral dipping , selected by spraying with 5.75% BASTA (Hoechst Schering AgrEvo) twice, and confirmed by PCR.

    Article Title: Genome-wide signatures of local adaptation among seven stoneflies species along a nationwide latitudinal gradient in Japan
    Article Snippet: This DNA extraction method involved the use of the whole body without any destruction of the specimen, thus reducing the probability of contamination (gut content contamination). ddRAD libraries were constructed as previously described [ ] with slight modifications. .. Briefly, 100 ng genomic DNA per sample was digested with restriction endonucleases, Sbf I (NEB) and Hae III (Takara) at 37 °C for 3 h. Restriction fragments of each sample were ligated to a unique 6-mer adaptor.

    Incubation:

    Article Title: Mapping the sex determination locus in the hāpuku (Polyprion oxygeneios) using ddRAD sequencing
    Article Snippet: ddRAD library preparation and sequencing Following a modified version of the protocol described by Peterson et al. [ ], two ddRAD libraries were prepared using different pairs of high fidelity restriction enzymes (REs) (New England Biolabs, UK; NEB); one using Sbf I (specific for the CCTGCA|GG motif) and Sph I (specific for the GCATG|C motif) and the other using Sbf I and Nco I (specific for the C|CATGG motif). .. Samples were returned to ambient temperature for 5 min, and then incubated for 10 min, at ambient temperature, with 3 μL of unique combinations of RAD-specific P1 (6 nM) and P2 (72 nM) paired-end adapters [ ] that included 5 or 7 bp barcodes (Additional file : Table S1).

    Article Title: Gene-centromere mapping in meiotic gynogenetic European seabass
    Article Snippet: Each sample (40 ng DNA) was digested at 37 °C for 30 min with 0.8 U Sbf I (‘rare’ cutter, CCTGCA|GG motif) and 0.8 U SphI (‘common’ cutter, GCATG|C motif) high fidelity restriction enzymes (New England Biolabs; NEB) in a 6 μL reaction volume that included 1× CutSmart™ buffer (NEB). .. After cooling the reactions to room temperature, 3 μL of a premade barcode-adapter mix was added to the digested DNA, and incubated at room temperature for 10 min.

    Article Title: Genome-wide signatures of local adaptation among seven stoneflies species along a nationwide latitudinal gradient in Japan
    Article Snippet: The whole body of the specimen was fully submerged in lysis buffer (Qiagen GmbH, Hilden, Germany) and incubated at 56 °C overnight. .. Briefly, 100 ng genomic DNA per sample was digested with restriction endonucleases, Sbf I (NEB) and Hae III (Takara) at 37 °C for 3 h. Restriction fragments of each sample were ligated to a unique 6-mer adaptor.

    Article Title: Rapid SNP Discovery and Genetic Mapping Using Sequenced RAD Markers
    Article Snippet: Isolation of RAD markers for Illumina sequencing Genomic DNA (0.1–1 µg; from either individual or pooled samples) was digested for 15 min at 37°C in a 50 µL reaction with 20 units (U) of EcoR I or Sbf I (New England Biolabs [NEB]). .. 2.5 µL of 100 nM P1 Adapter, a modified Solexa© adapter (2006 Illumina, Inc., all rights reserved; for EcoR I digestion, top: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTxxxxx-3′ [x = barcode], bottom: 5′-Phos-AATTxxxxxAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT-3′ , for Sbf I digestion, top: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTxxxxTGCA-3′ , bottom: 5′-Phos-xxxxAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT-3′ ) were added to the sample along with 1 µL of 100 mM rATP (Promega), 1 µL 10× EcoR I buffer, 0.5 µL (1000 U) T4 DNA Ligase (high concentration, NEB), 5 µL H2 O and incubated at room temperature (RT) for 20 min.

    Luciferase:

    Article Title: Long-term live imaging reveals cytosolic immune responses of host hepatocytes against Plasmodium infection and parasite escape mechanisms
    Article Snippet: Generation and analysis of the reporter line PbmCherryhsp70 +Luceef1α Construct pL1720 was made for generation of reporter line mCherryhsp70 +Luceef1 α that expresses mCherry reporter under control of the hsp70 (PBANKA_071190) 5′- and 3′-regulatory sequences and luciferase under the control of the ee1f α (PBANKA_113330) 5′-promoter/regulatory sequences and the pbdhfr/ts (PBANKA_071930) 3′-regulatory sequences. .. Construct pL1720 was made as follows: first the selectable marker (SM) cassette from pL1661 (containing both 5′hsp70 and 3′hsp70 sequences, tgdhfr/ts SM, and 230p targeting regions) was removed by digesting the plasmid with Sna BI (Roche, 10997480001) and Sbf I (New England Biolabs, R06425) followed by treatment of the DNA fragment with Klenow (Roche, 11008404001) and religation resulting in a plasmid that contains only the 5′hsp70 –3′hsp70 sequences and the 230 p (PBANKA_030600) targeting regions; the mCherry coding sequences (excised from pL0047 which contains the 5′pbeef1 α-mCherry- 3′pbdhfr cassette) was then introduced into this plasmid using sites Bam HI (Roche, 10220612001) and Not I (Roche, 11014706001).

    In Silico:

    Article Title: Gene-centromere mapping in meiotic gynogenetic European seabass
    Article Snippet: In silico estimation from the seabass genome predicted 52,230 ddRAD fragments with paired SbfI-SphI restriction site overhangs, while after the size selection applied in the present study (c. 320 bp −590 bp excluding adaptors) only 3603 fragments were predicted to be available. .. Each sample (40 ng DNA) was digested at 37 °C for 30 min with 0.8 U Sbf I (‘rare’ cutter, CCTGCA|GG motif) and 0.8 U SphI (‘common’ cutter, GCATG|C motif) high fidelity restriction enzymes (New England Biolabs; NEB) in a 6 μL reaction volume that included 1× CutSmart™ buffer (NEB).

    Expressing:

    Article Title: Characterization of the Rat Oncostatin M Receptor Complex Which Resembles the Human, but Differs from the Murine Cytokine Receptor
    Article Snippet: Paragraph title: Construction of expression vectors ... The rOSMR and rLIFR amplicons were digested with Sbf I and Fse I (New England Biolabs) for 4 hours at 37°C.

    Article Title: Long-term live imaging reveals cytosolic immune responses of host hepatocytes against Plasmodium infection and parasite escape mechanisms
    Article Snippet: Construct pL1720 was made as follows: first the selectable marker (SM) cassette from pL1661 (containing both 5′hsp70 and 3′hsp70 sequences, tgdhfr/ts SM, and 230p targeting regions) was removed by digesting the plasmid with Sna BI (Roche, 10997480001) and Sbf I (New England Biolabs, R06425) followed by treatment of the DNA fragment with Klenow (Roche, 11008404001) and religation resulting in a plasmid that contains only the 5′hsp70 –3′hsp70 sequences and the 230 p (PBANKA_030600) targeting regions; the mCherry coding sequences (excised from pL0047 which contains the 5′pbeef1 α-mCherry- 3′pbdhfr cassette) was then introduced into this plasmid using sites Bam HI (Roche, 10220612001) and Not I (Roche, 11014706001). .. Next a luciferase expression cassette (5′pbeef1a-LucIAV-3′pbdhfr) excised from pL1098 using Kpn I (Roche 11198939001) and Afl II (Roche, 11198939001) was introduced into this vector using the same restriction sites.

    Article Title: Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1 [W]Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1 [W] [OA]
    Article Snippet: ebi-1 was isolated from a screen of EMS-mutagenized M2 Arabidopsis ( Arabidopsis thaliana ) Ws-2 plants ( ) by its early phase of CAB2 :: LUC+ expression in DD. .. Complementation of the ebi-1 mutation was obtained by using the Myc-tagged CaMV 35S:EBI coding sequence in pRT104 plasmid (as described below), the construct was digested with Sbf I (New England Biolabs), and the resulting fragment was ligated into Pst I-digested and dephosphorylated promoterless binary vector pGREEN0229.

    Modification:

    Article Title: Mapping the sex determination locus in the hāpuku (Polyprion oxygeneios) using ddRAD sequencing
    Article Snippet: .. ddRAD library preparation and sequencing Following a modified version of the protocol described by Peterson et al. [ ], two ddRAD libraries were prepared using different pairs of high fidelity restriction enzymes (REs) (New England Biolabs, UK; NEB); one using Sbf I (specific for the CCTGCA|GG motif) and Sph I (specific for the GCATG|C motif) and the other using Sbf I and Nco I (specific for the C|CATGG motif). ..

    Article Title: A novel sex-determining QTL in Nile tilapia (Oreochromis niloticus)
    Article Snippet: ddRAD library preparation and sequencing The ddRAD library preparation protocol followed a modified version of the methodology described by Peterson et al. [ ]. .. Each sample (0.1 μg DNA) was digested at 37°C for 40 minutes with Sbf I (recognising the CCTGCA|GG motif) and Sph I (recognising the GCATG|C motif) high fidelity restriction enzymes (New England Biolabs, UK; NEB), using 6 U of each enzyme per microgram of genomic DNA in 1× Reaction Buffer 4 (NEB).

    Article Title: Rapid SNP Discovery and Genetic Mapping Using Sequenced RAD Markers
    Article Snippet: Isolation of RAD markers for Illumina sequencing Genomic DNA (0.1–1 µg; from either individual or pooled samples) was digested for 15 min at 37°C in a 50 µL reaction with 20 units (U) of EcoR I or Sbf I (New England Biolabs [NEB]). .. 2.5 µL of 100 nM P1 Adapter, a modified Solexa© adapter (2006 Illumina, Inc., all rights reserved; for EcoR I digestion, top: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTxxxxx-3′ [x = barcode], bottom: 5′-Phos-AATTxxxxxAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT-3′ , for Sbf I digestion, top: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTxxxxTGCA-3′ , bottom: 5′-Phos-xxxxAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT-3′ ) were added to the sample along with 1 µL of 100 mM rATP (Promega), 1 µL 10× EcoR I buffer, 0.5 µL (1000 U) T4 DNA Ligase (high concentration, NEB), 5 µL H2 O and incubated at room temperature (RT) for 20 min.

    Transformation Assay:

    Article Title: Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1 [W]Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1 [W] [OA]
    Article Snippet: Complementation of the ebi-1 mutation was obtained by using the Myc-tagged CaMV 35S:EBI coding sequence in pRT104 plasmid (as described below), the construct was digested with Sbf I (New England Biolabs), and the resulting fragment was ligated into Pst I-digested and dephosphorylated promoterless binary vector pGREEN0229. .. CCA1 :: LUC+ and TOC1 :: LUC+ constructs have been described previously ( ; ). ebi-1 plants without the CAB2 :: LUC+ reporter (obtained from a cross with wild-type Ws-2) were transformed with CCA1 :: LUC+ or TOC1 :: LUC+ reporters using floral dipping as described above.

    Gel Purification:

    Article Title: Characterization of the Rat Oncostatin M Receptor Complex Which Resembles the Human, but Differs from the Murine Cytokine Receptor
    Article Snippet: The rOSMR and rLIFR amplicons were digested with Sbf I and Fse I (New England Biolabs) for 4 hours at 37°C. .. After gel purification the fragments were ligated stepwise into the plasmid pBO (kindly provided by Dr. C. Haan, Luxembourg) which contains a tetracycline responsive bidirectional promoter to allow simultaneous transcription of two receptor cDNAs and a hygromycin B resistance cassette to allow selection of stable cell lines .

    Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
    Article Snippet: Briefly, each sample (0.72 μg parental DNA/0.24 μg offspring DNA) was digested at 37°C for 60 min with Sbf I (recognizing the CCTGCA| GG motif) high fidelity restriction enzyme (New England Biolabs, NEB). .. Shearing and initial size selection (300–600 bp) by agarose gel separation were followed by gel purification, end repair, dA overhang addition, P2 (individual-specific adapters) paired-end adapter ligation, library amplification, as described in the original RAD protocol ( ; ).

    Article Title: Mapping and Sequencing of a Significant Quantitative Trait Locus Affecting Resistance to Koi Herpesvirus in Common Carp
    Article Snippet: Briefly, template DNA was digested using the Sbf I (recognizing the CCTGCA|GG motif) high fidelity restriction enzyme (New England Biolabs; NEB). .. Following a final gel elution step into 20 µL EB buffer (MinElute Gel Purification Kit, Qiagen), 66 libraries (24 animals each) were sent to BMR Genomics (Italy), for quality control and high-throughput sequencing.

    Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
    Article Snippet: Briefly, each sample (0.72 μg parental DNA/0.24 μg offspring DNA) was digested at 37°C for 60 min with Sbf I (recognizing the CCTGCA| GG motif) high fidelity restriction enzyme (New England Biolabs, NEB). .. Shearing and initial size selection (300–600 bp) by agarose gel separation were followed by gel purification, end repair, dA overhang addition, P2 (individual-specific adapters) paired-end adapter ligation, library amplification, as described in the original RAD protocol ( ; ).

    Article Title: Mapping and Sequencing of a Significant Quantitative Trait Locus Affecting Resistance to Koi Herpesvirus in Common Carp
    Article Snippet: Briefly, template DNA was digested using the Sbf I (recognizing the CCTGCA|GG motif) high fidelity restriction enzyme (New England Biolabs; NEB). .. Following a final gel elution step into 20 µL EB buffer (MinElute Gel Purification Kit, Qiagen), 66 libraries (24 animals each) were sent to BMR Genomics (Italy), for quality control and high-throughput sequencing.

    Transfection:

    Article Title: Long-term live imaging reveals cytosolic immune responses of host hepatocytes against Plasmodium infection and parasite escape mechanisms
    Article Snippet: This construct was used to target the GIMOANKA mother line using the ‘gene insertion/marker out’ (GIMO transfection) procedure. .. Construct pL1720 was made as follows: first the selectable marker (SM) cassette from pL1661 (containing both 5′hsp70 and 3′hsp70 sequences, tgdhfr/ts SM, and 230p targeting regions) was removed by digesting the plasmid with Sna BI (Roche, 10997480001) and Sbf I (New England Biolabs, R06425) followed by treatment of the DNA fragment with Klenow (Roche, 11008404001) and religation resulting in a plasmid that contains only the 5′hsp70 –3′hsp70 sequences and the 230 p (PBANKA_030600) targeting regions; the mCherry coding sequences (excised from pL0047 which contains the 5′pbeef1 α-mCherry- 3′pbdhfr cassette) was then introduced into this plasmid using sites Bam HI (Roche, 10220612001) and Not I (Roche, 11014706001).

    Ligation:

    Article Title: Mapping and Validation of the Major Sex-Determining Region in Nile Tilapia (Oreochromis niloticus L.) Using RAD Sequencing
    Article Snippet: Each sample (0.72 µg parental DNA/0.24 µg offspring DNA) was digested at 37°C for 40 minutes with Sbf I (recognising the CCTGCA|GG motif) high fidelity restriction enzyme (New England Biolabs; NEB) using 6 U Sbf I per µg genomic DNA in 1× Reaction Buffer 4 (NEB) at a final concentration of c. 1 µg DNA per 50 µL reaction volume. .. Following heat inactivation at 65°C for 20 minutes, the ligation reactions were slowly cooled to room temperature (over 1 hour) then combined in appropriate multiplex pools ( ).

    Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
    Article Snippet: Briefly, each sample (0.72 μg parental DNA/0.24 μg offspring DNA) was digested at 37°C for 60 min with Sbf I (recognizing the CCTGCA| GG motif) high fidelity restriction enzyme (New England Biolabs, NEB). .. Following heat inactivation at 65°C for 20 min, the ligation reactions were slowly cooled to room temperature (over 1 h) then combined in appropriate multiplex pools.

    Article Title: Mapping the sex determination locus in the Atlantic halibut (Hippoglossus hippoglossus) using RAD sequencing
    Article Snippet: Each sample (1.5 μg parental DNA / 0.5 μg offspring DNA) was digested at 37°C for 30 minutes with Sbf I (recognising the CCTGCA|GG motif) high fidelity restriction enzyme (New England Biolabs; NEB) using 6U Sbf I per μg genomic DNA in 1× Reaction Buffer 4 (NEB) at a final concentration of c. 1 μg DNA per 50 μL reaction volume. .. Following heat inactivation at 65°C for 20 minutes, the ligation reactions were slowly cooled to room temperature (over 1 hour) then combined in appropriate multiplex pools (Additional file ).

    Article Title: Gene-centromere mapping in meiotic gynogenetic European seabass
    Article Snippet: Briefly, a single restriction enzyme digestion/adapter ligation reaction was performed for each progeny sample, while triplicate reactions were made for both dam and sire DNA samples. .. Each sample (40 ng DNA) was digested at 37 °C for 30 min with 0.8 U Sbf I (‘rare’ cutter, CCTGCA|GG motif) and 0.8 U SphI (‘common’ cutter, GCATG|C motif) high fidelity restriction enzymes (New England Biolabs; NEB) in a 6 μL reaction volume that included 1× CutSmart™ buffer (NEB).

    Article Title: A novel sex-determining QTL in Nile tilapia (Oreochromis niloticus)
    Article Snippet: Each sample (0.1 μg DNA) was digested at 37°C for 40 minutes with Sbf I (recognising the CCTGCA|GG motif) and Sph I (recognising the GCATG|C motif) high fidelity restriction enzymes (New England Biolabs, UK; NEB), using 6 U of each enzyme per microgram of genomic DNA in 1× Reaction Buffer 4 (NEB). .. Following heat inactivation at 65°C for 20 minutes, the ligation reactions were slowly cooled to room temperature (over 1 hour) then combined in a single pool (for one sequencing lane) and purified.

    Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
    Article Snippet: Briefly, each sample (0.72 μg parental DNA/0.24 μg offspring DNA) was digested at 37°C for 60 min with Sbf I (recognizing the CCTGCA| GG motif) high fidelity restriction enzyme (New England Biolabs, NEB). .. Following heat inactivation at 65°C for 20 min, the ligation reactions were slowly cooled to room temperature (over 1 h) then combined in appropriate multiplex pools.

    Generated:

    Article Title: Characterization of the Rat Oncostatin M Receptor Complex Which Resembles the Human, but Differs from the Murine Cytokine Receptor
    Article Snippet: The rOSMR and rLIFR amplicons were digested with Sbf I and Fse I (New England Biolabs) for 4 hours at 37°C. .. Thereby pBO-rgp130/rLIFR or pBO-rgp130/rOSMR was generated.

    Polymerase Chain Reaction:

    Article Title: Characterization of the Rat Oncostatin M Receptor Complex Which Resembles the Human, but Differs from the Murine Cytokine Receptor
    Article Snippet: Upon reverse transcription, the cDNA was used to amplify the complete coding sequence of each receptor using specific primers containing restriction sites flanking the start or stop codon and the PCR Extender System (5 PRIME). .. The rOSMR and rLIFR amplicons were digested with Sbf I and Fse I (New England Biolabs) for 4 hours at 37°C.

    Article Title: Mapping and Validation of the Major Sex-Determining Region in Nile Tilapia (Oreochromis niloticus L.) Using RAD Sequencing
    Article Snippet: The RAD specific P1 and P2 paired-end adapters and library amplification PCR primer sequences used in this study are detailed in Baxter et al. . .. Each sample (0.72 µg parental DNA/0.24 µg offspring DNA) was digested at 37°C for 40 minutes with Sbf I (recognising the CCTGCA|GG motif) high fidelity restriction enzyme (New England Biolabs; NEB) using 6 U Sbf I per µg genomic DNA in 1× Reaction Buffer 4 (NEB) at a final concentration of c. 1 µg DNA per 50 µL reaction volume.

    Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
    Article Snippet: The RAD-specific P1 and P2 paired-end adapters and library amplification PCR primer sequences used in this study are detailed in . .. Briefly, each sample (0.72 μg parental DNA/0.24 μg offspring DNA) was digested at 37°C for 60 min with Sbf I (recognizing the CCTGCA| GG motif) high fidelity restriction enzyme (New England Biolabs, NEB).

    Article Title: Mapping the sex determination locus in the Atlantic halibut (Hippoglossus hippoglossus) using RAD sequencing
    Article Snippet: The RAD-specific P1 and P2 paired-end adapters and library amplification PCR primer sequences used in this study are detailed in Baxter et al. [ ]. .. Each sample (1.5 μg parental DNA / 0.5 μg offspring DNA) was digested at 37°C for 30 minutes with Sbf I (recognising the CCTGCA|GG motif) high fidelity restriction enzyme (New England Biolabs; NEB) using 6U Sbf I per μg genomic DNA in 1× Reaction Buffer 4 (NEB) at a final concentration of c. 1 μg DNA per 50 μL reaction volume.

    Article Title: Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1 [W]Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1 [W] [OA]
    Article Snippet: Complementation of the ebi-1 mutation was obtained by using the Myc-tagged CaMV 35S:EBI coding sequence in pRT104 plasmid (as described below), the construct was digested with Sbf I (New England Biolabs), and the resulting fragment was ligated into Pst I-digested and dephosphorylated promoterless binary vector pGREEN0229. .. The resulting plasmid was introduced into ebi-1 using Agrobacterium tumefaciens -mediated floral dipping , selected by spraying with 5.75% BASTA (Hoechst Schering AgrEvo) twice, and confirmed by PCR.

    Article Title: Genome-wide signatures of local adaptation among seven stoneflies species along a nationwide latitudinal gradient in Japan
    Article Snippet: Briefly, 100 ng genomic DNA per sample was digested with restriction endonucleases, Sbf I (NEB) and Hae III (Takara) at 37 °C for 3 h. Restriction fragments of each sample were ligated to a unique 6-mer adaptor. .. Purified DNA samples were PCR amplified using two sequential PCRs.

    Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
    Article Snippet: The RAD-specific P1 and P2 paired-end adapters and library amplification PCR primer sequences used in this study are detailed in . .. Briefly, each sample (0.72 μg parental DNA/0.24 μg offspring DNA) was digested at 37°C for 60 min with Sbf I (recognizing the CCTGCA| GG motif) high fidelity restriction enzyme (New England Biolabs, NEB).

    DNA Extraction:

    Article Title: Mapping and Validation of the Major Sex-Determining Region in Nile Tilapia (Oreochromis niloticus L.) Using RAD Sequencing
    Article Snippet: RAD Library Preparation and Sequencing DNA was extracted from fin tissue of the fish using the REALPure genomic DNA extraction kit (Durviz S.L.) and treated with RNase to remove residual RNA from the sample. .. Each sample (0.72 µg parental DNA/0.24 µg offspring DNA) was digested at 37°C for 40 minutes with Sbf I (recognising the CCTGCA|GG motif) high fidelity restriction enzyme (New England Biolabs; NEB) using 6 U Sbf I per µg genomic DNA in 1× Reaction Buffer 4 (NEB) at a final concentration of c. 1 µg DNA per 50 µL reaction volume.

    Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
    Article Snippet: RAD Library Preparation and Sequencing Genomic DNA was extracted from fin samples using the REALPure genomic DNA extraction kit (Durviz S.L.) and treated with RNase. .. Briefly, each sample (0.72 μg parental DNA/0.24 μg offspring DNA) was digested at 37°C for 60 min with Sbf I (recognizing the CCTGCA| GG motif) high fidelity restriction enzyme (New England Biolabs, NEB).

    Article Title: Mapping the sex determination locus in the Atlantic halibut (Hippoglossus hippoglossus) using RAD sequencing
    Article Snippet: RAD library preparation and sequencing DNA was extracted from blood samples of the fish using the REALPure genomic DNA extraction kit (Durviz S.L.) and treated with RNase to remove residual RNA from the sample. .. Each sample (1.5 μg parental DNA / 0.5 μg offspring DNA) was digested at 37°C for 30 minutes with Sbf I (recognising the CCTGCA|GG motif) high fidelity restriction enzyme (New England Biolabs; NEB) using 6U Sbf I per μg genomic DNA in 1× Reaction Buffer 4 (NEB) at a final concentration of c. 1 μg DNA per 50 μL reaction volume.

    Article Title: Genome-wide signatures of local adaptation among seven stoneflies species along a nationwide latitudinal gradient in Japan
    Article Snippet: This DNA extraction method involved the use of the whole body without any destruction of the specimen, thus reducing the probability of contamination (gut content contamination). ddRAD libraries were constructed as previously described [ ] with slight modifications. .. Briefly, 100 ng genomic DNA per sample was digested with restriction endonucleases, Sbf I (NEB) and Hae III (Takara) at 37 °C for 3 h. Restriction fragments of each sample were ligated to a unique 6-mer adaptor.

    Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
    Article Snippet: Genomic DNA was extracted from fin samples using the REALPure genomic DNA extraction kit (Durviz S.L.) and treated with RNase. .. Briefly, each sample (0.72 μg parental DNA/0.24 μg offspring DNA) was digested at 37°C for 60 min with Sbf I (recognizing the CCTGCA| GG motif) high fidelity restriction enzyme (New England Biolabs, NEB).

    Marker:

    Article Title: Long-term live imaging reveals cytosolic immune responses of host hepatocytes against Plasmodium infection and parasite escape mechanisms
    Article Snippet: .. Construct pL1720 was made as follows: first the selectable marker (SM) cassette from pL1661 (containing both 5′hsp70 and 3′hsp70 sequences, tgdhfr/ts SM, and 230p targeting regions) was removed by digesting the plasmid with Sna BI (Roche, 10997480001) and Sbf I (New England Biolabs, R06425) followed by treatment of the DNA fragment with Klenow (Roche, 11008404001) and religation resulting in a plasmid that contains only the 5′hsp70 –3′hsp70 sequences and the 230 p (PBANKA_030600) targeting regions; the mCherry coding sequences (excised from pL0047 which contains the 5′pbeef1 α-mCherry- 3′pbdhfr cassette) was then introduced into this plasmid using sites Bam HI (Roche, 10220612001) and Not I (Roche, 11014706001). .. Next a luciferase expression cassette (5′pbeef1a-LucIAV-3′pbdhfr) excised from pL1098 using Kpn I (Roche 11198939001) and Afl II (Roche, 11198939001) was introduced into this vector using the same restriction sites.

    Mutagenesis:

    Article Title: Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1 [W]Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1 [W] [OA]
    Article Snippet: .. Complementation of the ebi-1 mutation was obtained by using the Myc-tagged CaMV 35S:EBI coding sequence in pRT104 plasmid (as described below), the construct was digested with Sbf I (New England Biolabs), and the resulting fragment was ligated into Pst I-digested and dephosphorylated promoterless binary vector pGREEN0229. .. The resulting plasmid was introduced into ebi-1 using Agrobacterium tumefaciens -mediated floral dipping , selected by spraying with 5.75% BASTA (Hoechst Schering AgrEvo) twice, and confirmed by PCR.

    Isolation:

    Article Title: Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1 [W]Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1 [W] [OA]
    Article Snippet: ebi-1 was isolated from a screen of EMS-mutagenized M2 Arabidopsis ( Arabidopsis thaliana ) Ws-2 plants ( ) by its early phase of CAB2 :: LUC+ expression in DD. .. Complementation of the ebi-1 mutation was obtained by using the Myc-tagged CaMV 35S:EBI coding sequence in pRT104 plasmid (as described below), the construct was digested with Sbf I (New England Biolabs), and the resulting fragment was ligated into Pst I-digested and dephosphorylated promoterless binary vector pGREEN0229.

    Article Title: Rapid SNP Discovery and Genetic Mapping Using Sequenced RAD Markers
    Article Snippet: .. Isolation of RAD markers for Illumina sequencing Genomic DNA (0.1–1 µg; from either individual or pooled samples) was digested for 15 min at 37°C in a 50 µL reaction with 20 units (U) of EcoR I or Sbf I (New England Biolabs [NEB]). ..

    Purification:

    Article Title: A novel sex-determining QTL in Nile tilapia (Oreochromis niloticus)
    Article Snippet: Each sample (0.1 μg DNA) was digested at 37°C for 40 minutes with Sbf I (recognising the CCTGCA|GG motif) and Sph I (recognising the GCATG|C motif) high fidelity restriction enzymes (New England Biolabs, UK; NEB), using 6 U of each enzyme per microgram of genomic DNA in 1× Reaction Buffer 4 (NEB). .. Following heat inactivation at 65°C for 20 minutes, the ligation reactions were slowly cooled to room temperature (over 1 hour) then combined in a single pool (for one sequencing lane) and purified.

    Article Title: Genome-wide signatures of local adaptation among seven stoneflies species along a nationwide latitudinal gradient in Japan
    Article Snippet: Briefly, 100 ng genomic DNA per sample was digested with restriction endonucleases, Sbf I (NEB) and Hae III (Takara) at 37 °C for 3 h. Restriction fragments of each sample were ligated to a unique 6-mer adaptor. .. Subsequently, 300–500 bp fragments were excised and purified using MinElute Gel Extraction Kit (Qiagen).

    Sequencing:

    Article Title: Characterization of the Rat Oncostatin M Receptor Complex Which Resembles the Human, but Differs from the Murine Cytokine Receptor
    Article Snippet: Upon reverse transcription, the cDNA was used to amplify the complete coding sequence of each receptor using specific primers containing restriction sites flanking the start or stop codon and the PCR Extender System (5 PRIME). .. The rOSMR and rLIFR amplicons were digested with Sbf I and Fse I (New England Biolabs) for 4 hours at 37°C.

    Article Title: Mapping the sex determination locus in the hāpuku (Polyprion oxygeneios) using ddRAD sequencing
    Article Snippet: .. ddRAD library preparation and sequencing Following a modified version of the protocol described by Peterson et al. [ ], two ddRAD libraries were prepared using different pairs of high fidelity restriction enzymes (REs) (New England Biolabs, UK; NEB); one using Sbf I (specific for the CCTGCA|GG motif) and Sph I (specific for the GCATG|C motif) and the other using Sbf I and Nco I (specific for the C|CATGG motif). ..

    Article Title: Mapping and Validation of the Major Sex-Determining Region in Nile Tilapia (Oreochromis niloticus L.) Using RAD Sequencing
    Article Snippet: Paragraph title: RAD Library Preparation and Sequencing ... Each sample (0.72 µg parental DNA/0.24 µg offspring DNA) was digested at 37°C for 40 minutes with Sbf I (recognising the CCTGCA|GG motif) high fidelity restriction enzyme (New England Biolabs; NEB) using 6 U Sbf I per µg genomic DNA in 1× Reaction Buffer 4 (NEB) at a final concentration of c. 1 µg DNA per 50 µL reaction volume.

    Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
    Article Snippet: Paragraph title: RAD Library Preparation and Sequencing ... Briefly, each sample (0.72 μg parental DNA/0.24 μg offspring DNA) was digested at 37°C for 60 min with Sbf I (recognizing the CCTGCA| GG motif) high fidelity restriction enzyme (New England Biolabs, NEB).

    Article Title: Mapping the sex determination locus in the Atlantic halibut (Hippoglossus hippoglossus) using RAD sequencing
    Article Snippet: Paragraph title: RAD library preparation and sequencing ... Each sample (1.5 μg parental DNA / 0.5 μg offspring DNA) was digested at 37°C for 30 minutes with Sbf I (recognising the CCTGCA|GG motif) high fidelity restriction enzyme (New England Biolabs; NEB) using 6U Sbf I per μg genomic DNA in 1× Reaction Buffer 4 (NEB) at a final concentration of c. 1 μg DNA per 50 μL reaction volume.

    Article Title: Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1 [W]Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1 [W] [OA]
    Article Snippet: .. Complementation of the ebi-1 mutation was obtained by using the Myc-tagged CaMV 35S:EBI coding sequence in pRT104 plasmid (as described below), the construct was digested with Sbf I (New England Biolabs), and the resulting fragment was ligated into Pst I-digested and dephosphorylated promoterless binary vector pGREEN0229. .. The resulting plasmid was introduced into ebi-1 using Agrobacterium tumefaciens -mediated floral dipping , selected by spraying with 5.75% BASTA (Hoechst Schering AgrEvo) twice, and confirmed by PCR.

    Article Title: Mapping and Sequencing of a Significant Quantitative Trait Locus Affecting Resistance to Koi Herpesvirus in Common Carp
    Article Snippet: Paragraph title: Library preparation and sequencing ... Briefly, template DNA was digested using the Sbf I (recognizing the CCTGCA|GG motif) high fidelity restriction enzyme (New England Biolabs; NEB).

    Article Title: Gene-centromere mapping in meiotic gynogenetic European seabass
    Article Snippet: Paragraph title: ddRAD library preparation and sequencing ... Each sample (40 ng DNA) was digested at 37 °C for 30 min with 0.8 U Sbf I (‘rare’ cutter, CCTGCA|GG motif) and 0.8 U SphI (‘common’ cutter, GCATG|C motif) high fidelity restriction enzymes (New England Biolabs; NEB) in a 6 μL reaction volume that included 1× CutSmart™ buffer (NEB).

    Article Title: A novel sex-determining QTL in Nile tilapia (Oreochromis niloticus)
    Article Snippet: Paragraph title: ddRAD library preparation and sequencing ... Each sample (0.1 μg DNA) was digested at 37°C for 40 minutes with Sbf I (recognising the CCTGCA|GG motif) and Sph I (recognising the GCATG|C motif) high fidelity restriction enzymes (New England Biolabs, UK; NEB), using 6 U of each enzyme per microgram of genomic DNA in 1× Reaction Buffer 4 (NEB).

    Article Title: Genome-wide signatures of local adaptation among seven stoneflies species along a nationwide latitudinal gradient in Japan
    Article Snippet: Paragraph title: ddRAD library preparation and sequencing ... Briefly, 100 ng genomic DNA per sample was digested with restriction endonucleases, Sbf I (NEB) and Hae III (Takara) at 37 °C for 3 h. Restriction fragments of each sample were ligated to a unique 6-mer adaptor.

    Article Title: Rapid SNP Discovery and Genetic Mapping Using Sequenced RAD Markers
    Article Snippet: .. Isolation of RAD markers for Illumina sequencing Genomic DNA (0.1–1 µg; from either individual or pooled samples) was digested for 15 min at 37°C in a 50 µL reaction with 20 units (U) of EcoR I or Sbf I (New England Biolabs [NEB]). ..

    Article Title: Low recombination rates in sexual species and sex–asex transitions
    Article Snippet: Paragraph title: (iii) RAD sequencing ... Genomic DNA was digested with Sbf I (New England Biolabs), barcoded with individual-specific P1 adapters, and pooled to create a single library containing 2100 ng DNA.

    Lysis:

    Article Title: Genome-wide signatures of local adaptation among seven stoneflies species along a nationwide latitudinal gradient in Japan
    Article Snippet: The whole body of the specimen was fully submerged in lysis buffer (Qiagen GmbH, Hilden, Germany) and incubated at 56 °C overnight. .. Briefly, 100 ng genomic DNA per sample was digested with restriction endonucleases, Sbf I (NEB) and Hae III (Takara) at 37 °C for 3 h. Restriction fragments of each sample were ligated to a unique 6-mer adaptor.

    Plasmid Preparation:

    Article Title: Characterization of the Rat Oncostatin M Receptor Complex Which Resembles the Human, but Differs from the Murine Cytokine Receptor
    Article Snippet: The rOSMR and rLIFR amplicons were digested with Sbf I and Fse I (New England Biolabs) for 4 hours at 37°C. .. After gel purification the fragments were ligated stepwise into the plasmid pBO (kindly provided by Dr. C. Haan, Luxembourg) which contains a tetracycline responsive bidirectional promoter to allow simultaneous transcription of two receptor cDNAs and a hygromycin B resistance cassette to allow selection of stable cell lines .

    Article Title: Long-term live imaging reveals cytosolic immune responses of host hepatocytes against Plasmodium infection and parasite escape mechanisms
    Article Snippet: .. Construct pL1720 was made as follows: first the selectable marker (SM) cassette from pL1661 (containing both 5′hsp70 and 3′hsp70 sequences, tgdhfr/ts SM, and 230p targeting regions) was removed by digesting the plasmid with Sna BI (Roche, 10997480001) and Sbf I (New England Biolabs, R06425) followed by treatment of the DNA fragment with Klenow (Roche, 11008404001) and religation resulting in a plasmid that contains only the 5′hsp70 –3′hsp70 sequences and the 230 p (PBANKA_030600) targeting regions; the mCherry coding sequences (excised from pL0047 which contains the 5′pbeef1 α-mCherry- 3′pbdhfr cassette) was then introduced into this plasmid using sites Bam HI (Roche, 10220612001) and Not I (Roche, 11014706001). .. Next a luciferase expression cassette (5′pbeef1a-LucIAV-3′pbdhfr) excised from pL1098 using Kpn I (Roche 11198939001) and Afl II (Roche, 11198939001) was introduced into this vector using the same restriction sites.

    Article Title: Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1 [W]Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1 [W] [OA]
    Article Snippet: .. Complementation of the ebi-1 mutation was obtained by using the Myc-tagged CaMV 35S:EBI coding sequence in pRT104 plasmid (as described below), the construct was digested with Sbf I (New England Biolabs), and the resulting fragment was ligated into Pst I-digested and dephosphorylated promoterless binary vector pGREEN0229. .. The resulting plasmid was introduced into ebi-1 using Agrobacterium tumefaciens -mediated floral dipping , selected by spraying with 5.75% BASTA (Hoechst Schering AgrEvo) twice, and confirmed by PCR.

    Multiplex Assay:

    Article Title: Mapping and Validation of the Major Sex-Determining Region in Nile Tilapia (Oreochromis niloticus L.) Using RAD Sequencing
    Article Snippet: Each sample (0.72 µg parental DNA/0.24 µg offspring DNA) was digested at 37°C for 40 minutes with Sbf I (recognising the CCTGCA|GG motif) high fidelity restriction enzyme (New England Biolabs; NEB) using 6 U Sbf I per µg genomic DNA in 1× Reaction Buffer 4 (NEB) at a final concentration of c. 1 µg DNA per 50 µL reaction volume. .. Following heat inactivation at 65°C for 20 minutes, the ligation reactions were slowly cooled to room temperature (over 1 hour) then combined in appropriate multiplex pools ( ).

    Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
    Article Snippet: Briefly, each sample (0.72 μg parental DNA/0.24 μg offspring DNA) was digested at 37°C for 60 min with Sbf I (recognizing the CCTGCA| GG motif) high fidelity restriction enzyme (New England Biolabs, NEB). .. Following heat inactivation at 65°C for 20 min, the ligation reactions were slowly cooled to room temperature (over 1 h) then combined in appropriate multiplex pools.

    Article Title: Mapping the sex determination locus in the Atlantic halibut (Hippoglossus hippoglossus) using RAD sequencing
    Article Snippet: Each sample (1.5 μg parental DNA / 0.5 μg offspring DNA) was digested at 37°C for 30 minutes with Sbf I (recognising the CCTGCA|GG motif) high fidelity restriction enzyme (New England Biolabs; NEB) using 6U Sbf I per μg genomic DNA in 1× Reaction Buffer 4 (NEB) at a final concentration of c. 1 μg DNA per 50 μL reaction volume. .. Following heat inactivation at 65°C for 20 minutes, the ligation reactions were slowly cooled to room temperature (over 1 hour) then combined in appropriate multiplex pools (Additional file ).

    Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
    Article Snippet: Briefly, each sample (0.72 μg parental DNA/0.24 μg offspring DNA) was digested at 37°C for 60 min with Sbf I (recognizing the CCTGCA| GG motif) high fidelity restriction enzyme (New England Biolabs, NEB). .. Following heat inactivation at 65°C for 20 min, the ligation reactions were slowly cooled to room temperature (over 1 h) then combined in appropriate multiplex pools.

    Selection:

    Article Title: Characterization of the Rat Oncostatin M Receptor Complex Which Resembles the Human, but Differs from the Murine Cytokine Receptor
    Article Snippet: The rOSMR and rLIFR amplicons were digested with Sbf I and Fse I (New England Biolabs) for 4 hours at 37°C. .. After gel purification the fragments were ligated stepwise into the plasmid pBO (kindly provided by Dr. C. Haan, Luxembourg) which contains a tetracycline responsive bidirectional promoter to allow simultaneous transcription of two receptor cDNAs and a hygromycin B resistance cassette to allow selection of stable cell lines .

    Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
    Article Snippet: Briefly, each sample (0.72 μg parental DNA/0.24 μg offspring DNA) was digested at 37°C for 60 min with Sbf I (recognizing the CCTGCA| GG motif) high fidelity restriction enzyme (New England Biolabs, NEB). .. Shearing and initial size selection (300–600 bp) by agarose gel separation were followed by gel purification, end repair, dA overhang addition, P2 (individual-specific adapters) paired-end adapter ligation, library amplification, as described in the original RAD protocol ( ; ).

    Article Title: Gene-centromere mapping in meiotic gynogenetic European seabass
    Article Snippet: In silico estimation from the seabass genome predicted 52,230 ddRAD fragments with paired SbfI-SphI restriction site overhangs, while after the size selection applied in the present study (c. 320 bp −590 bp excluding adaptors) only 3603 fragments were predicted to be available. .. Each sample (40 ng DNA) was digested at 37 °C for 30 min with 0.8 U Sbf I (‘rare’ cutter, CCTGCA|GG motif) and 0.8 U SphI (‘common’ cutter, GCATG|C motif) high fidelity restriction enzymes (New England Biolabs; NEB) in a 6 μL reaction volume that included 1× CutSmart™ buffer (NEB).

    Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
    Article Snippet: Briefly, each sample (0.72 μg parental DNA/0.24 μg offspring DNA) was digested at 37°C for 60 min with Sbf I (recognizing the CCTGCA| GG motif) high fidelity restriction enzyme (New England Biolabs, NEB). .. Shearing and initial size selection (300–600 bp) by agarose gel separation were followed by gel purification, end repair, dA overhang addition, P2 (individual-specific adapters) paired-end adapter ligation, library amplification, as described in the original RAD protocol ( ; ).

    Agarose Gel Electrophoresis:

    Article Title: Mapping and Validation of the Major Sex-Determining Region in Nile Tilapia (Oreochromis niloticus L.) Using RAD Sequencing
    Article Snippet: Each sample was quantified by spectrophotometry (Nanodrop) and quality assessed by agarose gel electrophoresis, and was finally diluted to a concentration of 50 ng/µL in 5 mmol/L Tris, pH 8.5. .. Each sample (0.72 µg parental DNA/0.24 µg offspring DNA) was digested at 37°C for 40 minutes with Sbf I (recognising the CCTGCA|GG motif) high fidelity restriction enzyme (New England Biolabs; NEB) using 6 U Sbf I per µg genomic DNA in 1× Reaction Buffer 4 (NEB) at a final concentration of c. 1 µg DNA per 50 µL reaction volume.

    Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
    Article Snippet: Each sample was quantified by spectrophotometry (Nanodrop), and its quality was assessed by agarose gel electrophoresis, before being diluted to a concentration of 20 ng/μL [measured by Qubit Fluorometer (Invitrogen)] in 5 mmol/L Tris, pH 8.5. .. Briefly, each sample (0.72 μg parental DNA/0.24 μg offspring DNA) was digested at 37°C for 60 min with Sbf I (recognizing the CCTGCA| GG motif) high fidelity restriction enzyme (New England Biolabs, NEB).

    Article Title: Mapping the sex determination locus in the Atlantic halibut (Hippoglossus hippoglossus) using RAD sequencing
    Article Snippet: Each sample was quantified by spectrophotometry (Nanodrop) and quality assessed by agarose gel electrophoresis, and was finally diluted to a concentration of 50 ng/μL in 5 mmol/L Tris, pH 8.5. .. Each sample (1.5 μg parental DNA / 0.5 μg offspring DNA) was digested at 37°C for 30 minutes with Sbf I (recognising the CCTGCA|GG motif) high fidelity restriction enzyme (New England Biolabs; NEB) using 6U Sbf I per μg genomic DNA in 1× Reaction Buffer 4 (NEB) at a final concentration of c. 1 μg DNA per 50 μL reaction volume.

    Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
    Article Snippet: Each sample was quantified by spectrophotometry (Nanodrop), and its quality was assessed by agarose gel electrophoresis, before being diluted to a concentration of 20 ng/μL [measured by Qubit Fluorometer (Invitrogen)] in 5 mmol/L Tris, pH 8.5. .. Briefly, each sample (0.72 μg parental DNA/0.24 μg offspring DNA) was digested at 37°C for 60 min with Sbf I (recognizing the CCTGCA| GG motif) high fidelity restriction enzyme (New England Biolabs, NEB).

    Article Title: Low recombination rates in sexual species and sex–asex transitions
    Article Snippet: Genomic DNA was digested with Sbf I (New England Biolabs), barcoded with individual-specific P1 adapters, and pooled to create a single library containing 2100 ng DNA. .. After pooling, the library was randomly sheared on a Bioruptor using six cycles (30 s ON, 1 min OFF per cycle), and fragments between 200 and 500 bp were selected using agarose gel electrophoresis.

    Transgenic Assay:

    Article Title: Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1 [W]Partners in Time: EARLY BIRD Associates with ZEITLUPE and Regulates the Speed of the Arabidopsis Clock 1 [W] [OA]
    Article Snippet: Paragraph title: Plant Material and Transgenic Lines ... Complementation of the ebi-1 mutation was obtained by using the Myc-tagged CaMV 35S:EBI coding sequence in pRT104 plasmid (as described below), the construct was digested with Sbf I (New England Biolabs), and the resulting fragment was ligated into Pst I-digested and dephosphorylated promoterless binary vector pGREEN0229.

    Spectrophotometry:

    Article Title: Mapping and Validation of the Major Sex-Determining Region in Nile Tilapia (Oreochromis niloticus L.) Using RAD Sequencing
    Article Snippet: Each sample was quantified by spectrophotometry (Nanodrop) and quality assessed by agarose gel electrophoresis, and was finally diluted to a concentration of 50 ng/µL in 5 mmol/L Tris, pH 8.5. .. Each sample (0.72 µg parental DNA/0.24 µg offspring DNA) was digested at 37°C for 40 minutes with Sbf I (recognising the CCTGCA|GG motif) high fidelity restriction enzyme (New England Biolabs; NEB) using 6 U Sbf I per µg genomic DNA in 1× Reaction Buffer 4 (NEB) at a final concentration of c. 1 µg DNA per 50 µL reaction volume.

    Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
    Article Snippet: Each sample was quantified by spectrophotometry (Nanodrop), and its quality was assessed by agarose gel electrophoresis, before being diluted to a concentration of 20 ng/μL [measured by Qubit Fluorometer (Invitrogen)] in 5 mmol/L Tris, pH 8.5. .. Briefly, each sample (0.72 μg parental DNA/0.24 μg offspring DNA) was digested at 37°C for 60 min with Sbf I (recognizing the CCTGCA| GG motif) high fidelity restriction enzyme (New England Biolabs, NEB).

    Article Title: Mapping the sex determination locus in the Atlantic halibut (Hippoglossus hippoglossus) using RAD sequencing
    Article Snippet: Each sample was quantified by spectrophotometry (Nanodrop) and quality assessed by agarose gel electrophoresis, and was finally diluted to a concentration of 50 ng/μL in 5 mmol/L Tris, pH 8.5. .. Each sample (1.5 μg parental DNA / 0.5 μg offspring DNA) was digested at 37°C for 30 minutes with Sbf I (recognising the CCTGCA|GG motif) high fidelity restriction enzyme (New England Biolabs; NEB) using 6U Sbf I per μg genomic DNA in 1× Reaction Buffer 4 (NEB) at a final concentration of c. 1 μg DNA per 50 μL reaction volume.

    Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
    Article Snippet: Each sample was quantified by spectrophotometry (Nanodrop), and its quality was assessed by agarose gel electrophoresis, before being diluted to a concentration of 20 ng/μL [measured by Qubit Fluorometer (Invitrogen)] in 5 mmol/L Tris, pH 8.5. .. Briefly, each sample (0.72 μg parental DNA/0.24 μg offspring DNA) was digested at 37°C for 60 min with Sbf I (recognizing the CCTGCA| GG motif) high fidelity restriction enzyme (New England Biolabs, NEB).

    Concentration Assay:

    Article Title: Mapping and Validation of the Major Sex-Determining Region in Nile Tilapia (Oreochromis niloticus L.) Using RAD Sequencing
    Article Snippet: .. Each sample (0.72 µg parental DNA/0.24 µg offspring DNA) was digested at 37°C for 40 minutes with Sbf I (recognising the CCTGCA|GG motif) high fidelity restriction enzyme (New England Biolabs; NEB) using 6 U Sbf I per µg genomic DNA in 1× Reaction Buffer 4 (NEB) at a final concentration of c. 1 µg DNA per 50 µL reaction volume. ..

    Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
    Article Snippet: Each sample was quantified by spectrophotometry (Nanodrop), and its quality was assessed by agarose gel electrophoresis, before being diluted to a concentration of 20 ng/μL [measured by Qubit Fluorometer (Invitrogen)] in 5 mmol/L Tris, pH 8.5. .. Briefly, each sample (0.72 μg parental DNA/0.24 μg offspring DNA) was digested at 37°C for 60 min with Sbf I (recognizing the CCTGCA| GG motif) high fidelity restriction enzyme (New England Biolabs, NEB).

    Article Title: Mapping the sex determination locus in the Atlantic halibut (Hippoglossus hippoglossus) using RAD sequencing
    Article Snippet: .. Each sample (1.5 μg parental DNA / 0.5 μg offspring DNA) was digested at 37°C for 30 minutes with Sbf I (recognising the CCTGCA|GG motif) high fidelity restriction enzyme (New England Biolabs; NEB) using 6U Sbf I per μg genomic DNA in 1× Reaction Buffer 4 (NEB) at a final concentration of c. 1 μg DNA per 50 μL reaction volume. ..

    Article Title: Rapid SNP Discovery and Genetic Mapping Using Sequenced RAD Markers
    Article Snippet: Isolation of RAD markers for Illumina sequencing Genomic DNA (0.1–1 µg; from either individual or pooled samples) was digested for 15 min at 37°C in a 50 µL reaction with 20 units (U) of EcoR I or Sbf I (New England Biolabs [NEB]). .. 2.5 µL of 100 nM P1 Adapter, a modified Solexa© adapter (2006 Illumina, Inc., all rights reserved; for EcoR I digestion, top: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTxxxxx-3′ [x = barcode], bottom: 5′-Phos-AATTxxxxxAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT-3′ , for Sbf I digestion, top: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTxxxxTGCA-3′ , bottom: 5′-Phos-xxxxAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT-3′ ) were added to the sample along with 1 µL of 100 mM rATP (Promega), 1 µL 10× EcoR I buffer, 0.5 µL (1000 U) T4 DNA Ligase (high concentration, NEB), 5 µL H2 O and incubated at room temperature (RT) for 20 min.

    Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
    Article Snippet: Each sample was quantified by spectrophotometry (Nanodrop), and its quality was assessed by agarose gel electrophoresis, before being diluted to a concentration of 20 ng/μL [measured by Qubit Fluorometer (Invitrogen)] in 5 mmol/L Tris, pH 8.5. .. Briefly, each sample (0.72 μg parental DNA/0.24 μg offspring DNA) was digested at 37°C for 60 min with Sbf I (recognizing the CCTGCA| GG motif) high fidelity restriction enzyme (New England Biolabs, NEB).

    High Throughput Screening Assay:

    Article Title: Mapping and Sequencing of a Significant Quantitative Trait Locus Affecting Resistance to Koi Herpesvirus in Common Carp
    Article Snippet: Briefly, template DNA was digested using the Sbf I (recognizing the CCTGCA|GG motif) high fidelity restriction enzyme (New England Biolabs; NEB). .. Following a final gel elution step into 20 µL EB buffer (MinElute Gel Purification Kit, Qiagen), 66 libraries (24 animals each) were sent to BMR Genomics (Italy), for quality control and high-throughput sequencing.

    Article Title: Mapping and Sequencing of a Significant Quantitative Trait Locus Affecting Resistance to Koi Herpesvirus in Common Carp
    Article Snippet: Briefly, template DNA was digested using the Sbf I (recognizing the CCTGCA|GG motif) high fidelity restriction enzyme (New England Biolabs; NEB). .. Following a final gel elution step into 20 µL EB buffer (MinElute Gel Purification Kit, Qiagen), 66 libraries (24 animals each) were sent to BMR Genomics (Italy), for quality control and high-throughput sequencing.

    Gel Extraction:

    Article Title: Genome-wide signatures of local adaptation among seven stoneflies species along a nationwide latitudinal gradient in Japan
    Article Snippet: Briefly, 100 ng genomic DNA per sample was digested with restriction endonucleases, Sbf I (NEB) and Hae III (Takara) at 37 °C for 3 h. Restriction fragments of each sample were ligated to a unique 6-mer adaptor. .. Subsequently, 300–500 bp fragments were excised and purified using MinElute Gel Extraction Kit (Qiagen).

    Fluorescence In Situ Hybridization:

    Article Title: Mapping and Validation of the Major Sex-Determining Region in Nile Tilapia (Oreochromis niloticus L.) Using RAD Sequencing
    Article Snippet: RAD Library Preparation and Sequencing DNA was extracted from fin tissue of the fish using the REALPure genomic DNA extraction kit (Durviz S.L.) and treated with RNase to remove residual RNA from the sample. .. Each sample (0.72 µg parental DNA/0.24 µg offspring DNA) was digested at 37°C for 40 minutes with Sbf I (recognising the CCTGCA|GG motif) high fidelity restriction enzyme (New England Biolabs; NEB) using 6 U Sbf I per µg genomic DNA in 1× Reaction Buffer 4 (NEB) at a final concentration of c. 1 µg DNA per 50 µL reaction volume.

    Article Title: Mapping the sex determination locus in the Atlantic halibut (Hippoglossus hippoglossus) using RAD sequencing
    Article Snippet: RAD library preparation and sequencing DNA was extracted from blood samples of the fish using the REALPure genomic DNA extraction kit (Durviz S.L.) and treated with RNase to remove residual RNA from the sample. .. Each sample (1.5 μg parental DNA / 0.5 μg offspring DNA) was digested at 37°C for 30 minutes with Sbf I (recognising the CCTGCA|GG motif) high fidelity restriction enzyme (New England Biolabs; NEB) using 6U Sbf I per μg genomic DNA in 1× Reaction Buffer 4 (NEB) at a final concentration of c. 1 μg DNA per 50 μL reaction volume.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs sbfi restriction sites
    Cloning, expression and purification of equine recombinant SCGB 1A1 and SCGB 1A1A proteins. (A) SCGB1A1 (“1”) and SCGB1A1A (“1A”) partial ORFs were amplified from equine lung cDNA preparations. A unique band of appropriate size (225 bp) was amplified for each gene. L = 1 Kb+ DNA ladder. (B) Fragments were digested with <t>XmnI</t> and <t>SbfI</t> restriction enzymes (purple boxes) and inserted into the multiple cloning sites (MCS) of the pMAL-c5X expression vector (top). DNA from the transformed colonies was submitted for sequencing to determine the presence, integrity, orientation and suitable translational reading frame of the insert. SCGB1A1 and SCGB1A1A sequenced (S) products showed proper orientation and 100% identity to the predicted (P) sequences. (C) Fractions collected during the purification steps of SCGB 1A1 and SCGB 1A1A were analyzed by SDS-PAGE. A fusion protein was apparent in extracts from IPTG-induced (I) but not un-induced (U) colonies. A crude extract (CE) was collected from induced cells and purified by affinity chromatography, using an amylose (A) column. The eluted fractions were pooled and incubated with Factor Xa protease (Fx) to cleave the fusion proteins. Fx was removed by FPLC (F), and MBP (42.5 kDa) was removed by additional passage on an amylose column from which pure (P) recombinant proteins (7 kDa) were collected. (D) Purified SCGB 1A1 and SCGB 1A1A proteins form dimers that dissociate under reducing and denaturing conditions. (E) Identity of dimers and monomers was confirmed by Western blot analysis. (C, D, E) S = Precision plus protein standard (dual color).
    Sbfi Restriction Sites, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 69 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sbfi restriction sites/product/New England Biolabs
    Average 95 stars, based on 69 article reviews
    Price from $9.99 to $1999.99
    sbfi restriction sites - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results


    Cloning, expression and purification of equine recombinant SCGB 1A1 and SCGB 1A1A proteins. (A) SCGB1A1 (“1”) and SCGB1A1A (“1A”) partial ORFs were amplified from equine lung cDNA preparations. A unique band of appropriate size (225 bp) was amplified for each gene. L = 1 Kb+ DNA ladder. (B) Fragments were digested with XmnI and SbfI restriction enzymes (purple boxes) and inserted into the multiple cloning sites (MCS) of the pMAL-c5X expression vector (top). DNA from the transformed colonies was submitted for sequencing to determine the presence, integrity, orientation and suitable translational reading frame of the insert. SCGB1A1 and SCGB1A1A sequenced (S) products showed proper orientation and 100% identity to the predicted (P) sequences. (C) Fractions collected during the purification steps of SCGB 1A1 and SCGB 1A1A were analyzed by SDS-PAGE. A fusion protein was apparent in extracts from IPTG-induced (I) but not un-induced (U) colonies. A crude extract (CE) was collected from induced cells and purified by affinity chromatography, using an amylose (A) column. The eluted fractions were pooled and incubated with Factor Xa protease (Fx) to cleave the fusion proteins. Fx was removed by FPLC (F), and MBP (42.5 kDa) was removed by additional passage on an amylose column from which pure (P) recombinant proteins (7 kDa) were collected. (D) Purified SCGB 1A1 and SCGB 1A1A proteins form dimers that dissociate under reducing and denaturing conditions. (E) Identity of dimers and monomers was confirmed by Western blot analysis. (C, D, E) S = Precision plus protein standard (dual color).

    Journal: PLoS ONE

    Article Title: Secretoglobin 1A1 and 1A1A Differentially Regulate Neutrophil Reactive Oxygen Species Production, Phagocytosis and Extracellular Trap Formation

    doi: 10.1371/journal.pone.0096217

    Figure Lengend Snippet: Cloning, expression and purification of equine recombinant SCGB 1A1 and SCGB 1A1A proteins. (A) SCGB1A1 (“1”) and SCGB1A1A (“1A”) partial ORFs were amplified from equine lung cDNA preparations. A unique band of appropriate size (225 bp) was amplified for each gene. L = 1 Kb+ DNA ladder. (B) Fragments were digested with XmnI and SbfI restriction enzymes (purple boxes) and inserted into the multiple cloning sites (MCS) of the pMAL-c5X expression vector (top). DNA from the transformed colonies was submitted for sequencing to determine the presence, integrity, orientation and suitable translational reading frame of the insert. SCGB1A1 and SCGB1A1A sequenced (S) products showed proper orientation and 100% identity to the predicted (P) sequences. (C) Fractions collected during the purification steps of SCGB 1A1 and SCGB 1A1A were analyzed by SDS-PAGE. A fusion protein was apparent in extracts from IPTG-induced (I) but not un-induced (U) colonies. A crude extract (CE) was collected from induced cells and purified by affinity chromatography, using an amylose (A) column. The eluted fractions were pooled and incubated with Factor Xa protease (Fx) to cleave the fusion proteins. Fx was removed by FPLC (F), and MBP (42.5 kDa) was removed by additional passage on an amylose column from which pure (P) recombinant proteins (7 kDa) were collected. (D) Purified SCGB 1A1 and SCGB 1A1A proteins form dimers that dissociate under reducing and denaturing conditions. (E) Identity of dimers and monomers was confirmed by Western blot analysis. (C, D, E) S = Precision plus protein standard (dual color).

    Article Snippet: Primers were designed with XmnI and SbfI restriction sites for cloning into the pMAL-c5X expression vector (New England BioLabs, Mississauga, ON).

    Techniques: Clone Assay, Expressing, Purification, Recombinant, Amplification, Plasmid Preparation, Transformation Assay, Sequencing, SDS Page, Affinity Chromatography, Incubation, Fast Protein Liquid Chromatography, Western Blot

    Sequenced RAD marker mapping. (A) A native saltwater stickleback population, Rabbit Slough (RS), have complete lateral plate armor (brackets) while these structures are absent in the derived, freshwater Bear Paw (BP) population. The freshwater fish also have a reduction in pelvic structure (arrow) compared to the oceanic population. These two phenotypes segregate independently in an F 2 mapping cross. Using Sbf I (B) or EcoR I (C), we mapped polymorphic RAD markers from RS (red) and BP (green) parental fish along the 21 stickleback linkage groups. The apparent size differences of the linkage groups between (B) and (C) reflect the fact that the EcoR I recognition sequence occurs more frequently than Sbf I. Red and green bars above the linkage groups are measures of lateral plate linkage in the F 2 progeny, indicating the number of tightly linked markers in the local region. (D) Sequence reads per barcoded F 2 individual used to create (C). Variable numbers of reads were obtained from each of the 96 individuals used in our analysis, reflecting different concentrations of starting DNA template. 68% of individuals had between 50 K and 150 K RAD tags sequenced (∼0.4–1.0× coverage of the ∼150 K tags present in the genome). Only 2 individuals had less than 10,000 reads (red). (E) A close-up of the boxed region from (C) showing recombination breakpoints in six informative low plate F 2 fish on LGIV. Black tick marks are 1 Mb apart in physical distance. (F) F 2 individuals were repooled in silico based on the pelvic structure phenotype (A, arrow). Linkage was determined as in (B, C), mapping the locus for a reduction in pelvic structure to the end of LGVII.

    Journal: PLoS ONE

    Article Title: Rapid SNP Discovery and Genetic Mapping Using Sequenced RAD Markers

    doi: 10.1371/journal.pone.0003376

    Figure Lengend Snippet: Sequenced RAD marker mapping. (A) A native saltwater stickleback population, Rabbit Slough (RS), have complete lateral plate armor (brackets) while these structures are absent in the derived, freshwater Bear Paw (BP) population. The freshwater fish also have a reduction in pelvic structure (arrow) compared to the oceanic population. These two phenotypes segregate independently in an F 2 mapping cross. Using Sbf I (B) or EcoR I (C), we mapped polymorphic RAD markers from RS (red) and BP (green) parental fish along the 21 stickleback linkage groups. The apparent size differences of the linkage groups between (B) and (C) reflect the fact that the EcoR I recognition sequence occurs more frequently than Sbf I. Red and green bars above the linkage groups are measures of lateral plate linkage in the F 2 progeny, indicating the number of tightly linked markers in the local region. (D) Sequence reads per barcoded F 2 individual used to create (C). Variable numbers of reads were obtained from each of the 96 individuals used in our analysis, reflecting different concentrations of starting DNA template. 68% of individuals had between 50 K and 150 K RAD tags sequenced (∼0.4–1.0× coverage of the ∼150 K tags present in the genome). Only 2 individuals had less than 10,000 reads (red). (E) A close-up of the boxed region from (C) showing recombination breakpoints in six informative low plate F 2 fish on LGIV. Black tick marks are 1 Mb apart in physical distance. (F) F 2 individuals were repooled in silico based on the pelvic structure phenotype (A, arrow). Linkage was determined as in (B, C), mapping the locus for a reduction in pelvic structure to the end of LGVII.

    Article Snippet: Isolation of RAD markers for Illumina sequencing Genomic DNA (0.1–1 µg; from either individual or pooled samples) was digested for 15 min at 37°C in a 50 µL reaction with 20 units (U) of EcoR I or Sbf I (New England Biolabs [NEB]).

    Techniques: Marker, Derivative Assay, Fluorescence In Situ Hybridization, Sequencing, In Silico

    Dendogram of the PFGE profiles of the B. cereus group isolates, using combined Not I and Sbf I restriction analysis. a +, growth; -, no growth. b S, strong, W, weak.

    Journal: BMC Microbiology

    Article Title: Characterization of the spore-forming Bacillus cereus sensu lato group and Clostridium perfringens bacteria isolated from the Australian dairy farm environment

    doi: 10.1186/s12866-015-0377-9

    Figure Lengend Snippet: Dendogram of the PFGE profiles of the B. cereus group isolates, using combined Not I and Sbf I restriction analysis. a +, growth; -, no growth. b S, strong, W, weak.

    Article Snippet: For PFGE analysis, DNA plugs were restricted using either Sbf I or Not I endonucleases (New England Biolabs, US).

    Techniques:

    Screening for sialidase activity from a hot spring metagenomic library. A , restriction fragment analysis of 12 randomly selected clones from the hot spring metagenomic library were isolated and digested with the rare-cutting endonuclease SbfI. Digested fosmids were separated overnight on a 1% agarose gel along with a λHindIII size marker and a linearized pSMART FOS empty vector control ( lane 14 ; contains one SbfI site). Each clone showed a unique banding pattern, with fragments whose combined sizes indicated the presence of an insert of at least 30–40 kb. B , E. coli cells harboring individual fosmid clones were assayed for sialidase activity with X-Neu5Ac incorporated into agar medium. A single positive clone forming a blue colony is denoted with an arrow. C , lysate from microcultures of E. coli cells harboring individual fosmid clones were assayed for sialidase activity with 4MU-α-Neu5Ac. A single positive clone is denoted with an arrow .

    Journal: The Journal of Biological Chemistry

    Article Title: Functional metagenomics identifies an exosialidase with an inverting catalytic mechanism that defines a new glycoside hydrolase family (GH156)

    doi: 10.1074/jbc.RA118.003302

    Figure Lengend Snippet: Screening for sialidase activity from a hot spring metagenomic library. A , restriction fragment analysis of 12 randomly selected clones from the hot spring metagenomic library were isolated and digested with the rare-cutting endonuclease SbfI. Digested fosmids were separated overnight on a 1% agarose gel along with a λHindIII size marker and a linearized pSMART FOS empty vector control ( lane 14 ; contains one SbfI site). Each clone showed a unique banding pattern, with fragments whose combined sizes indicated the presence of an insert of at least 30–40 kb. B , E. coli cells harboring individual fosmid clones were assayed for sialidase activity with X-Neu5Ac incorporated into agar medium. A single positive clone forming a blue colony is denoted with an arrow. C , lysate from microcultures of E. coli cells harboring individual fosmid clones were assayed for sialidase activity with 4MU-α-Neu5Ac. A single positive clone is denoted with an arrow .

    Article Snippet: Each fosmid was digested with SbfI (New England Biolabs), a unique restriction site in the pSMART FOS vector.

    Techniques: Activity Assay, Clone Assay, Isolation, Agarose Gel Electrophoresis, Marker, Plasmid Preparation