mme i  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    MmeI
    Description:
    MmeI 500 units
    Catalog Number:
    R0637L
    Price:
    277
    Size:
    500 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs mme i
    MmeI
    MmeI 500 units
    https://www.bioz.com/result/mme i/product/New England Biolabs
    Average 99 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    mme i - by Bioz Stars, 2019-09
    99/100 stars

    Images

    1) Product Images from "Distributed probing of chromatin structure in vivo reveals pervasive chromatin accessibility for expressed and non-expressed genes during tissue differentiation in C. elegans"

    Article Title: Distributed probing of chromatin structure in vivo reveals pervasive chromatin accessibility for expressed and non-expressed genes during tissue differentiation in C. elegans

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-11-465

    Schematic of DALEC . Brown and green represent priming regions for Solexa bridge amplification primers. Blue indicates the primer binding region for the Solexa sequencing reaction. TCCGAC is the Mme I recognition sequence and the sequence immediately upstream of it (black) is the variable region. The inset gives detailed information for linkers A and B.
    Figure Legend Snippet: Schematic of DALEC . Brown and green represent priming regions for Solexa bridge amplification primers. Blue indicates the primer binding region for the Solexa sequencing reaction. TCCGAC is the Mme I recognition sequence and the sequence immediately upstream of it (black) is the variable region. The inset gives detailed information for linkers A and B.

    Techniques Used: Amplification, Binding Assay, Sequencing

    Related Articles

    Diagnostic Assay:

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: After heat inactivation at 70°C for 10 min, 5 pmol S-adenosylmethionine (NEB) and 1 U MmeI enzyme (NEB) were added to the reaction followed by incubation at 37°C for 30 min. Another 3 U MmeI was added and the reaction was incubated for another 30 min. .. After heat inactivation at 70°C for 10 min, 5 pmol S-adenosylmethionine (NEB) and 1 U MmeI enzyme (NEB) were added to the reaction followed by incubation at 37°C for 30 min. Another 3 U MmeI was added and the reaction was incubated for another 30 min.

    Clone Assay:

    Article Title: Human neural crest cells display molecular and phenotypic hallmarks of stem cells
    Article Snippet: In brief, Nla III and MmeI restriction enzymes (New England Biolabs) were used for tag generation. .. After 3 h self-ligation, 10′ at 65°C and 2′ on ice, purified concatemers were subsequently cloned into pZERO-1 (Invitrogen).

    Article Title: Large-scale production of SAGE libraries from microdissected tissues, flow-sorted cells, and cell lines
    Article Snippet: The adapter–cDNA ligation products were digested with the type IIS tagging enzyme MmeI (NEB), releasing adapter-tag products with 2-nucleotide (nt) overhangs. .. Gel-purified scale-up PCR products were digested with the anchoring enzyme NlaIII, yielding tail-to-tail ligated ∼36-bp cDNA ditags with CATG overhangs.

    Article Title: Differences in Brain Transcriptomes of Closely Related Baikal Coregonid Species
    Article Snippet: The ligated fragments were then treated with MmeI restrictase (NEB) to produce tags; the two mixtures were pooled together, and the tags were ligated to each other to give ditags. .. The ditags were PCR amplified, adapters were removed by digestion with NlaIII and separated from ditags in a 12% polyacrylamide gel, and the purified ditags were ligated to form linear concatemers.

    Centrifugation:

    Article Title: Genome-Wide Survey of Pseudomonas aeruginosa PA14 Reveals a Role for the Glyoxylate Pathway and Extracellular Proteases in the Utilization of Mucin
    Article Snippet: Bacterial cells were harvested by centrifugation and frozen at −80°C. .. Genomic DNA was extracted from frozen cell pellets using a Wizard genomic DNA purification kit (Promega), cut with MmeI restriction enzyme (New England BioLabs), and treated with calf intestinal phosphatase (New England BioLabs).

    Amplification:

    Article Title: A paired-end sequencing strategy to map the complex landscape of transcription initiation
    Article Snippet: After Exo I (NEB) and Exo III (NEB) digestion to remove linear DNAs, rolling circle amplification (RCA) was performed to amplify the remaining circular DNAs. .. The RCA products were digested with MmeI (NEB) to generate a specific 93~95 bp band.

    Article Title: Genome-wide exonic small interference RNA-mediated gene silencing regulates sexual reproduction in the homothallic fungus Fusarium graminearum
    Article Snippet: The ligated products were reverse-transcribed into cDNA using an oligo (dT) primer (5′-CGAGCACAGAATTAATACGACTTTTTTTTTTTTTTTTTT-3′) by SuperScript III reverse transcriptase (Invitrogen) and amplified by PCR with a pair of cDNA primers (5´-GTTCAGAGTTCTACAGTCCGA-3′ and 5´-CGAGCACAGAATTAATACGACT-3′). .. The resulting product was digested with a MmeI (NEB, MA, USA) to obtain short fragments from the 5´ end of double-stranded cDNA.

    Article Title: miRNA–mRNA Conflux Regulating Immunity and Oxidative Stress Pathways in the Midgut of Blood-Fed Anopheles stephensi
    Article Snippet: The resulting cDNA was PCR amplified. .. The PCR amplified products were digested with Mme I (NEB, Evry, France) to generate equal sized products. .. A double stranded DNA was ligated to the MmeI digestion products using T4 DNA ligase.

    Article Title: Large-scale production of SAGE libraries from microdissected tissues, flow-sorted cells, and cell lines
    Article Snippet: The adapter–cDNA ligation products were digested with the type IIS tagging enzyme MmeI (NEB), releasing adapter-tag products with 2-nucleotide (nt) overhangs. .. The two adapter–tag fractions were then ligated to form ∼131-bp adapter–ditag–adapter products that served as template for scale-up PCR.

    Article Title: Inhibition of Rho Kinases Enhances the Degradation of Mutant Huntingtin
    Article Snippet: Human androgen receptor with 23Q (AR23Q) was amplified from human brain cDNA library by PCR using a set of primers BglII-AR-Fw (5′-AAAAGATCTATGGAAGTGCAGTTAGGGCT-3′) and SalI-AR-Rv (5′-AAAAAAGTCGACCTGGGTGTGGAAATAGATGG-3′), cleaved by BglII and SalI, and introduced into the BglII-SalI sites of the pEGFP-C1 vector (EGFP-AR23Q). .. These two fragments were digested by Mme I (New England Biolabs), gel-purified, and treated with T4 DNA ligase to connect them at their CAG repeat tracts.

    Article Title: Global analysis of the mammalian RNA degradome reveals widespread miRNA-dependent and miRNA-independent endonucleolytic cleavage
    Article Snippet: RNA was then reverse transcribed (SuperscriptIII, Invitrogen) using the primer (5′-CGAGCACAGAATTAATACGACT( )V-3′) and amplified by PCR (Phusion DNA Polymerase, Finnzymes) using the primers (5′-GTTCAGAGTTCTACAGTCCGAC-3′ and 5′-CGAGCACAGAATTAATACGAC-3′). .. PCR conditions were 7 cycles of 94°C for 30 s, 60°C for 20 s and 72°C for 3 min. Products were gel purified, cleaved with MmeI (New England Biolabs) and dephosphorylated (Shrimp alkaline phosphatase, New England Biolabs).

    Article Title: Comparative Analysis and Identification of miRNAs and Their Target Genes Responsive to Salt Stress in Diploid and Tetraploid Paulownia fortunei Seedlings
    Article Snippet: Briefly, poly (A) RNA was isolated and ligated to a 5′ RNA adapter containing a Mme I (NEB, Ipswich, MA, USA) recognition site. .. Briefly, poly (A) RNA was isolated and ligated to a 5′ RNA adapter containing a Mme I (NEB, Ipswich, MA, USA) recognition site.

    Article Title: Molecular Basis for Strain Variation in the Saccharomyces cerevisiae Adhesin Flo11p
    Article Snippet: PCR was carried out at 94°C for 4 min; 94°C for 1 min, 58°C for 1 min 30 s, and 72°C for 3 min for 25 cycles; and a final extension at 72°C for 10 min. .. The amplified product was digested with restriction enzymes MmeI and SfcI (New England Biolabs, MA). .. The gel-purified digested product was ligated with a linker having a universal primer site at the 5′ end (t 7, 5′ TAATACGACTCACTATAGGG 3′; GENEWIZ, North Brunswick, NJ).

    DNA Ligation:

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: After heat inactivation at 70°C for 10 min, 5 pmol S-adenosylmethionine (NEB) and 1 U MmeI enzyme (NEB) were added to the reaction followed by incubation at 37°C for 30 min. Another 3 U MmeI was added and the reaction was incubated for another 30 min. .. After heat inactivation at 70°C for 10 min, 5 pmol S-adenosylmethionine (NEB) and 1 U MmeI enzyme (NEB) were added to the reaction followed by incubation at 37°C for 30 min. Another 3 U MmeI was added and the reaction was incubated for another 30 min.

    Synthesized:

    Article Title: Genetic dissection of blood lipid traits by integrating genome-wide association study and gene expression profiling in a porcine model
    Article Snippet: In brief, mRNA was isolated from total RNA with the magnetic oligo (dT) beads (invitrogen, USA). .. Using the mRNA attached to the bead as a template, double-stranded cDNA was synthesized with oligo-d (T) primers, and then digested with restriction enzymes Nla III and Mme I (New England Biolabs, UK). .. The digested-cDNA was ligated to Illumina specific adapters 1 and 2.

    Article Title: De novo Genome Assembly of the Fungal Plant Pathogen Pyrenophora semeniperda
    Article Snippet: RNA samples meeting sufficient quality and quantity criteria were pooled together for 1st strand synthesis and cDNA optimization. cDNA was synthesized from pooled RNA using the SMARTer™ PCR cDNA Synthesis Kit (ClonTech, Mountain View, CA) followed by PCR cycling of cDNA with the Advantage HF 2 PCR kit (ClonTech, Mountain View, CA). .. MmeI (New England BioLabs, Ipswitch, MA) was used for 5′ and 3′ modified SMART adaptor excision followed by removal of excised 5′ and 3′ adaptor ends using AMPure beads (Agencourt Bioscience Corporation, Beverly, MA) using manufacturer's recommended protocols.

    Construct:

    Article Title: Human neural crest cells display molecular and phenotypic hallmarks of stem cells
    Article Snippet: Standard protocols ( , ) were used to construct a LongSAGE library from 5 µg total RNA (RNeasy Mini, Qiagen) prepared from trunk-level hNCC of a C13 embryo after 7 passages. .. In brief, Nla III and MmeI restriction enzymes (New England Biolabs) were used for tag generation.

    Article Title: Comparative Analysis and Identification of miRNAs and Their Target Genes Responsive to Salt Stress in Diploid and Tetraploid Paulownia fortunei Seedlings
    Article Snippet: To predict genes that may be regulated by the miRNA in the PF2U, PF2S, PF4U, and PF4Splants, four degradome libraries suitable for miRNA target identification were constructed according to the protocol described previously [ , ]. .. Briefly, poly (A) RNA was isolated and ligated to a 5′ RNA adapter containing a Mme I (NEB, Ipswich, MA, USA) recognition site.

    SYBR Green Assay:

    Article Title: Quantification of gene transcripts with Deep Sequencing Analysis of Gene Expression (DSAGE) from 1-2μg total RNA
    Article Snippet: We describe the use of a sequencing primer (Reagents and Solutions) that overlaps the common NlaIII site and reduces the required cycles needed for sequencing to 17. .. Trizol (Invitrogen, cat#15596-018) or RNeasy kit (Qiagen, cat#74104) Dynabeads mRNA DIRECT Kit (Invitrogen, cat#610-12) DynaMag-2 magnet (Invitrogen, cat#123-21D) SuperScript II Reverse Transcriptase (Invitrogen, cat#18064-022) Second-Strand Buffer (Invitrogen, cat#10812-014) E. coli DNA Polymerase I (Invitrogen, cat#18010025) E. coli DNA Ligase (Invitrogen, cat#18052019) E. coli Rnase H (Invitrogen, cat#18021071) NlaIII (New England Biolabs, cat#R0125L) MmeI (New England Biolabs, cat#R0637L) 100X BSA (New England Biolabs, cat#B9001S) T4 DNA Ligase (high concentration) (Invitrogen, cat#15224-041) Novex 20% TBE gels(Invitrogen, cat#EC6315BOX) Low Molecular Weight DNA ladder (New England Biolabs, cat#N3233S) SYBR Green I (Invitrogen, cat#S7563) Phenol:Chloroform (adjust to pH7.5-8) (Ambion, cat#AM9732) Spin-X Centrifuge Tube Filters (Corning, cat#8161) Glycogen (Roche, cat#10901393001) GlycoBlue (Ambion, cat#AM9515) Non-Stick RNase-free Microfuge Tubes, 1.5ml (Ambion, cat#12450 Non-Stick RNase-free Microfuge Tubes, 0.5ml (Ambion, cat#12350) Platinum Taq DNA polymerase (Invitrogen, cat#10966034) Qubit fluorometer (Invitrogen, cat# ) Quant-iT dsDNA HS Assay Kit (Invitrogen, cat# ) 2X Bind and Wash (BW) Buffer (Reagents and solutions) Buffer C (Reagents and Solutions) Buffer D (Reagents and Solutions) Buffer 4 (Reagents and Solutions) LoTE (Reagents and Solutions) MGB Buffer (Reagents and Solutions) Oligonucleotides (Reagents and Solutions) (Integrated DNA Technologies) .. Transfer 100μl of the oligo(dT) beads (Dynabeads) to a 1.5ml tube (non-stick tubes are used throughout the experiment).

    Incubation:

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: MmeI digestion : The ligation products are digested with 5 U MmeI (NEB) for 2 h. The cleaved DNA is resolved in 10% polyacrylamide gel, the resulting 50 bp fragment is cut out, isolated from the gel with QIAquick gel extraction kit (Qiagen) and resuspended in 50 μl of 10 mM Tris (pH 8). .. Removal of biotinylated products : The cleaned product is heated to 95°C, and 50 μl of streptavidin-coated magnetic beads were added (SPHERO™ Streptavidin Magnetic Particles from Spherotech, Inc., Libertyville, IL).

    Article Title: DNase-seq: a high-resolution technique for mapping active gene regulatory elements across the genome from mammalian cells
    Article Snippet: Bovine serum albumin (BSA) (100X, New England Biolabs) B & W buffer (2X; 10 mM Tris-Cl, pH 8.0, 1 mM EDTA, 2 M NaCl) CHEF disposable plug mold (Bio-Rad) Chloroform (J.T. .. Baker) DNA ladder (25 bp) (Invitrogen) DNA Polymerase Buffer (1X; 10 mM Tris-Cl, pH 8.0, 50 mM NaCl, 10 mM MgCl2 , 1 mM dithiothreitol) DNase I recombinant, RNase free (10 U/μL) and incubation Buffer (10X) (Roche Diagnostics) dNTP, 10 mM (Roche Diagnostics) Dynal Streptavidin beads (Invitrogen Dynal M-280) EDTA (50 mM, pH 8.0) Ethanol (70% and 100%) Ethidium bromide(10 mg/ml) Glycogen (20 mg/mL) (Roche Diagnostics) InCert low melt agarose (1%, melted in sterile 50 mM EDTA pH 8.0 and stored at 4 °C) (Lonza) LIDS Buffer (10 mM Tris-Cl, pH 8.0,1% Lauryl sulfate lithium salt (Sigma), 100 mM EDTA) MmeI (2 U/μL, New England Biolabs) NaOAc (3 M, pH 5.3) NaOH (0.15 M) NEB Buffer 2 (10X; New England Biolabs) NEB Buffer 4 (10X; New England Biolabs) Igepal CA-630 (Sigma) Phenol (Invitrogen) Phenol: chloroform: Isoamyl Alcohol (25:24:1, Invitrogen) Phosphatase alkaline, shrimp (SAP; 1 U/μL, Roche Diagnostics) Phosphate Buffered Saline without Mg2+ /Ca2+ (1X, pH 7.2, GIBCO) Phusion DNA Polymerase (2 U/μL, Finnzymes) and Phusion HF reaction Buffer (5X) RSB Buffer (10 mM Tris-Cl, pH 7.4, 10 mM NaCl, 3 mM MgCl2 ) S-adenosylmethionine (SAM; 500 μM, New England Biolabs) Spin-X filter (Fisher) T4 DNA Polymerase (New England Biolabs) TBE buffer (0.5X; 40 mM Tris-Cl, pH 8.3, 45 mM Boric Acid, 1 mM EDTA) TE Buffer (1X; 10 mM Tris-Cl, pH 8.0, 1 mM EDTA) Tris-HCl buffer (1X, pH8.0) T4 Ligase (5 U/μL) and ligation buffer (10X) (Roche Diagnostics) Trypan blue (Gibco) Ultrapure™ Agarose (Invitrogen) Ultrapure™ L.M.P. .. Agarose (Invitrogen) Yeast Chromosome PFG molecular weight marker (New England Biolabs)

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: The reaction was incubated at 98°C for 5 min, chilled on ice, added with 8.5 μl H2 O, 5 pmol dNTP and 5 U Klenow Fragment (3′ to 5′ exo-) enzyme (NEB), and further incubated at 37°C for 1 hr. .. After heat inactivation at 70°C for 10 min, 5 pmol S-adenosylmethionine (NEB) and 1 U MmeI enzyme (NEB) were added to the reaction followed by incubation at 37°C for 30 min. Another 3 U MmeI was added and the reaction was incubated for another 30 min. .. The reaction was terminated by adding 40 μg Proteinase K at 65°C for 20 min. Digested DNA was extracted and purified before loading to 12% native polyacrylamide TBE gel for size-selection.

    Article Title: Differences in Brain Transcriptomes of Closely Related Baikal Coregonid Species
    Article Snippet: The isolated RNA was incubated with magnetic beads (Dynabeads) and used to synthesize double-stranded cDNA according to a standard protocol. .. The ligated fragments were then treated with MmeI restrictase (NEB) to produce tags; the two mixtures were pooled together, and the tags were ligated to each other to give ditags.

    Introduce:

    Article Title: Genome-Wide Survey of Pseudomonas aeruginosa PA14 Reveals a Role for the Glyoxylate Pathway and Extracellular Proteases in the Utilization of Mucin
    Article Snippet: Genomic DNA was extracted from frozen cell pellets using a Wizard genomic DNA purification kit (Promega), cut with MmeI restriction enzyme (New England BioLabs), and treated with calf intestinal phosphatase (New England BioLabs). .. PCR was then performed using ligation reactions as the template with primers specific for the inverted repeat region on the transposon and the ligated adapter (P1_M6_MmeI and Gex_PCR_Primer, respectively).

    Expressing:

    Article Title: Genetic dissection of blood lipid traits by integrating genome-wide association study and gene expression profiling in a porcine model
    Article Snippet: Digital gene expression (DGE) analyses of genome-wide transcripts were performed on 497 F2 liver samples as described previously [ ]. .. Using the mRNA attached to the bead as a template, double-stranded cDNA was synthesized with oligo-d (T) primers, and then digested with restriction enzymes Nla III and Mme I (New England Biolabs, UK).

    Article Title: Differences in Brain Transcriptomes of Closely Related Baikal Coregonid Species
    Article Snippet: Paragraph title: 2.5. Serial Analysis of Gene Expression ... The ligated fragments were then treated with MmeI restrictase (NEB) to produce tags; the two mixtures were pooled together, and the tags were ligated to each other to give ditags.

    Genome Wide:

    Article Title: Genetic dissection of blood lipid traits by integrating genome-wide association study and gene expression profiling in a porcine model
    Article Snippet: Digital gene expression (DGE) analyses of genome-wide transcripts were performed on 497 F2 liver samples as described previously [ ]. .. Using the mRNA attached to the bead as a template, double-stranded cDNA was synthesized with oligo-d (T) primers, and then digested with restriction enzymes Nla III and Mme I (New England Biolabs, UK).

    Modification:

    Article Title: De novo Genome Assembly of the Fungal Plant Pathogen Pyrenophora semeniperda
    Article Snippet: Normalization of cDNA was accomplished with the Axxora Trimmer cDNA Normalization kit (AxxOra, San Diego, CA). .. MmeI (New England BioLabs, Ipswitch, MA) was used for 5′ and 3′ modified SMART adaptor excision followed by removal of excised 5′ and 3′ adaptor ends using AMPure beads (Agencourt Bioscience Corporation, Beverly, MA) using manufacturer's recommended protocols. .. In total, a half plate of a whole genome library, a full plate of a 3-kb paired end library, and a half plate of normalized cDNA were sequenced using the 454 Life Sciences Genome Sequencer using FLX Titanium series reagents (454 Life Sciences, Bradford, CT).

    Flow Cytometry:

    Article Title: Genome-Wide Survey of Pseudomonas aeruginosa PA14 Reveals a Role for the Glyoxylate Pathway and Extracellular Proteases in the Utilization of Mucin
    Article Snippet: Genomic DNA was extracted from frozen cell pellets using a Wizard genomic DNA purification kit (Promega), cut with MmeI restriction enzyme (New England BioLabs), and treated with calf intestinal phosphatase (New England BioLabs). .. PCR was then performed using ligation reactions as the template with primers specific for the inverted repeat region on the transposon and the ligated adapter (P1_M6_MmeI and Gex_PCR_Primer, respectively).

    Sequencing:

    Article Title: Human neural crest cells display molecular and phenotypic hallmarks of stem cells
    Article Snippet: In brief, Nla III and MmeI restriction enzymes (New England Biolabs) were used for tag generation. .. In brief, Nla III and MmeI restriction enzymes (New England Biolabs) were used for tag generation.

    Article Title: A paired-end sequencing strategy to map the complex landscape of transcription initiation
    Article Snippet: The RCA products were digested with MmeI (NEB) to generate a specific 93~95 bp band. .. The desired product was ligated with two Illumina Paired-End adaptors and amplified with low-cycle PCR.

    Article Title: Genome-wide exonic small interference RNA-mediated gene silencing regulates sexual reproduction in the homothallic fungus Fusarium graminearum
    Article Snippet: Paragraph title: Deep sequencing of transcriptome, sRNAs, and degradome ... The resulting product was digested with a MmeI (NEB, MA, USA) to obtain short fragments from the 5´ end of double-stranded cDNA.

    Article Title: miRNA–mRNA Conflux Regulating Immunity and Oxidative Stress Pathways in the Midgut of Blood-Fed Anopheles stephensi
    Article Snippet: Paragraph title: 5.10. Degradome Sequencing for Identification of Cleaved miRNA Targets ... The PCR amplified products were digested with Mme I (NEB, Evry, France) to generate equal sized products.

    Article Title: Inhibition of Rho Kinases Enhances the Degradation of Mutant Huntingtin
    Article Snippet: A primer set, BglII-AR-Fw and MmeI-AR-exp-Rv (CATCCTCACCCTGCTGCTGCTCCAACTGCCTGGGG) was used to amplify the 5′-coding sequence including the CAG repeat tract. .. These two fragments were digested by Mme I (New England Biolabs), gel-purified, and treated with T4 DNA ligase to connect them at their CAG repeat tracts.

    Article Title: Genome-Wide Survey of Pseudomonas aeruginosa PA14 Reveals a Role for the Glyoxylate Pathway and Extracellular Proteases in the Utilization of Mucin
    Article Snippet: Genomic DNA was extracted from frozen cell pellets using a Wizard genomic DNA purification kit (Promega), cut with MmeI restriction enzyme (New England BioLabs), and treated with calf intestinal phosphatase (New England BioLabs). .. Oligonucleotide adapters (see Table S1 in the supplemental material) with a 3′-NN overhang containing appropriate sequences for Illumina sequencing were ligated to the resulting fragments using T4 ligase (New England BioLabs).

    Article Title: Global analysis of the mammalian RNA degradome reveals widespread miRNA-dependent and miRNA-independent endonucleolytic cleavage
    Article Snippet: PCR conditions were 7 cycles of 94°C for 30 s, 60°C for 20 s and 72°C for 3 min. Products were gel purified, cleaved with MmeI (New England Biolabs) and dephosphorylated (Shrimp alkaline phosphatase, New England Biolabs). .. PCR conditions were 7 cycles of 94°C for 30 s, 60°C for 20 s and 72°C for 3 min. Products were gel purified, cleaved with MmeI (New England Biolabs) and dephosphorylated (Shrimp alkaline phosphatase, New England Biolabs).

    Article Title: Comparative Analysis and Identification of miRNAs and Their Target Genes Responsive to Salt Stress in Diploid and Tetraploid Paulownia fortunei Seedlings
    Article Snippet: Paragraph title: Identification of miRNA target genes by degradome sequencing ... Briefly, poly (A) RNA was isolated and ligated to a 5′ RNA adapter containing a Mme I (NEB, Ipswich, MA, USA) recognition site.

    Article Title: Molecular Basis for Strain Variation in the Saccharomyces cerevisiae Adhesin Flo11p
    Article Snippet: Paragraph title: PCR amplification of the sequencing product. ... The amplified product was digested with restriction enzymes MmeI and SfcI (New England Biolabs, MA).

    Article Title: Generating high accuracy peptide binding data in high throughput with yeast surface display and SORTCERY
    Article Snippet: Paragraph title: 2.3 Deep Sequencing Sample Preparation (see ) ... Zymoprep Yeast Plasmid Miniprep I (Zymo Research) Isopropanole High-Fidelity DNA Polymerase (e.g. Phusion) Thermocycler Gel equipment PCR purification and gel extraction kits (QiaGen) MmeI (New England Biolabs): MmeI restriction enzyme, NEB Cut Smart Buffer, 1 mM SAM T4 Ligase Primers and oligos

    Article Title: Differences in Brain Transcriptomes of Closely Related Baikal Coregonid Species
    Article Snippet: The ligated fragments were then treated with MmeI restrictase (NEB) to produce tags; the two mixtures were pooled together, and the tags were ligated to each other to give ditags. .. Independent recombinant clones were used to generate clone libraries arrayed in 96-well plates.

    Ligation:

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: The ligation products are purified to remove the T4 ligase and buffer with QIAquick nucleotide removal column and eluted in 55 μl of 10 mM Tris (pH 8). .. MmeI digestion : The ligation products are digested with 5 U MmeI (NEB) for 2 h. The cleaved DNA is resolved in 10% polyacrylamide gel, the resulting 50 bp fragment is cut out, isolated from the gel with QIAquick gel extraction kit (Qiagen) and resuspended in 50 μl of 10 mM Tris (pH 8). .. Blocking of MmeI-tagged primers : 25 μl Of the fragment is used as primer with 10 μl Driver bio-dsDNA template in the presence of 2.5 mM each ddNTPs-bio (Biotin-11-ddNTPs, NEN® Life Science Products Inc., Boston, MA), 0.025 mM each dNTPs (Roche) and Thermo Sequenase™ (Amersham Pharmacia Biotech, Inc., Piscataway, NJ).

    Article Title: Large-scale production of SAGE libraries from microdissected tissues, flow-sorted cells, and cell lines
    Article Snippet: The resulting bead-bound cDNA was digested with the tagging enzyme NlaIII (Invitrogen), and the product was divided into two fractions for separate ligation of two adapters with 4-bp overhangs complementary to NlaIII digestion products. .. The adapter–cDNA ligation products were digested with the type IIS tagging enzyme MmeI (NEB), releasing adapter-tag products with 2-nucleotide (nt) overhangs. .. The two adapter–tag fractions were then ligated to form ∼131-bp adapter–ditag–adapter products that served as template for scale-up PCR.

    Article Title: Genome-Wide Survey of Pseudomonas aeruginosa PA14 Reveals a Role for the Glyoxylate Pathway and Extracellular Proteases in the Utilization of Mucin
    Article Snippet: Genomic DNA was extracted from frozen cell pellets using a Wizard genomic DNA purification kit (Promega), cut with MmeI restriction enzyme (New England BioLabs), and treated with calf intestinal phosphatase (New England BioLabs). .. Adapters were barcoded with a unique 4-bp sequence to enable multiplexing.

    Article Title: DNase-seq: a high-resolution technique for mapping active gene regulatory elements across the genome from mammalian cells
    Article Snippet: Bovine serum albumin (BSA) (100X, New England Biolabs) B & W buffer (2X; 10 mM Tris-Cl, pH 8.0, 1 mM EDTA, 2 M NaCl) CHEF disposable plug mold (Bio-Rad) Chloroform (J.T. .. Baker) DNA ladder (25 bp) (Invitrogen) DNA Polymerase Buffer (1X; 10 mM Tris-Cl, pH 8.0, 50 mM NaCl, 10 mM MgCl2 , 1 mM dithiothreitol) DNase I recombinant, RNase free (10 U/μL) and incubation Buffer (10X) (Roche Diagnostics) dNTP, 10 mM (Roche Diagnostics) Dynal Streptavidin beads (Invitrogen Dynal M-280) EDTA (50 mM, pH 8.0) Ethanol (70% and 100%) Ethidium bromide(10 mg/ml) Glycogen (20 mg/mL) (Roche Diagnostics) InCert low melt agarose (1%, melted in sterile 50 mM EDTA pH 8.0 and stored at 4 °C) (Lonza) LIDS Buffer (10 mM Tris-Cl, pH 8.0,1% Lauryl sulfate lithium salt (Sigma), 100 mM EDTA) MmeI (2 U/μL, New England Biolabs) NaOAc (3 M, pH 5.3) NaOH (0.15 M) NEB Buffer 2 (10X; New England Biolabs) NEB Buffer 4 (10X; New England Biolabs) Igepal CA-630 (Sigma) Phenol (Invitrogen) Phenol: chloroform: Isoamyl Alcohol (25:24:1, Invitrogen) Phosphatase alkaline, shrimp (SAP; 1 U/μL, Roche Diagnostics) Phosphate Buffered Saline without Mg2+ /Ca2+ (1X, pH 7.2, GIBCO) Phusion DNA Polymerase (2 U/μL, Finnzymes) and Phusion HF reaction Buffer (5X) RSB Buffer (10 mM Tris-Cl, pH 7.4, 10 mM NaCl, 3 mM MgCl2 ) S-adenosylmethionine (SAM; 500 μM, New England Biolabs) Spin-X filter (Fisher) T4 DNA Polymerase (New England Biolabs) TBE buffer (0.5X; 40 mM Tris-Cl, pH 8.3, 45 mM Boric Acid, 1 mM EDTA) TE Buffer (1X; 10 mM Tris-Cl, pH 8.0, 1 mM EDTA) Tris-HCl buffer (1X, pH8.0) T4 Ligase (5 U/μL) and ligation buffer (10X) (Roche Diagnostics) Trypan blue (Gibco) Ultrapure™ Agarose (Invitrogen) Ultrapure™ L.M.P. .. Agarose (Invitrogen) Yeast Chromosome PFG molecular weight marker (New England Biolabs)

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: After heat inactivation at 70°C for 10 min, 5 pmol S-adenosylmethionine (NEB) and 1 U MmeI enzyme (NEB) were added to the reaction followed by incubation at 37°C for 30 min. Another 3 U MmeI was added and the reaction was incubated for another 30 min. .. After heat inactivation at 70°C for 10 min, 5 pmol S-adenosylmethionine (NEB) and 1 U MmeI enzyme (NEB) were added to the reaction followed by incubation at 37°C for 30 min. Another 3 U MmeI was added and the reaction was incubated for another 30 min.

    Cell Culture:

    Article Title: Identification of the Tetraspanin CD82 as a New Barrier to Xenotransplantation
    Article Snippet: PMA, DMSO, dibutyryl cAMP, MTT, cell culture reagents, protease inhibitors, and other analytical-grade reagents were purchased from Sigma-Aldrich. .. Restriction enzymes NlaIII, MmeI, and Sph were purchased from New England Biolabs (Beverly, MA).

    DNA Sequencing:

    Article Title: Molecular Basis for Strain Variation in the Saccharomyces cerevisiae Adhesin Flo11p
    Article Snippet: PCR primers were designed on the basis of the strain S288C FLO11 DNA sequence and amplified for DNA sequencing. .. The amplified product was digested with restriction enzymes MmeI and SfcI (New England Biolabs, MA).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Human neural crest cells display molecular and phenotypic hallmarks of stem cells
    Article Snippet: Paragraph title: Sage library construction and RT–PCR ... In brief, Nla III and MmeI restriction enzymes (New England Biolabs) were used for tag generation.

    Affinity Purification:

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: Isolated DNA was mixed with 300 μg of Streptavidin-conjugated magnetic beads that had been washed with B & W Buffer for biotin affinity purification. .. After heat inactivation at 70°C for 10 min, 5 pmol S-adenosylmethionine (NEB) and 1 U MmeI enzyme (NEB) were added to the reaction followed by incubation at 37°C for 30 min. Another 3 U MmeI was added and the reaction was incubated for another 30 min.

    Recombinant:

    Article Title: DNase-seq: a high-resolution technique for mapping active gene regulatory elements across the genome from mammalian cells
    Article Snippet: Bovine serum albumin (BSA) (100X, New England Biolabs) B & W buffer (2X; 10 mM Tris-Cl, pH 8.0, 1 mM EDTA, 2 M NaCl) CHEF disposable plug mold (Bio-Rad) Chloroform (J.T. .. Baker) DNA ladder (25 bp) (Invitrogen) DNA Polymerase Buffer (1X; 10 mM Tris-Cl, pH 8.0, 50 mM NaCl, 10 mM MgCl2 , 1 mM dithiothreitol) DNase I recombinant, RNase free (10 U/μL) and incubation Buffer (10X) (Roche Diagnostics) dNTP, 10 mM (Roche Diagnostics) Dynal Streptavidin beads (Invitrogen Dynal M-280) EDTA (50 mM, pH 8.0) Ethanol (70% and 100%) Ethidium bromide(10 mg/ml) Glycogen (20 mg/mL) (Roche Diagnostics) InCert low melt agarose (1%, melted in sterile 50 mM EDTA pH 8.0 and stored at 4 °C) (Lonza) LIDS Buffer (10 mM Tris-Cl, pH 8.0,1% Lauryl sulfate lithium salt (Sigma), 100 mM EDTA) MmeI (2 U/μL, New England Biolabs) NaOAc (3 M, pH 5.3) NaOH (0.15 M) NEB Buffer 2 (10X; New England Biolabs) NEB Buffer 4 (10X; New England Biolabs) Igepal CA-630 (Sigma) Phenol (Invitrogen) Phenol: chloroform: Isoamyl Alcohol (25:24:1, Invitrogen) Phosphatase alkaline, shrimp (SAP; 1 U/μL, Roche Diagnostics) Phosphate Buffered Saline without Mg2+ /Ca2+ (1X, pH 7.2, GIBCO) Phusion DNA Polymerase (2 U/μL, Finnzymes) and Phusion HF reaction Buffer (5X) RSB Buffer (10 mM Tris-Cl, pH 7.4, 10 mM NaCl, 3 mM MgCl2 ) S-adenosylmethionine (SAM; 500 μM, New England Biolabs) Spin-X filter (Fisher) T4 DNA Polymerase (New England Biolabs) TBE buffer (0.5X; 40 mM Tris-Cl, pH 8.3, 45 mM Boric Acid, 1 mM EDTA) TE Buffer (1X; 10 mM Tris-Cl, pH 8.0, 1 mM EDTA) Tris-HCl buffer (1X, pH8.0) T4 Ligase (5 U/μL) and ligation buffer (10X) (Roche Diagnostics) Trypan blue (Gibco) Ultrapure™ Agarose (Invitrogen) Ultrapure™ L.M.P. .. Agarose (Invitrogen) Yeast Chromosome PFG molecular weight marker (New England Biolabs)

    Article Title: Differences in Brain Transcriptomes of Closely Related Baikal Coregonid Species
    Article Snippet: The ligated fragments were then treated with MmeI restrictase (NEB) to produce tags; the two mixtures were pooled together, and the tags were ligated to each other to give ditags. .. The obtained concatemers, containing abundant representative cDNA fragments, were ligated into the pZErO-1 vector (Invitrogen) and cloned into E. coli cells.

    Cellular Antioxidant Activity Assay:

    Article Title: De novo Genome Assembly of the Fungal Plant Pathogen Pyrenophora semeniperda
    Article Snippet: Modified oligo primers were used to allow for MmeI digestion for 5′ and 3′ adaptor excision: 5′ Smart Oligo [5′-AAG CAG TGG TAA CAA CGC ATC CGA CGC rGrGrG-3′]; 3′ Oligo dT SmartIIA [5′-AAG CAG TGG TAA CAA CGC ATC CGA CTT TTT TTT TTT TTT TTT TTT TTV N-3′]; New SmartIIA [5′-AAG CAG TGG TAA CAA CGC ATC CGA C-3′] (Sandra Clifton, Personal Communication, Washington University). .. MmeI (New England BioLabs, Ipswitch, MA) was used for 5′ and 3′ modified SMART adaptor excision followed by removal of excised 5′ and 3′ adaptor ends using AMPure beads (Agencourt Bioscience Corporation, Beverly, MA) using manufacturer's recommended protocols.

    Molecular Weight:

    Article Title: Quantification of gene transcripts with Deep Sequencing Analysis of Gene Expression (DSAGE) from 1-2μg total RNA
    Article Snippet: We describe the use of a sequencing primer (Reagents and Solutions) that overlaps the common NlaIII site and reduces the required cycles needed for sequencing to 17. .. Trizol (Invitrogen, cat#15596-018) or RNeasy kit (Qiagen, cat#74104) Dynabeads mRNA DIRECT Kit (Invitrogen, cat#610-12) DynaMag-2 magnet (Invitrogen, cat#123-21D) SuperScript II Reverse Transcriptase (Invitrogen, cat#18064-022) Second-Strand Buffer (Invitrogen, cat#10812-014) E. coli DNA Polymerase I (Invitrogen, cat#18010025) E. coli DNA Ligase (Invitrogen, cat#18052019) E. coli Rnase H (Invitrogen, cat#18021071) NlaIII (New England Biolabs, cat#R0125L) MmeI (New England Biolabs, cat#R0637L) 100X BSA (New England Biolabs, cat#B9001S) T4 DNA Ligase (high concentration) (Invitrogen, cat#15224-041) Novex 20% TBE gels(Invitrogen, cat#EC6315BOX) Low Molecular Weight DNA ladder (New England Biolabs, cat#N3233S) SYBR Green I (Invitrogen, cat#S7563) Phenol:Chloroform (adjust to pH7.5-8) (Ambion, cat#AM9732) Spin-X Centrifuge Tube Filters (Corning, cat#8161) Glycogen (Roche, cat#10901393001) GlycoBlue (Ambion, cat#AM9515) Non-Stick RNase-free Microfuge Tubes, 1.5ml (Ambion, cat#12450 Non-Stick RNase-free Microfuge Tubes, 0.5ml (Ambion, cat#12350) Platinum Taq DNA polymerase (Invitrogen, cat#10966034) Qubit fluorometer (Invitrogen, cat# ) Quant-iT dsDNA HS Assay Kit (Invitrogen, cat# ) 2X Bind and Wash (BW) Buffer (Reagents and solutions) Buffer C (Reagents and Solutions) Buffer D (Reagents and Solutions) Buffer 4 (Reagents and Solutions) LoTE (Reagents and Solutions) MGB Buffer (Reagents and Solutions) Oligonucleotides (Reagents and Solutions) (Integrated DNA Technologies) .. Transfer 100μl of the oligo(dT) beads (Dynabeads) to a 1.5ml tube (non-stick tubes are used throughout the experiment).

    Multiplexing:

    Article Title: Genome-Wide Survey of Pseudomonas aeruginosa PA14 Reveals a Role for the Glyoxylate Pathway and Extracellular Proteases in the Utilization of Mucin
    Article Snippet: Genomic DNA was extracted from frozen cell pellets using a Wizard genomic DNA purification kit (Promega), cut with MmeI restriction enzyme (New England BioLabs), and treated with calf intestinal phosphatase (New England BioLabs). .. Oligonucleotide adapters (see Table S1 in the supplemental material) with a 3′-NN overhang containing appropriate sequences for Illumina sequencing were ligated to the resulting fragments using T4 ligase (New England BioLabs).

    Nucleic Acid Electrophoresis:

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: After heat inactivation at 70°C for 10 min, 5 pmol S-adenosylmethionine (NEB) and 1 U MmeI enzyme (NEB) were added to the reaction followed by incubation at 37°C for 30 min. Another 3 U MmeI was added and the reaction was incubated for another 30 min. .. The reaction was terminated by adding 40 μg Proteinase K at 65°C for 20 min. Digested DNA was extracted and purified before loading to 12% native polyacrylamide TBE gel for size-selection.

    Magnetic Beads:

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: MmeI digestion : The ligation products are digested with 5 U MmeI (NEB) for 2 h. The cleaved DNA is resolved in 10% polyacrylamide gel, the resulting 50 bp fragment is cut out, isolated from the gel with QIAquick gel extraction kit (Qiagen) and resuspended in 50 μl of 10 mM Tris (pH 8). .. The product is purified with QIAquick nucleotide removal kit to remove the excess ddNTPs and eluted in 100 μl of 10 mM Tris (pH 8).

    Article Title: Large-scale production of SAGE libraries from microdissected tissues, flow-sorted cells, and cell lines
    Article Snippet: Construction of “standard” libraries initially required 2–50 μg of DNase-treated total RNA. mRNA was captured using oligo(dT) magnetic beads followed by synthesis of double-stranded cDNA using SuperScript II reverse transcriptase (Invitrogen), RNAseH, and Escherichia coli DNA polymerase (Invitrogen). .. The adapter–cDNA ligation products were digested with the type IIS tagging enzyme MmeI (NEB), releasing adapter-tag products with 2-nucleotide (nt) overhangs.

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: Isolated DNA was mixed with 300 μg of Streptavidin-conjugated magnetic beads that had been washed with B & W Buffer for biotin affinity purification. .. After heat inactivation at 70°C for 10 min, 5 pmol S-adenosylmethionine (NEB) and 1 U MmeI enzyme (NEB) were added to the reaction followed by incubation at 37°C for 30 min. Another 3 U MmeI was added and the reaction was incubated for another 30 min.

    Article Title: Differences in Brain Transcriptomes of Closely Related Baikal Coregonid Species
    Article Snippet: The isolated RNA was incubated with magnetic beads (Dynabeads) and used to synthesize double-stranded cDNA according to a standard protocol. .. The ligated fragments were then treated with MmeI restrictase (NEB) to produce tags; the two mixtures were pooled together, and the tags were ligated to each other to give ditags.

    Isolation:

    Article Title: Genetic dissection of blood lipid traits by integrating genome-wide association study and gene expression profiling in a porcine model
    Article Snippet: In brief, mRNA was isolated from total RNA with the magnetic oligo (dT) beads (invitrogen, USA). .. Using the mRNA attached to the bead as a template, double-stranded cDNA was synthesized with oligo-d (T) primers, and then digested with restriction enzymes Nla III and Mme I (New England Biolabs, UK).

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: The ligation products are purified to remove the T4 ligase and buffer with QIAquick nucleotide removal column and eluted in 55 μl of 10 mM Tris (pH 8). .. MmeI digestion : The ligation products are digested with 5 U MmeI (NEB) for 2 h. The cleaved DNA is resolved in 10% polyacrylamide gel, the resulting 50 bp fragment is cut out, isolated from the gel with QIAquick gel extraction kit (Qiagen) and resuspended in 50 μl of 10 mM Tris (pH 8). .. Blocking of MmeI-tagged primers : 25 μl Of the fragment is used as primer with 10 μl Driver bio-dsDNA template in the presence of 2.5 mM each ddNTPs-bio (Biotin-11-ddNTPs, NEN® Life Science Products Inc., Boston, MA), 0.025 mM each dNTPs (Roche) and Thermo Sequenase™ (Amersham Pharmacia Biotech, Inc., Piscataway, NJ).

    Article Title: Genome-wide exonic small interference RNA-mediated gene silencing regulates sexual reproduction in the homothallic fungus Fusarium graminearum
    Article Snippet: Poly (A)+ RNA was isolated using the NucleoTraP® mRNA purification kits (Machery-Nagel, Düren, Germany) according to the manufacturer’s instructions. .. The resulting product was digested with a MmeI (NEB, MA, USA) to obtain short fragments from the 5´ end of double-stranded cDNA.

    Article Title: Global analysis of the mammalian RNA degradome reveals widespread miRNA-dependent and miRNA-independent endonucleolytic cleavage
    Article Snippet: Polyadenylated RNA was isolated from 200 µg total RNA (from adult mouse brain, liver or lung) using oligo(dT) dynabeads (Invitrogen) and an RNA adaptor (5′-GUUCAGAGUUCUACAGUCCGAC-3′) ligated using T4 RNA ligase (Ambion). .. PCR conditions were 7 cycles of 94°C for 30 s, 60°C for 20 s and 72°C for 3 min. Products were gel purified, cleaved with MmeI (New England Biolabs) and dephosphorylated (Shrimp alkaline phosphatase, New England Biolabs).

    Article Title: Comparative Analysis and Identification of miRNAs and Their Target Genes Responsive to Salt Stress in Diploid and Tetraploid Paulownia fortunei Seedlings
    Article Snippet: To predict genes that may be regulated by the miRNA in the PF2U, PF2S, PF4U, and PF4Splants, four degradome libraries suitable for miRNA target identification were constructed according to the protocol described previously [ , ]. .. Briefly, poly (A) RNA was isolated and ligated to a 5′ RNA adapter containing a Mme I (NEB, Ipswich, MA, USA) recognition site. .. After reverse transcription using oligo(dT) and PCR enrichment, the PCR products were purified and digested with Mme I.

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: Isolated DNA was mixed with 300 μg of Streptavidin-conjugated magnetic beads that had been washed with B & W Buffer for biotin affinity purification. .. After heat inactivation at 70°C for 10 min, 5 pmol S-adenosylmethionine (NEB) and 1 U MmeI enzyme (NEB) were added to the reaction followed by incubation at 37°C for 30 min. Another 3 U MmeI was added and the reaction was incubated for another 30 min.

    Article Title: Differences in Brain Transcriptomes of Closely Related Baikal Coregonid Species
    Article Snippet: The isolated RNA was incubated with magnetic beads (Dynabeads) and used to synthesize double-stranded cDNA according to a standard protocol. .. The ligated fragments were then treated with MmeI restrictase (NEB) to produce tags; the two mixtures were pooled together, and the tags were ligated to each other to give ditags.

    Purification:

    Article Title: Genetic dissection of blood lipid traits by integrating genome-wide association study and gene expression profiling in a porcine model
    Article Snippet: Using the mRNA attached to the bead as a template, double-stranded cDNA was synthesized with oligo-d (T) primers, and then digested with restriction enzymes Nla III and Mme I (New England Biolabs, UK). .. Using the mRNA attached to the bead as a template, double-stranded cDNA was synthesized with oligo-d (T) primers, and then digested with restriction enzymes Nla III and Mme I (New England Biolabs, UK).

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: The ligation products are purified to remove the T4 ligase and buffer with QIAquick nucleotide removal column and eluted in 55 μl of 10 mM Tris (pH 8). .. MmeI digestion : The ligation products are digested with 5 U MmeI (NEB) for 2 h. The cleaved DNA is resolved in 10% polyacrylamide gel, the resulting 50 bp fragment is cut out, isolated from the gel with QIAquick gel extraction kit (Qiagen) and resuspended in 50 μl of 10 mM Tris (pH 8).

    Article Title: A paired-end sequencing strategy to map the complex landscape of transcription initiation
    Article Snippet: First strand cDNAs were amplified using 5 cycles of PCR, and the products were purified with DNA clean & concentrator-5 kit (ZYMO). .. The RCA products were digested with MmeI (NEB) to generate a specific 93~95 bp band.

    Article Title: Genome-wide exonic small interference RNA-mediated gene silencing regulates sexual reproduction in the homothallic fungus Fusarium graminearum
    Article Snippet: Poly (A)+ RNA was isolated using the NucleoTraP® mRNA purification kits (Machery-Nagel, Düren, Germany) according to the manufacturer’s instructions. .. The resulting product was digested with a MmeI (NEB, MA, USA) to obtain short fragments from the 5´ end of double-stranded cDNA.

    Article Title: miRNA–mRNA Conflux Regulating Immunity and Oxidative Stress Pathways in the Midgut of Blood-Fed Anopheles stephensi
    Article Snippet: The PCR amplified products were digested with Mme I (NEB, Evry, France) to generate equal sized products. .. The PCR amplified products were digested with Mme I (NEB, Evry, France) to generate equal sized products.

    Article Title: Global analysis of the mammalian RNA degradome reveals widespread miRNA-dependent and miRNA-independent endonucleolytic cleavage
    Article Snippet: RNA was then reverse transcribed (SuperscriptIII, Invitrogen) using the primer (5′-CGAGCACAGAATTAATACGACT( )V-3′) and amplified by PCR (Phusion DNA Polymerase, Finnzymes) using the primers (5′-GTTCAGAGTTCTACAGTCCGAC-3′ and 5′-CGAGCACAGAATTAATACGAC-3′). .. PCR conditions were 7 cycles of 94°C for 30 s, 60°C for 20 s and 72°C for 3 min. Products were gel purified, cleaved with MmeI (New England Biolabs) and dephosphorylated (Shrimp alkaline phosphatase, New England Biolabs). .. Samples were run on a 12% polyacrylamide gel and a 42 nt band excised.

    Article Title: Comparative Analysis and Identification of miRNAs and Their Target Genes Responsive to Salt Stress in Diploid and Tetraploid Paulownia fortunei Seedlings
    Article Snippet: Briefly, poly (A) RNA was isolated and ligated to a 5′ RNA adapter containing a Mme I (NEB, Ipswich, MA, USA) recognition site. .. Briefly, poly (A) RNA was isolated and ligated to a 5′ RNA adapter containing a Mme I (NEB, Ipswich, MA, USA) recognition site.

    Article Title: Molecular Basis for Strain Variation in the Saccharomyces cerevisiae Adhesin Flo11p
    Article Snippet: The amplified product was digested with restriction enzymes MmeI and SfcI (New England Biolabs, MA). .. The amplified product was digested with restriction enzymes MmeI and SfcI (New England Biolabs, MA).

    Article Title: Generating high accuracy peptide binding data in high throughput with yeast surface display and SORTCERY
    Article Snippet: Low protein binding 0.45 µm filter plates or bottle-top filters BSS pH 8.0: 50 mM Tris, 100 mM NaCl, 1 mg/ml BSA Primary antibody mixture: anti-HA (Roche) 1:100 dilution and anti-Myc (Sigma) 1:100 dilution in BSS Secondary antibody mixture: APC-labeled anti-mouse (BD Biosciences) 1:40 dilution and PE-labeled anti-rabbit (Sigma) 1:100 dilution in BSS .. Zymoprep Yeast Plasmid Miniprep I (Zymo Research) Isopropanole High-Fidelity DNA Polymerase (e.g. Phusion) Thermocycler Gel equipment PCR purification and gel extraction kits (QiaGen) MmeI (New England Biolabs): MmeI restriction enzyme, NEB Cut Smart Buffer, 1 mM SAM T4 Ligase Primers and oligos .. Dilute cells to OD600 of 0.05 in SD + CAA and grow for 8 h at 30 °C.

    Polymerase Chain Reaction:

    Article Title: Genetic dissection of blood lipid traits by integrating genome-wide association study and gene expression profiling in a porcine model
    Article Snippet: Using the mRNA attached to the bead as a template, double-stranded cDNA was synthesized with oligo-d (T) primers, and then digested with restriction enzymes Nla III and Mme I (New England Biolabs, UK). .. Using the mRNA attached to the bead as a template, double-stranded cDNA was synthesized with oligo-d (T) primers, and then digested with restriction enzymes Nla III and Mme I (New England Biolabs, UK).

    Article Title: A paired-end sequencing strategy to map the complex landscape of transcription initiation
    Article Snippet: Circularization was performed with a “collector” oligonucleotide, which converts the PCR product into a single-stranded circular DNA. .. The RCA products were digested with MmeI (NEB) to generate a specific 93~95 bp band.

    Article Title: Genome-wide exonic small interference RNA-mediated gene silencing regulates sexual reproduction in the homothallic fungus Fusarium graminearum
    Article Snippet: The ligated products were reverse-transcribed into cDNA using an oligo (dT) primer (5′-CGAGCACAGAATTAATACGACTTTTTTTTTTTTTTTTTT-3′) by SuperScript III reverse transcriptase (Invitrogen) and amplified by PCR with a pair of cDNA primers (5´-GTTCAGAGTTCTACAGTCCGA-3′ and 5´-CGAGCACAGAATTAATACGACT-3′). .. The resulting product was digested with a MmeI (NEB, MA, USA) to obtain short fragments from the 5´ end of double-stranded cDNA.

    Article Title: miRNA–mRNA Conflux Regulating Immunity and Oxidative Stress Pathways in the Midgut of Blood-Fed Anopheles stephensi
    Article Snippet: The resulting cDNA was PCR amplified. .. The PCR amplified products were digested with Mme I (NEB, Evry, France) to generate equal sized products. .. A double stranded DNA was ligated to the MmeI digestion products using T4 DNA ligase.

    Article Title: Large-scale production of SAGE libraries from microdissected tissues, flow-sorted cells, and cell lines
    Article Snippet: The adapter–cDNA ligation products were digested with the type IIS tagging enzyme MmeI (NEB), releasing adapter-tag products with 2-nucleotide (nt) overhangs. .. The two adapter–tag fractions were then ligated to form ∼131-bp adapter–ditag–adapter products that served as template for scale-up PCR.

    Article Title: Inhibition of Rho Kinases Enhances the Degradation of Mutant Huntingtin
    Article Snippet: Human androgen receptor with 23Q (AR23Q) was amplified from human brain cDNA library by PCR using a set of primers BglII-AR-Fw (5′-AAAAGATCTATGGAAGTGCAGTTAGGGCT-3′) and SalI-AR-Rv (5′-AAAAAAGTCGACCTGGGTGTGGAAATAGATGG-3′), cleaved by BglII and SalI, and introduced into the BglII-SalI sites of the pEGFP-C1 vector (EGFP-AR23Q). .. These two fragments were digested by Mme I (New England Biolabs), gel-purified, and treated with T4 DNA ligase to connect them at their CAG repeat tracts.

    Article Title: Genome-Wide Survey of Pseudomonas aeruginosa PA14 Reveals a Role for the Glyoxylate Pathway and Extracellular Proteases in the Utilization of Mucin
    Article Snippet: Genomic DNA was extracted from frozen cell pellets using a Wizard genomic DNA purification kit (Promega), cut with MmeI restriction enzyme (New England BioLabs), and treated with calf intestinal phosphatase (New England BioLabs). .. Adapters were barcoded with a unique 4-bp sequence to enable multiplexing.

    Article Title: Global analysis of the mammalian RNA degradome reveals widespread miRNA-dependent and miRNA-independent endonucleolytic cleavage
    Article Snippet: RNA was then reverse transcribed (SuperscriptIII, Invitrogen) using the primer (5′-CGAGCACAGAATTAATACGACT( )V-3′) and amplified by PCR (Phusion DNA Polymerase, Finnzymes) using the primers (5′-GTTCAGAGTTCTACAGTCCGAC-3′ and 5′-CGAGCACAGAATTAATACGAC-3′). .. PCR conditions were 7 cycles of 94°C for 30 s, 60°C for 20 s and 72°C for 3 min. Products were gel purified, cleaved with MmeI (New England Biolabs) and dephosphorylated (Shrimp alkaline phosphatase, New England Biolabs). .. Samples were run on a 12% polyacrylamide gel and a 42 nt band excised.

    Article Title: Comparative Analysis and Identification of miRNAs and Their Target Genes Responsive to Salt Stress in Diploid and Tetraploid Paulownia fortunei Seedlings
    Article Snippet: Briefly, poly (A) RNA was isolated and ligated to a 5′ RNA adapter containing a Mme I (NEB, Ipswich, MA, USA) recognition site. .. Briefly, poly (A) RNA was isolated and ligated to a 5′ RNA adapter containing a Mme I (NEB, Ipswich, MA, USA) recognition site.

    Article Title: Molecular Basis for Strain Variation in the Saccharomyces cerevisiae Adhesin Flo11p
    Article Snippet: Paragraph title: PCR amplification of the sequencing product. ... The amplified product was digested with restriction enzymes MmeI and SfcI (New England Biolabs, MA).

    Article Title: Generating high accuracy peptide binding data in high throughput with yeast surface display and SORTCERY
    Article Snippet: Low protein binding 0.45 µm filter plates or bottle-top filters BSS pH 8.0: 50 mM Tris, 100 mM NaCl, 1 mg/ml BSA Primary antibody mixture: anti-HA (Roche) 1:100 dilution and anti-Myc (Sigma) 1:100 dilution in BSS Secondary antibody mixture: APC-labeled anti-mouse (BD Biosciences) 1:40 dilution and PE-labeled anti-rabbit (Sigma) 1:100 dilution in BSS .. Zymoprep Yeast Plasmid Miniprep I (Zymo Research) Isopropanole High-Fidelity DNA Polymerase (e.g. Phusion) Thermocycler Gel equipment PCR purification and gel extraction kits (QiaGen) MmeI (New England Biolabs): MmeI restriction enzyme, NEB Cut Smart Buffer, 1 mM SAM T4 Ligase Primers and oligos .. Dilute cells to OD600 of 0.05 in SD + CAA and grow for 8 h at 30 °C.

    Article Title: De novo Genome Assembly of the Fungal Plant Pathogen Pyrenophora semeniperda
    Article Snippet: RNA samples meeting sufficient quality and quantity criteria were pooled together for 1st strand synthesis and cDNA optimization. cDNA was synthesized from pooled RNA using the SMARTer™ PCR cDNA Synthesis Kit (ClonTech, Mountain View, CA) followed by PCR cycling of cDNA with the Advantage HF 2 PCR kit (ClonTech, Mountain View, CA). .. MmeI (New England BioLabs, Ipswitch, MA) was used for 5′ and 3′ modified SMART adaptor excision followed by removal of excised 5′ and 3′ adaptor ends using AMPure beads (Agencourt Bioscience Corporation, Beverly, MA) using manufacturer's recommended protocols.

    Article Title: Differences in Brain Transcriptomes of Closely Related Baikal Coregonid Species
    Article Snippet: The ligated fragments were then treated with MmeI restrictase (NEB) to produce tags; the two mixtures were pooled together, and the tags were ligated to each other to give ditags. .. Independent recombinant clones were used to generate clone libraries arrayed in 96-well plates.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Genome-wide exonic small interference RNA-mediated gene silencing regulates sexual reproduction in the homothallic fungus Fusarium graminearum
    Article Snippet: The resulting product was digested with a MmeI (NEB, MA, USA) to obtain short fragments from the 5´ end of double-stranded cDNA. .. The resulting product was digested with a MmeI (NEB, MA, USA) to obtain short fragments from the 5´ end of double-stranded cDNA.

    Article Title: Large-scale production of SAGE libraries from microdissected tissues, flow-sorted cells, and cell lines
    Article Snippet: The adapter–cDNA ligation products were digested with the type IIS tagging enzyme MmeI (NEB), releasing adapter-tag products with 2-nucleotide (nt) overhangs. .. Gel-purified scale-up PCR products were digested with the anchoring enzyme NlaIII, yielding tail-to-tail ligated ∼36-bp cDNA ditags with CATG overhangs.

    cDNA Library Assay:

    Article Title: Genetic dissection of blood lipid traits by integrating genome-wide association study and gene expression profiling in a porcine model
    Article Snippet: Using the mRNA attached to the bead as a template, double-stranded cDNA was synthesized with oligo-d (T) primers, and then digested with restriction enzymes Nla III and Mme I (New England Biolabs, UK). .. Using the mRNA attached to the bead as a template, double-stranded cDNA was synthesized with oligo-d (T) primers, and then digested with restriction enzymes Nla III and Mme I (New England Biolabs, UK).

    Article Title: Inhibition of Rho Kinases Enhances the Degradation of Mutant Huntingtin
    Article Snippet: Human androgen receptor with 23Q (AR23Q) was amplified from human brain cDNA library by PCR using a set of primers BglII-AR-Fw (5′-AAAAGATCTATGGAAGTGCAGTTAGGGCT-3′) and SalI-AR-Rv (5′-AAAAAAGTCGACCTGGGTGTGGAAATAGATGG-3′), cleaved by BglII and SalI, and introduced into the BglII-SalI sites of the pEGFP-C1 vector (EGFP-AR23Q). .. These two fragments were digested by Mme I (New England Biolabs), gel-purified, and treated with T4 DNA ligase to connect them at their CAG repeat tracts.

    Article Title: Comparative Analysis and Identification of miRNAs and Their Target Genes Responsive to Salt Stress in Diploid and Tetraploid Paulownia fortunei Seedlings
    Article Snippet: Briefly, poly (A) RNA was isolated and ligated to a 5′ RNA adapter containing a Mme I (NEB, Ipswich, MA, USA) recognition site. .. Briefly, poly (A) RNA was isolated and ligated to a 5′ RNA adapter containing a Mme I (NEB, Ipswich, MA, USA) recognition site.

    Article Title: De novo Genome Assembly of the Fungal Plant Pathogen Pyrenophora semeniperda
    Article Snippet: Paragraph title: cDNA Library Construction and Normalization ... MmeI (New England BioLabs, Ipswitch, MA) was used for 5′ and 3′ modified SMART adaptor excision followed by removal of excised 5′ and 3′ adaptor ends using AMPure beads (Agencourt Bioscience Corporation, Beverly, MA) using manufacturer's recommended protocols.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Quantification of gene transcripts with Deep Sequencing Analysis of Gene Expression (DSAGE) from 1-2μg total RNA
    Article Snippet: We describe the use of a sequencing primer (Reagents and Solutions) that overlaps the common NlaIII site and reduces the required cycles needed for sequencing to 17. .. Trizol (Invitrogen, cat15596-018) or RNeasy kit (Qiagen, cat#74104) Dynabeads mRNA DIRECT Kit (Invitrogen, cat#610-12) DynaMag-2 magnet (Invitrogen, cat#123-21D) SuperScript II Reverse Transcriptase (Invitrogen, cat#18064-022) Second-Strand Buffer (Invitrogen, cat#10812-014) E. coli DNA Polymerase I (Invitrogen, cat#18010025) E. coli DNA Ligase (Invitrogen, cat#18052019) E. coli Rnase H (Invitrogen, cat#18021071) NlaIII (New England Biolabs, cat#R0125L) MmeI (New England Biolabs, cat#R0637L) 100X BSA (New England Biolabs, cat#B9001S) T4 DNA Ligase (high concentration) (Invitrogen, cat#15224-041) Novex 20% TBE gels(Invitrogen, cat#EC6315BOX) Low Molecular Weight DNA ladder (New England Biolabs, cat#N3233S) SYBR Green I (Invitrogen, cat#S7563) Phenol:Chloroform (adjust to pH7.5-8) (Ambion, cat#AM9732) Spin-X Centrifuge Tube Filters (Corning, cat#8161) Glycogen (Roche, cat#10901393001) GlycoBlue (Ambion, cat#AM9515) Non-Stick RNase-free Microfuge Tubes, 1.5ml (Ambion, cat#12450 Non-Stick RNase-free Microfuge Tubes, 0.5ml (Ambion, cat#12350) Platinum Taq DNA polymerase (Invitrogen, cat#10966034) Qubit fluorometer (Invitrogen, cat# ) Quant-iT dsDNA HS Assay Kit (Invitrogen, cat# ) 2X Bind and Wash (BW) Buffer (Reagents and solutions) Buffer C (Reagents and Solutions) Buffer D (Reagents and Solutions) Buffer 4 (Reagents and Solutions) LoTE (Reagents and Solutions) MGB Buffer (Reagents and Solutions) Oligonucleotides (Reagents and Solutions) (Integrated DNA Technologies) .. Transfer 100μl of the oligo(dT) beads (Dynabeads) to a 1.5ml tube (non-stick tubes are used throughout the experiment).

    Paired-end Tag:

    Article Title: Large-scale production of SAGE libraries from microdissected tissues, flow-sorted cells, and cell lines
    Article Snippet: The adapter–cDNA ligation products were digested with the type IIS tagging enzyme MmeI (NEB), releasing adapter-tag products with 2-nucleotide (nt) overhangs. .. Scale-up PCR used 23–39 amplification cycles with 1/20 to 1/80 dilutions of template material and 48 50-μL reactions.

    Article Title: Differences in Brain Transcriptomes of Closely Related Baikal Coregonid Species
    Article Snippet: The selected fragments were divided into two parts and ligated to two different adapters, each containing a MmeI restriction site. .. The ligated fragments were then treated with MmeI restrictase (NEB) to produce tags; the two mixtures were pooled together, and the tags were ligated to each other to give ditags. .. The ditags were PCR amplified, adapters were removed by digestion with NlaIII and separated from ditags in a 12% polyacrylamide gel, and the purified ditags were ligated to form linear concatemers.

    Plasmid Preparation:

    Article Title: Inhibition of Rho Kinases Enhances the Degradation of Mutant Huntingtin
    Article Snippet: Human androgen receptor with 23Q (AR23Q) was amplified from human brain cDNA library by PCR using a set of primers BglII-AR-Fw (5′-AAAAGATCTATGGAAGTGCAGTTAGGGCT-3′) and SalI-AR-Rv (5′-AAAAAAGTCGACCTGGGTGTGGAAATAGATGG-3′), cleaved by BglII and SalI, and introduced into the BglII-SalI sites of the pEGFP-C1 vector (EGFP-AR23Q). .. These two fragments were digested by Mme I (New England Biolabs), gel-purified, and treated with T4 DNA ligase to connect them at their CAG repeat tracts.

    Article Title: Generating high accuracy peptide binding data in high throughput with yeast surface display and SORTCERY
    Article Snippet: Low protein binding 0.45 µm filter plates or bottle-top filters BSS pH 8.0: 50 mM Tris, 100 mM NaCl, 1 mg/ml BSA Primary antibody mixture: anti-HA (Roche) 1:100 dilution and anti-Myc (Sigma) 1:100 dilution in BSS Secondary antibody mixture: APC-labeled anti-mouse (BD Biosciences) 1:40 dilution and PE-labeled anti-rabbit (Sigma) 1:100 dilution in BSS .. Zymoprep Yeast Plasmid Miniprep I (Zymo Research) Isopropanole High-Fidelity DNA Polymerase (e.g. Phusion) Thermocycler Gel equipment PCR purification and gel extraction kits (QiaGen) MmeI (New England Biolabs): MmeI restriction enzyme, NEB Cut Smart Buffer, 1 mM SAM T4 Ligase Primers and oligos .. Dilute cells to OD600 of 0.05 in SD + CAA and grow for 8 h at 30 °C.

    Article Title: Differences in Brain Transcriptomes of Closely Related Baikal Coregonid Species
    Article Snippet: The ligated fragments were then treated with MmeI restrictase (NEB) to produce tags; the two mixtures were pooled together, and the tags were ligated to each other to give ditags. .. The ditags were PCR amplified, adapters were removed by digestion with NlaIII and separated from ditags in a 12% polyacrylamide gel, and the purified ditags were ligated to form linear concatemers.

    Software:

    Article Title: Human neural crest cells display molecular and phenotypic hallmarks of stem cells
    Article Snippet: In brief, Nla III and MmeI restriction enzymes (New England Biolabs) were used for tag generation. .. In brief, Nla III and MmeI restriction enzymes (New England Biolabs) were used for tag generation.

    Article Title: Comparative Analysis and Identification of miRNAs and Their Target Genes Responsive to Salt Stress in Diploid and Tetraploid Paulownia fortunei Seedlings
    Article Snippet: Briefly, poly (A) RNA was isolated and ligated to a 5′ RNA adapter containing a Mme I (NEB, Ipswich, MA, USA) recognition site. .. The products were amplified using 20 PCR cycles and purified to obtain the final cDNA library, which was sequenced on an Illumina HiSeq™ 2000 system.

    Sample Prep:

    Article Title: Generating high accuracy peptide binding data in high throughput with yeast surface display and SORTCERY
    Article Snippet: Paragraph title: 2.3 Deep Sequencing Sample Preparation (see ) ... Zymoprep Yeast Plasmid Miniprep I (Zymo Research) Isopropanole High-Fidelity DNA Polymerase (e.g. Phusion) Thermocycler Gel equipment PCR purification and gel extraction kits (QiaGen) MmeI (New England Biolabs): MmeI restriction enzyme, NEB Cut Smart Buffer, 1 mM SAM T4 Ligase Primers and oligos

    Random Hexamer Labeling:

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: Second strand synthesis was performed by mixing ssDNA with 250 ng Random Hexamer Primers and 5 μl of 10× NEB Buffer CutSmart. .. After heat inactivation at 70°C for 10 min, 5 pmol S-adenosylmethionine (NEB) and 1 U MmeI enzyme (NEB) were added to the reaction followed by incubation at 37°C for 30 min. Another 3 U MmeI was added and the reaction was incubated for another 30 min.

    Concentration Assay:

    Article Title: Quantification of gene transcripts with Deep Sequencing Analysis of Gene Expression (DSAGE) from 1-2μg total RNA
    Article Snippet: We describe the use of a sequencing primer (Reagents and Solutions) that overlaps the common NlaIII site and reduces the required cycles needed for sequencing to 17. .. Trizol (Invitrogen, cat#15596-018) or RNeasy kit (Qiagen, cat#74104) Dynabeads mRNA DIRECT Kit (Invitrogen, cat#610-12) DynaMag-2 magnet (Invitrogen, cat#123-21D) SuperScript II Reverse Transcriptase (Invitrogen, cat#18064-022) Second-Strand Buffer (Invitrogen, cat#10812-014) E. coli DNA Polymerase I (Invitrogen, cat#18010025) E. coli DNA Ligase (Invitrogen, cat#18052019) E. coli Rnase H (Invitrogen, cat#18021071) NlaIII (New England Biolabs, cat#R0125L) MmeI (New England Biolabs, cat#R0637L) 100X BSA (New England Biolabs, cat#B9001S) T4 DNA Ligase (high concentration) (Invitrogen, cat#15224-041) Novex 20% TBE gels(Invitrogen, cat#EC6315BOX) Low Molecular Weight DNA ladder (New England Biolabs, cat#N3233S) SYBR Green I (Invitrogen, cat#S7563) Phenol:Chloroform (adjust to pH7.5-8) (Ambion, cat#AM9732) Spin-X Centrifuge Tube Filters (Corning, cat#8161) Glycogen (Roche, cat#10901393001) GlycoBlue (Ambion, cat#AM9515) Non-Stick RNase-free Microfuge Tubes, 1.5ml (Ambion, cat#12450 Non-Stick RNase-free Microfuge Tubes, 0.5ml (Ambion, cat#12350) Platinum Taq DNA polymerase (Invitrogen, cat#10966034) Qubit fluorometer (Invitrogen, cat# ) Quant-iT dsDNA HS Assay Kit (Invitrogen, cat# ) 2X Bind and Wash (BW) Buffer (Reagents and solutions) Buffer C (Reagents and Solutions) Buffer D (Reagents and Solutions) Buffer 4 (Reagents and Solutions) LoTE (Reagents and Solutions) MGB Buffer (Reagents and Solutions) Oligonucleotides (Reagents and Solutions) (Integrated DNA Technologies) .. Transfer 100μl of the oligo(dT) beads (Dynabeads) to a 1.5ml tube (non-stick tubes are used throughout the experiment).

    DNA Purification:

    Article Title: Genome-Wide Survey of Pseudomonas aeruginosa PA14 Reveals a Role for the Glyoxylate Pathway and Extracellular Proteases in the Utilization of Mucin
    Article Snippet: Bacterial cells were harvested by centrifugation and frozen at −80°C. .. Genomic DNA was extracted from frozen cell pellets using a Wizard genomic DNA purification kit (Promega), cut with MmeI restriction enzyme (New England BioLabs), and treated with calf intestinal phosphatase (New England BioLabs). .. Oligonucleotide adapters (see Table S1 in the supplemental material) with a 3′-NN overhang containing appropriate sequences for Illumina sequencing were ligated to the resulting fragments using T4 ligase (New England BioLabs).

    High Throughput Screening Assay:

    Article Title: Global analysis of the mammalian RNA degradome reveals widespread miRNA-dependent and miRNA-independent endonucleolytic cleavage
    Article Snippet: PCR conditions were 7 cycles of 94°C for 30 s, 60°C for 20 s and 72°C for 3 min. Products were gel purified, cleaved with MmeI (New England Biolabs) and dephosphorylated (Shrimp alkaline phosphatase, New England Biolabs). .. Products were then ligated using T4 DNA ligase (Ambion) to one of six double-stranded DNA adaptors (top 5′-P-TCGTATGCCGTCTTCTGCTTG-3′, bottom NN: 3′-NNAGCATACGGCAGAAGACGAAC-5′) that varied in the composition of an additional first 6 nt (not in the given sequence) to enable barcoding of the separate tissue samples.

    Gel Extraction:

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: The ligation products are purified to remove the T4 ligase and buffer with QIAquick nucleotide removal column and eluted in 55 μl of 10 mM Tris (pH 8). .. MmeI digestion : The ligation products are digested with 5 U MmeI (NEB) for 2 h. The cleaved DNA is resolved in 10% polyacrylamide gel, the resulting 50 bp fragment is cut out, isolated from the gel with QIAquick gel extraction kit (Qiagen) and resuspended in 50 μl of 10 mM Tris (pH 8). .. Blocking of MmeI-tagged primers : 25 μl Of the fragment is used as primer with 10 μl Driver bio-dsDNA template in the presence of 2.5 mM each ddNTPs-bio (Biotin-11-ddNTPs, NEN® Life Science Products Inc., Boston, MA), 0.025 mM each dNTPs (Roche) and Thermo Sequenase™ (Amersham Pharmacia Biotech, Inc., Piscataway, NJ).

    Article Title: Generating high accuracy peptide binding data in high throughput with yeast surface display and SORTCERY
    Article Snippet: Low protein binding 0.45 µm filter plates or bottle-top filters BSS pH 8.0: 50 mM Tris, 100 mM NaCl, 1 mg/ml BSA Primary antibody mixture: anti-HA (Roche) 1:100 dilution and anti-Myc (Sigma) 1:100 dilution in BSS Secondary antibody mixture: APC-labeled anti-mouse (BD Biosciences) 1:40 dilution and PE-labeled anti-rabbit (Sigma) 1:100 dilution in BSS .. Zymoprep Yeast Plasmid Miniprep I (Zymo Research) Isopropanole High-Fidelity DNA Polymerase (e.g. Phusion) Thermocycler Gel equipment PCR purification and gel extraction kits (QiaGen) MmeI (New England Biolabs): MmeI restriction enzyme, NEB Cut Smart Buffer, 1 mM SAM T4 Ligase Primers and oligos .. Dilute cells to OD600 of 0.05 in SD + CAA and grow for 8 h at 30 °C.

    MTT Assay:

    Article Title: Identification of the Tetraspanin CD82 as a New Barrier to Xenotransplantation
    Article Snippet: PMA, DMSO, dibutyryl cAMP, MTT, cell culture reagents, protease inhibitors, and other analytical-grade reagents were purchased from Sigma-Aldrich. .. Restriction enzymes NlaIII, MmeI, and Sph were purchased from New England Biolabs (Beverly, MA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs mme i
    Schematic of DALEC . Brown and green represent priming regions for Solexa bridge amplification primers. Blue indicates the primer binding region for the Solexa sequencing reaction. TCCGAC is the <t>Mme</t> I recognition sequence and the sequence immediately upstream of it (black) is the variable region. The inset gives detailed information for linkers A and B.
    Mme I, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mme i/product/New England Biolabs
    Average 99 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    mme i - by Bioz Stars, 2019-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    Schematic of DALEC . Brown and green represent priming regions for Solexa bridge amplification primers. Blue indicates the primer binding region for the Solexa sequencing reaction. TCCGAC is the Mme I recognition sequence and the sequence immediately upstream of it (black) is the variable region. The inset gives detailed information for linkers A and B.

    Journal: BMC Genomics

    Article Title: Distributed probing of chromatin structure in vivo reveals pervasive chromatin accessibility for expressed and non-expressed genes during tissue differentiation in C. elegans

    doi: 10.1186/1471-2164-11-465

    Figure Lengend Snippet: Schematic of DALEC . Brown and green represent priming regions for Solexa bridge amplification primers. Blue indicates the primer binding region for the Solexa sequencing reaction. TCCGAC is the Mme I recognition sequence and the sequence immediately upstream of it (black) is the variable region. The inset gives detailed information for linkers A and B.

    Article Snippet: Linker A-ligated molecules were subjected to Mme I digestion using the following 200 μl reaction mix: 20 μl Linker A-ligated product, 20.0 μl 10× NEB 4, 0.3 μl 32 mM S-adenosyl methionine, 2.0 μl Mme I (2 U/μl; NEB R0637), 157.7 μl dH2 O.

    Techniques: Amplification, Binding Assay, Sequencing