hpych4v  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Name:
    HpyCH4V
    Description:
    HpyCH4V 500 units
    Catalog Number:
    r0620l
    Price:
    282
    Category:
    Restriction Enzymes
    Size:
    500 units
    Buy from Supplier


    Structured Review

    New England Biolabs hpych4v
    HpyCH4V
    HpyCH4V 500 units
    https://www.bioz.com/result/hpych4v/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hpych4v - by Bioz Stars, 2021-03
    94/100 stars

    Images

    1) Product Images from "Efficient CRISPR/Cas9-mediated biallelic gene disruption and site-specific knockin after rapid selection of highly active sgRNAs in pigs"

    Article Title: Efficient CRISPR/Cas9-mediated biallelic gene disruption and site-specific knockin after rapid selection of highly active sgRNAs in pigs

    Journal: Scientific Reports

    doi: 10.1038/srep13348

    Rapidly selecting most effective sgRNAs by single blastocyst genotyping. ( A ) Overview and timeline of the experiment. Beginning wit h experimental design, assessment of sgRNA mutagenesis efficiencies can be achieved within 10 days. ( B ) Genotyping of single blastocyst derived from Cas9 mRNA and sgRNA-injected parthenogenetic oocytes by RFLP and Sanger sequence analyses. Representative RFLP agarose gel electrophoresis showing PCR product of target region derived from 10 individual blastocysts digested with different restriction enzymes. The F1, F2, R1 and R2 sgRNA mutagenesis efficiencies were assessed by BsaJI, HpyCH4V, BsaJI and DraI, respectively. In each RFLP assay, some PCR products were sequenced to confirm the mutations at the target sites. The numbers on the right show the type of mutation and how many nucleotides are involved, with “−” and “+” indicating deletion or insertion of the given number of nucleotides, respectively. The sgRNA sequence is labeled in red, and the PAM sequence is labeled in purple. Deleted bases are marked with colons, and arrows indicate the sites of inserted bases, which are listed under the mutant alleles.
    Figure Legend Snippet: Rapidly selecting most effective sgRNAs by single blastocyst genotyping. ( A ) Overview and timeline of the experiment. Beginning wit h experimental design, assessment of sgRNA mutagenesis efficiencies can be achieved within 10 days. ( B ) Genotyping of single blastocyst derived from Cas9 mRNA and sgRNA-injected parthenogenetic oocytes by RFLP and Sanger sequence analyses. Representative RFLP agarose gel electrophoresis showing PCR product of target region derived from 10 individual blastocysts digested with different restriction enzymes. The F1, F2, R1 and R2 sgRNA mutagenesis efficiencies were assessed by BsaJI, HpyCH4V, BsaJI and DraI, respectively. In each RFLP assay, some PCR products were sequenced to confirm the mutations at the target sites. The numbers on the right show the type of mutation and how many nucleotides are involved, with “−” and “+” indicating deletion or insertion of the given number of nucleotides, respectively. The sgRNA sequence is labeled in red, and the PAM sequence is labeled in purple. Deleted bases are marked with colons, and arrows indicate the sites of inserted bases, which are listed under the mutant alleles.

    Techniques Used: Mutagenesis, Derivative Assay, Injection, Sequencing, Agarose Gel Electrophoresis, Polymerase Chain Reaction, RFLP Assay, Labeling

    2) Product Images from "Novel pathogenic mutations in C1QTNF5 support a dominant negative disease mechanism in late-onset retinal degeneration"

    Article Title: Novel pathogenic mutations in C1QTNF5 support a dominant negative disease mechanism in late-onset retinal degeneration

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-11898-3

    Pedigree, genotype and phenotype of family 1. ( a ) L-ORD family 1 is a multi-generation pedigree showing autosomal dominant inheritance. Squares represent males, circles represent females. Shaded shapes indicate an affected individual. Clinical phenotyping of the proband V:I. ( b ) Anterior segment slit lamp photograph shows long-anterior zonules (white arrow) encroaching beyond the pupil margin in a dilated pupil. ( c ) Colour fundus photography shows areas of central atrophy affecting the macula and ( d ) Fundus autofluorescence imaging shows areas of central scalloped hypoautofluorescence matching the areas of atrophy surrounded by a cuff of increased autofluorescence. ( e ) Microperimetry interpolated plot superimposes areas of retinal sensitivity on a colour fundus image. Areas of good sensitvity vary from green to yellow to red for poor sensitivity. Areas with no sensitivity have no polygons. The image shows non-detectable sensitivity at the macula for the patient. ( f ) Hyperreflective deposits deep to the neural retina, indicated by asterisks, are observed in the macula in an OCT scan of the proband. NR, neural retina; CH, choroid. ( g ) Dark adaptometry of the proband (L-ORD case) shows that recovery of sensitivity after light exposure is slow and final sensitivity is still reduced at 80 minutes, compared to the normal, rapid recovery of sensitivity in an unaffected sibling. ( h ) Sequence analysis of C1QTNF5 exon 3 revealed a heterozygous c.646G > T transversion, resulting in a glycine to cysteine mutation at position 216 in the L-ORD case (lower panel) compared to an unaffected relative (upper panel). ( i ) HpyCh4V restriction digest confirms the c.646 G > T mutation by generating fragments of 439, 363, 129 and 120 bp in homozygous G (p.G216) samples, and 439, 363, 129, 94 and 26 bp for the mutant G > T (p.C216) allele.
    Figure Legend Snippet: Pedigree, genotype and phenotype of family 1. ( a ) L-ORD family 1 is a multi-generation pedigree showing autosomal dominant inheritance. Squares represent males, circles represent females. Shaded shapes indicate an affected individual. Clinical phenotyping of the proband V:I. ( b ) Anterior segment slit lamp photograph shows long-anterior zonules (white arrow) encroaching beyond the pupil margin in a dilated pupil. ( c ) Colour fundus photography shows areas of central atrophy affecting the macula and ( d ) Fundus autofluorescence imaging shows areas of central scalloped hypoautofluorescence matching the areas of atrophy surrounded by a cuff of increased autofluorescence. ( e ) Microperimetry interpolated plot superimposes areas of retinal sensitivity on a colour fundus image. Areas of good sensitvity vary from green to yellow to red for poor sensitivity. Areas with no sensitivity have no polygons. The image shows non-detectable sensitivity at the macula for the patient. ( f ) Hyperreflective deposits deep to the neural retina, indicated by asterisks, are observed in the macula in an OCT scan of the proband. NR, neural retina; CH, choroid. ( g ) Dark adaptometry of the proband (L-ORD case) shows that recovery of sensitivity after light exposure is slow and final sensitivity is still reduced at 80 minutes, compared to the normal, rapid recovery of sensitivity in an unaffected sibling. ( h ) Sequence analysis of C1QTNF5 exon 3 revealed a heterozygous c.646G > T transversion, resulting in a glycine to cysteine mutation at position 216 in the L-ORD case (lower panel) compared to an unaffected relative (upper panel). ( i ) HpyCh4V restriction digest confirms the c.646 G > T mutation by generating fragments of 439, 363, 129 and 120 bp in homozygous G (p.G216) samples, and 439, 363, 129, 94 and 26 bp for the mutant G > T (p.C216) allele.

    Techniques Used: Imaging, Sequencing, Mutagenesis

    3) Product Images from "SYBR Green Real-Time PCR-RFLP Assay Targeting the Plasmodium Cytochrome B Gene – A Highly Sensitive Molecular Tool for Malaria Parasite Detection and Species Determination"

    Article Title: SYBR Green Real-Time PCR-RFLP Assay Targeting the Plasmodium Cytochrome B Gene – A Highly Sensitive Molecular Tool for Malaria Parasite Detection and Species Determination

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0120210

    The cytb-qPCR products and RFLP assays for species determination. a) The 430 bp cytb-qPCR products for each species. b-e) Four RFLP assays using FspBI, AluI, HpyCH4V and Csp6I restriction enzymes for Plasmodium species determination. f) Schematic diagram showing the RFLP product lengths. a-e) Lane 1, GeneRuler low range DNA ladder (Thermo Fisher); F, P . falciparum ; V, P . vivax ; M, P . malariae ; O, P . ovale ; NC, negative control.
    Figure Legend Snippet: The cytb-qPCR products and RFLP assays for species determination. a) The 430 bp cytb-qPCR products for each species. b-e) Four RFLP assays using FspBI, AluI, HpyCH4V and Csp6I restriction enzymes for Plasmodium species determination. f) Schematic diagram showing the RFLP product lengths. a-e) Lane 1, GeneRuler low range DNA ladder (Thermo Fisher); F, P . falciparum ; V, P . vivax ; M, P . malariae ; O, P . ovale ; NC, negative control.

    Techniques Used: Real-time Polymerase Chain Reaction, Negative Control

    4) Product Images from "Rapid detection of equine coronavirus by reverse transcription loop-mediated isothermal amplification"

    Article Title: Rapid detection of equine coronavirus by reverse transcription loop-mediated isothermal amplification

    Journal: Journal of Virological Methods

    doi: 10.1016/j.jviromet.2015.02.001

    Restriction enzyme digestion of RT-LAMP products. Undigested RT-LAMP products (Lane 1) and products digested with HpyCH4V (Lane 2). M, marker.
    Figure Legend Snippet: Restriction enzyme digestion of RT-LAMP products. Undigested RT-LAMP products (Lane 1) and products digested with HpyCH4V (Lane 2). M, marker.

    Techniques Used: Marker

    5) Product Images from "Seven novel mutations in the long isoform of the USH2A gene in Chinese families with nonsyndromic retinitis pigmentosa and Usher syndrome Type II"

    Article Title: Seven novel mutations in the long isoform of the USH2A gene in Chinese families with nonsyndromic retinitis pigmentosa and Usher syndrome Type II

    Journal: Molecular Vision

    doi:

    A restriction fragment length analysis of the four mutations detected in this study. A : c.2802T > G abolished a HincII restriction site that co-segregated with the affected individuals and the carriers (42 bp, 57 bp, 99 bp, 717 bp, and 774 bp), but not with unaffected individuals and normal controls (42 bp, 57 bp, and 717 bp). B : c.8232G > C created a new HpyCH4V restriction site that co-segregated with the affected individuals and the carriers (88 bp, 186 bp, 218 bp, and 274 bp), but not with unaffected individuals and normal controls (218 bp, 274 bp). C : c.3788G > A abolished a BsaI restriction site that co-segregated with the affected individuals and the carriers (70 bp, 132 bp, 422 bp, and 492 bp), but not with unaffected individuals and normal controls (70 bp, 132 bp, and 422 bp). D : c.14403C > G created a SpeI restriction site that co-segregated with the affected individuals and the carriers (145 bp, 300 bp, and 445 bp), but not with unaffected individuals and normal controls (445 bp). A participant identification number is given above each lane. N represents normal controls.
    Figure Legend Snippet: A restriction fragment length analysis of the four mutations detected in this study. A : c.2802T > G abolished a HincII restriction site that co-segregated with the affected individuals and the carriers (42 bp, 57 bp, 99 bp, 717 bp, and 774 bp), but not with unaffected individuals and normal controls (42 bp, 57 bp, and 717 bp). B : c.8232G > C created a new HpyCH4V restriction site that co-segregated with the affected individuals and the carriers (88 bp, 186 bp, 218 bp, and 274 bp), but not with unaffected individuals and normal controls (218 bp, 274 bp). C : c.3788G > A abolished a BsaI restriction site that co-segregated with the affected individuals and the carriers (70 bp, 132 bp, 422 bp, and 492 bp), but not with unaffected individuals and normal controls (70 bp, 132 bp, and 422 bp). D : c.14403C > G created a SpeI restriction site that co-segregated with the affected individuals and the carriers (145 bp, 300 bp, and 445 bp), but not with unaffected individuals and normal controls (445 bp). A participant identification number is given above each lane. N represents normal controls.

    Techniques Used:

    6) Product Images from "Novel pathogenic mutations in C1QTNF5 support a dominant negative disease mechanism in late-onset retinal degeneration"

    Article Title: Novel pathogenic mutations in C1QTNF5 support a dominant negative disease mechanism in late-onset retinal degeneration

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-11898-3

    Pedigree, genotype and phenotype of family 1. ( a ) L-ORD family 1 is a multi-generation pedigree showing autosomal dominant inheritance. Squares represent males, circles represent females. Shaded shapes indicate an affected individual. Clinical phenotyping of the proband V:I. ( b ) Anterior segment slit lamp photograph shows long-anterior zonules (white arrow) encroaching beyond the pupil margin in a dilated pupil. ( c ) Colour fundus photography shows areas of central atrophy affecting the macula and ( d ) Fundus autofluorescence imaging shows areas of central scalloped hypoautofluorescence matching the areas of atrophy surrounded by a cuff of increased autofluorescence. ( e ) Microperimetry interpolated plot superimposes areas of retinal sensitivity on a colour fundus image. Areas of good sensitvity vary from green to yellow to red for poor sensitivity. Areas with no sensitivity have no polygons. The image shows non-detectable sensitivity at the macula for the patient. ( f ) Hyperreflective deposits deep to the neural retina, indicated by asterisks, are observed in the macula in an OCT scan of the proband. NR, neural retina; CH, choroid. ( g ) Dark adaptometry of the proband (L-ORD case) shows that recovery of sensitivity after light exposure is slow and final sensitivity is still reduced at 80 minutes, compared to the normal, rapid recovery of sensitivity in an unaffected sibling. ( h ) Sequence analysis of C1QTNF5 exon 3 revealed a heterozygous c.646G > T transversion, resulting in a glycine to cysteine mutation at position 216 in the L-ORD case (lower panel) compared to an unaffected relative (upper panel). ( i ) HpyCh4V restriction digest confirms the c.646 G > T mutation by generating fragments of 439, 363, 129 and 120 bp in homozygous G (p.G216) samples, and 439, 363, 129, 94 and 26 bp for the mutant G > T (p.C216) allele.
    Figure Legend Snippet: Pedigree, genotype and phenotype of family 1. ( a ) L-ORD family 1 is a multi-generation pedigree showing autosomal dominant inheritance. Squares represent males, circles represent females. Shaded shapes indicate an affected individual. Clinical phenotyping of the proband V:I. ( b ) Anterior segment slit lamp photograph shows long-anterior zonules (white arrow) encroaching beyond the pupil margin in a dilated pupil. ( c ) Colour fundus photography shows areas of central atrophy affecting the macula and ( d ) Fundus autofluorescence imaging shows areas of central scalloped hypoautofluorescence matching the areas of atrophy surrounded by a cuff of increased autofluorescence. ( e ) Microperimetry interpolated plot superimposes areas of retinal sensitivity on a colour fundus image. Areas of good sensitvity vary from green to yellow to red for poor sensitivity. Areas with no sensitivity have no polygons. The image shows non-detectable sensitivity at the macula for the patient. ( f ) Hyperreflective deposits deep to the neural retina, indicated by asterisks, are observed in the macula in an OCT scan of the proband. NR, neural retina; CH, choroid. ( g ) Dark adaptometry of the proband (L-ORD case) shows that recovery of sensitivity after light exposure is slow and final sensitivity is still reduced at 80 minutes, compared to the normal, rapid recovery of sensitivity in an unaffected sibling. ( h ) Sequence analysis of C1QTNF5 exon 3 revealed a heterozygous c.646G > T transversion, resulting in a glycine to cysteine mutation at position 216 in the L-ORD case (lower panel) compared to an unaffected relative (upper panel). ( i ) HpyCh4V restriction digest confirms the c.646 G > T mutation by generating fragments of 439, 363, 129 and 120 bp in homozygous G (p.G216) samples, and 439, 363, 129, 94 and 26 bp for the mutant G > T (p.C216) allele.

    Techniques Used: Imaging, Sequencing, Mutagenesis

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Efficient CRISPR/Cas9-mediated biallelic gene disruption and site-specific knockin after rapid selection of highly active sgRNAs in pigs
    Article Snippet: The identity of each PCR product was confirmed by restriction fragment length polymorphism (RFLP) analysis. .. Ten microliters of PCR product was digested with BsaJI, HpyCH4V or DraI (New England Biolabs, US), respectively. .. The reaction products were separated by 2% agarose gel electrophoresis in the presence of ethidium bromide solution, and visualized with a UV transilluminator (UVP, Upland, CA).

    Article Title: A new molecular method for the exploration of hybrid zones between two toad species of conservation interest
    Article Snippet: With NEBCutter [ ] and dCAPS Finder [ ] four HpyCH4V restriction enzyme sites (TG_^CA) were detected in B. bombina , with one out of four missing from the B. variegata sequences (S2 Fig). .. The amplified PCR fragments were digested with HpyCH4V enzyme (New England Biolab) at 37 °C for 3 hours. .. 10 μl of each digestion reaction were loaded into 2.5 % TAE agarose gel and GeneRuler™ 1 kb Plus DNA Ladder (Fermentas) was used as a molecular weight marker.

    Article Title: Identification and distribution of a GABA receptor mutation conferring dieldrin resistance in the malaria vector Anopheles funestus in Africa
    Article Snippet: The same primers RDLF and RDLR used above were used to amplify the fragment of 255 bp of Exon 7 using the same PCR conditions. .. The PCR product was directly digested with HpyCH4V restriction endonuclease (New England Biolabs) during 1 h of incubation at 37 °C. .. This restriction enzyme cleaves the susceptible allele at the recognition sequence TG^CA producing two fragments detectable on a 2% agarose gel.

    Amplification:

    Article Title: A new molecular method for the exploration of hybrid zones between two toad species of conservation interest
    Article Snippet: With NEBCutter [ ] and dCAPS Finder [ ] four HpyCH4V restriction enzyme sites (TG_^CA) were detected in B. bombina , with one out of four missing from the B. variegata sequences (S2 Fig). .. The amplified PCR fragments were digested with HpyCH4V enzyme (New England Biolab) at 37 °C for 3 hours. .. 10 μl of each digestion reaction were loaded into 2.5 % TAE agarose gel and GeneRuler™ 1 kb Plus DNA Ladder (Fermentas) was used as a molecular weight marker.

    other:

    Article Title: Restriction Analysis of β‐Tubulin Gene for Differentiation of the Common Pathogenic Dermatophytes
    Article Snippet: As exemplified in Figures , , and in accordance with our theoretical analysis, restriction fragment length determination of BT2 revealed that a combination of restriction digestion by Fat I, Alw 21I, and Hpy CH4V is useful and applicable for identifying the nine species, M. gypseum , M. canis, T. verrucosum, T. rubrum T. violaceum, T. interdigitale , T. tonsurans , T. schoenleinii , and E. floccosum .

    Article Title: Restriction Analysis of β‐Tubulin Gene for Differentiation of the Common Pathogenic Dermatophytes
    Article Snippet: But regarding to the fully congruence of the restriction profiles by Fat I, Alw 21I, and Hpy CH4V (Figs. , , ) with the fragments sizes deduced from computational analysis, it is certainly predictable that the estimated fragments sizes of BT2 after digestion with Mwo I can be applicable for differentiation of the mentioned species.

    Mutagenesis:

    Article Title: Novel pathogenic mutations in C1QTNF5 support a dominant negative disease mechanism in late-onset retinal degeneration
    Article Snippet: In family 1, the G216C mutation was confirmed by restriction digestion using HpyCh4V (NEB) following PCR using the primers CTRP5x3AF (5′GAGGGGTACGGTGACCTTAGA3′) and CTRP53′UTRBR (5′ACCATGATCCCAGAAACAGG3′), to generate fragments of 439, 363, 129 and 120 bp in homozygous G (p.G216) samples, and 439, 363, 129, 94 and 26 bp for the mutant G > T (p.C216) allele. .. Restriction digest screening using HpyCh4V was also performed 351 unrelated control samples from the Scottish population and 244 Scottish age-related macular degeneration (AMD) cases, to validate the mutation. ..

    Incubation:

    Article Title: Identification and distribution of a GABA receptor mutation conferring dieldrin resistance in the malaria vector Anopheles funestus in Africa
    Article Snippet: The same primers RDLF and RDLR used above were used to amplify the fragment of 255 bp of Exon 7 using the same PCR conditions. .. The PCR product was directly digested with HpyCH4V restriction endonuclease (New England Biolabs) during 1 h of incubation at 37 °C. .. This restriction enzyme cleaves the susceptible allele at the recognition sequence TG^CA producing two fragments detectable on a 2% agarose gel.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    New England Biolabs hpy ch4v
    Restriction patterns of BT2 gene by <t>Hpy</t> <t>CH4V</t> for discrimination between T. schoenleinii and E. floccosum . Lane 1, T. schoenleinii (NBRC 8191); lane 2, E. floccosum (NBRC 9045); lane 3, M. gypseum (CBS 8228), lane 4, M. canis (NBRC 9182). M, 100‐bp molecular size marker.
    Hpy Ch4v, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hpy ch4v/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hpy ch4v - by Bioz Stars, 2021-03
    94/100 stars
      Buy from Supplier

    Image Search Results


    Restriction patterns of BT2 gene by Hpy CH4V for discrimination between T. schoenleinii and E. floccosum . Lane 1, T. schoenleinii (NBRC 8191); lane 2, E. floccosum (NBRC 9045); lane 3, M. gypseum (CBS 8228), lane 4, M. canis (NBRC 9182). M, 100‐bp molecular size marker.

    Journal: Journal of Clinical Laboratory Analysis

    Article Title: Restriction Analysis of β‐Tubulin Gene for Differentiation of the Common Pathogenic Dermatophytes

    doi: 10.1002/jcla.21649

    Figure Lengend Snippet: Restriction patterns of BT2 gene by Hpy CH4V for discrimination between T. schoenleinii and E. floccosum . Lane 1, T. schoenleinii (NBRC 8191); lane 2, E. floccosum (NBRC 9045); lane 3, M. gypseum (CBS 8228), lane 4, M. canis (NBRC 9182). M, 100‐bp molecular size marker.

    Article Snippet: As exemplified in Figures , , and in accordance with our theoretical analysis, restriction fragment length determination of BT2 revealed that a combination of restriction digestion by Fat I, Alw 21I, and Hpy CH4V is useful and applicable for identifying the nine species, M. gypseum , M. canis, T. verrucosum, T. rubrum T. violaceum, T. interdigitale , T. tonsurans , T. schoenleinii , and E. floccosum .

    Techniques: Marker

    Rapidly selecting most effective sgRNAs by single blastocyst genotyping. ( A ) Overview and timeline of the experiment. Beginning wit h experimental design, assessment of sgRNA mutagenesis efficiencies can be achieved within 10 days. ( B ) Genotyping of single blastocyst derived from Cas9 mRNA and sgRNA-injected parthenogenetic oocytes by RFLP and Sanger sequence analyses. Representative RFLP agarose gel electrophoresis showing PCR product of target region derived from 10 individual blastocysts digested with different restriction enzymes. The F1, F2, R1 and R2 sgRNA mutagenesis efficiencies were assessed by BsaJI, HpyCH4V, BsaJI and DraI, respectively. In each RFLP assay, some PCR products were sequenced to confirm the mutations at the target sites. The numbers on the right show the type of mutation and how many nucleotides are involved, with “−” and “+” indicating deletion or insertion of the given number of nucleotides, respectively. The sgRNA sequence is labeled in red, and the PAM sequence is labeled in purple. Deleted bases are marked with colons, and arrows indicate the sites of inserted bases, which are listed under the mutant alleles.

    Journal: Scientific Reports

    Article Title: Efficient CRISPR/Cas9-mediated biallelic gene disruption and site-specific knockin after rapid selection of highly active sgRNAs in pigs

    doi: 10.1038/srep13348

    Figure Lengend Snippet: Rapidly selecting most effective sgRNAs by single blastocyst genotyping. ( A ) Overview and timeline of the experiment. Beginning wit h experimental design, assessment of sgRNA mutagenesis efficiencies can be achieved within 10 days. ( B ) Genotyping of single blastocyst derived from Cas9 mRNA and sgRNA-injected parthenogenetic oocytes by RFLP and Sanger sequence analyses. Representative RFLP agarose gel electrophoresis showing PCR product of target region derived from 10 individual blastocysts digested with different restriction enzymes. The F1, F2, R1 and R2 sgRNA mutagenesis efficiencies were assessed by BsaJI, HpyCH4V, BsaJI and DraI, respectively. In each RFLP assay, some PCR products were sequenced to confirm the mutations at the target sites. The numbers on the right show the type of mutation and how many nucleotides are involved, with “−” and “+” indicating deletion or insertion of the given number of nucleotides, respectively. The sgRNA sequence is labeled in red, and the PAM sequence is labeled in purple. Deleted bases are marked with colons, and arrows indicate the sites of inserted bases, which are listed under the mutant alleles.

    Article Snippet: Ten microliters of PCR product was digested with BsaJI, HpyCH4V or DraI (New England Biolabs, US), respectively.

    Techniques: Mutagenesis, Derivative Assay, Injection, Sequencing, Agarose Gel Electrophoresis, Polymerase Chain Reaction, RFLP Assay, Labeling

    Pedigree, genotype and phenotype of family 1. ( a ) L-ORD family 1 is a multi-generation pedigree showing autosomal dominant inheritance. Squares represent males, circles represent females. Shaded shapes indicate an affected individual. Clinical phenotyping of the proband V:I. ( b ) Anterior segment slit lamp photograph shows long-anterior zonules (white arrow) encroaching beyond the pupil margin in a dilated pupil. ( c ) Colour fundus photography shows areas of central atrophy affecting the macula and ( d ) Fundus autofluorescence imaging shows areas of central scalloped hypoautofluorescence matching the areas of atrophy surrounded by a cuff of increased autofluorescence. ( e ) Microperimetry interpolated plot superimposes areas of retinal sensitivity on a colour fundus image. Areas of good sensitvity vary from green to yellow to red for poor sensitivity. Areas with no sensitivity have no polygons. The image shows non-detectable sensitivity at the macula for the patient. ( f ) Hyperreflective deposits deep to the neural retina, indicated by asterisks, are observed in the macula in an OCT scan of the proband. NR, neural retina; CH, choroid. ( g ) Dark adaptometry of the proband (L-ORD case) shows that recovery of sensitivity after light exposure is slow and final sensitivity is still reduced at 80 minutes, compared to the normal, rapid recovery of sensitivity in an unaffected sibling. ( h ) Sequence analysis of C1QTNF5 exon 3 revealed a heterozygous c.646G > T transversion, resulting in a glycine to cysteine mutation at position 216 in the L-ORD case (lower panel) compared to an unaffected relative (upper panel). ( i ) HpyCh4V restriction digest confirms the c.646 G > T mutation by generating fragments of 439, 363, 129 and 120 bp in homozygous G (p.G216) samples, and 439, 363, 129, 94 and 26 bp for the mutant G > T (p.C216) allele.

    Journal: Scientific Reports

    Article Title: Novel pathogenic mutations in C1QTNF5 support a dominant negative disease mechanism in late-onset retinal degeneration

    doi: 10.1038/s41598-017-11898-3

    Figure Lengend Snippet: Pedigree, genotype and phenotype of family 1. ( a ) L-ORD family 1 is a multi-generation pedigree showing autosomal dominant inheritance. Squares represent males, circles represent females. Shaded shapes indicate an affected individual. Clinical phenotyping of the proband V:I. ( b ) Anterior segment slit lamp photograph shows long-anterior zonules (white arrow) encroaching beyond the pupil margin in a dilated pupil. ( c ) Colour fundus photography shows areas of central atrophy affecting the macula and ( d ) Fundus autofluorescence imaging shows areas of central scalloped hypoautofluorescence matching the areas of atrophy surrounded by a cuff of increased autofluorescence. ( e ) Microperimetry interpolated plot superimposes areas of retinal sensitivity on a colour fundus image. Areas of good sensitvity vary from green to yellow to red for poor sensitivity. Areas with no sensitivity have no polygons. The image shows non-detectable sensitivity at the macula for the patient. ( f ) Hyperreflective deposits deep to the neural retina, indicated by asterisks, are observed in the macula in an OCT scan of the proband. NR, neural retina; CH, choroid. ( g ) Dark adaptometry of the proband (L-ORD case) shows that recovery of sensitivity after light exposure is slow and final sensitivity is still reduced at 80 minutes, compared to the normal, rapid recovery of sensitivity in an unaffected sibling. ( h ) Sequence analysis of C1QTNF5 exon 3 revealed a heterozygous c.646G > T transversion, resulting in a glycine to cysteine mutation at position 216 in the L-ORD case (lower panel) compared to an unaffected relative (upper panel). ( i ) HpyCh4V restriction digest confirms the c.646 G > T mutation by generating fragments of 439, 363, 129 and 120 bp in homozygous G (p.G216) samples, and 439, 363, 129, 94 and 26 bp for the mutant G > T (p.C216) allele.

    Article Snippet: Restriction digest screening using HpyCh4V was also performed 351 unrelated control samples from the Scottish population and 244 Scottish age-related macular degeneration (AMD) cases, to validate the mutation.

    Techniques: Imaging, Sequencing, Mutagenesis

    Electrophoretic differentiation of the digested PCR fragments specific to Ncx-1 gene. The amplified PCR product from Ncx-1 gene before enzymatic digestion: B. variegata (Bv; identifier of the individual: 101), B. bombina (Bb; identifier of the individual: 189) and hybrid (Bv × Bb; identifier of the individual: 169) Fragments resulted by the digestion with HpyCH4V restriction enzyme: Bv* (101), Bv × Bb* (169), Bb* (189). MM – molecular weight marker.

    Journal: bioRxiv

    Article Title: A new molecular method for the exploration of hybrid zones between two toad species of conservation interest

    doi: 10.1101/2020.07.29.226472

    Figure Lengend Snippet: Electrophoretic differentiation of the digested PCR fragments specific to Ncx-1 gene. The amplified PCR product from Ncx-1 gene before enzymatic digestion: B. variegata (Bv; identifier of the individual: 101), B. bombina (Bb; identifier of the individual: 189) and hybrid (Bv × Bb; identifier of the individual: 169) Fragments resulted by the digestion with HpyCH4V restriction enzyme: Bv* (101), Bv × Bb* (169), Bb* (189). MM – molecular weight marker.

    Article Snippet: The amplified PCR fragments were digested with HpyCH4V enzyme (New England Biolab) at 37 °C for 3 hours.

    Techniques: Polymerase Chain Reaction, Amplification, Molecular Weight, Marker