swai  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    SwaI
    Description:
    SwaI 10 000 units
    Catalog Number:
    r0604l
    Price:
    282
    Size:
    10 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs swai
    SwaI
    SwaI 10 000 units
    https://www.bioz.com/result/swai/product/New England Biolabs
    Average 95 stars, based on 900 article reviews
    Price from $9.99 to $1999.99
    swai - by Bioz Stars, 2020-09
    95/100 stars

    Images

    1) Product Images from "The abundance of Fob1 modulates the efficiency of rRFBs to stall replication forks"

    Article Title: The abundance of Fob1 modulates the efficiency of rRFBs to stall replication forks

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkx655

    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_MEM_3rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_MEM_3rRFBs+ (8908 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note the insertion of an EcoRI fragment containing the three putative Fob1 binding sites expected to act as RFBs (indicated in red), described by Kobayashi ( 20 ). ( B ) Map of the 3708 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with SwaI and BamHI showing the relative position of the three putative RFBs. ( C ) Map of the 5186 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with EcoRV and MluI showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3708 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5186-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them.
    Figure Legend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_MEM_3rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_MEM_3rRFBs+ (8908 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note the insertion of an EcoRI fragment containing the three putative Fob1 binding sites expected to act as RFBs (indicated in red), described by Kobayashi ( 20 ). ( B ) Map of the 3708 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with SwaI and BamHI showing the relative position of the three putative RFBs. ( C ) Map of the 5186 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with EcoRV and MluI showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3708 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5186-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them.

    Techniques Used: Two-Dimensional Gel Electrophoresis, Binding Assay, Activated Clotting Time Assay, Generated

    Genetic map and 2D gel analysis of linear fragments corresponding to pYAC_MEM. ( A ) Genetic map of pYAC_MEM (7966 bp) showing its most relevant features: clockwise starting with the replication origin ARS4 (indicated in green), URA3 gene active in Saccharomyces cerevisiae (indicated in light blue), L1 lambda DNA used for hybridization (indicated in yellow), HIS3 gene active in S. cerevisiae (indicated in light blue), L2 lambda DNA used for hybridization (indicated in yellow), the ColE1 replication origin active only in Escherichia coli (indicated in gray), the ampicillin resistance gene active only in E. coli (indicated in gray) and the budding yeast centromeric sequence CEN6 (indicated in orange). The sites for specific restriction endonucleases are indicated outside the map. In addition, a magenta triangle points the position located 180° apart from the replication origin ARS4. ( B ) Map of the 2764-bp linear fragment generated by digestion of pYAC_MEM with SwaI and BamHI. ( C ) Map of the 4245-bp linear fragment generated by digestion of pYAC_MEM with EcoRV and MluI. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 2764 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 4245-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). De-localized termination signals are indicated in magenta.
    Figure Legend Snippet: Genetic map and 2D gel analysis of linear fragments corresponding to pYAC_MEM. ( A ) Genetic map of pYAC_MEM (7966 bp) showing its most relevant features: clockwise starting with the replication origin ARS4 (indicated in green), URA3 gene active in Saccharomyces cerevisiae (indicated in light blue), L1 lambda DNA used for hybridization (indicated in yellow), HIS3 gene active in S. cerevisiae (indicated in light blue), L2 lambda DNA used for hybridization (indicated in yellow), the ColE1 replication origin active only in Escherichia coli (indicated in gray), the ampicillin resistance gene active only in E. coli (indicated in gray) and the budding yeast centromeric sequence CEN6 (indicated in orange). The sites for specific restriction endonucleases are indicated outside the map. In addition, a magenta triangle points the position located 180° apart from the replication origin ARS4. ( B ) Map of the 2764-bp linear fragment generated by digestion of pYAC_MEM with SwaI and BamHI. ( C ) Map of the 4245-bp linear fragment generated by digestion of pYAC_MEM with EcoRV and MluI. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 2764 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 4245-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). De-localized termination signals are indicated in magenta.

    Techniques Used: Two-Dimensional Gel Electrophoresis, Lambda DNA Preparation, Hybridization, Sequencing, Generated

    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ isolated from cells that overexpress Fob1 and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the ten putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194 bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in ( D ) is presented in ( H ) indicating the height of the peaks. For comparison, the densitometric profile corresponding to the 3705-bp SwaI-BamHI of pYAC_AC_10rRFBs isolated from the top2-td strain shown in Figure 4H is presented on top.
    Figure Legend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ isolated from cells that overexpress Fob1 and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the ten putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194 bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in ( D ) is presented in ( H ) indicating the height of the peaks. For comparison, the densitometric profile corresponding to the 3705-bp SwaI-BamHI of pYAC_AC_10rRFBs isolated from the top2-td strain shown in Figure 4H is presented on top.

    Techniques Used: Two-Dimensional Gel Electrophoresis, Isolation, Binding Assay, Activated Clotting Time Assay, In Vivo, Generated

    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the 10 putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705-bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks.
    Figure Legend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the 10 putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705-bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks.

    Techniques Used: Two-Dimensional Gel Electrophoresis, Binding Assay, Activated Clotting Time Assay, In Vivo, Generated

    2) Product Images from "Genome Diversity of Pseudomonas aeruginosa PAO1 Laboratory Strains ▿ PAO1 Laboratory Strains ▿ †"

    Article Title: Genome Diversity of Pseudomonas aeruginosa PAO1 Laboratory Strains ▿ PAO1 Laboratory Strains ▿ †

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.01515-09

    Genomic differences in PAO1 sublines. (A) PFGE of SwaI- and PacI-digested DNA of PAO1 sublines PAO1-DSM (lanes a) and PAO1-UW (lanes b). Restriction fragments that are altered due to the chromosomal inversion are labeled. (B) Circular maps of PAO1 sublines
    Figure Legend Snippet: Genomic differences in PAO1 sublines. (A) PFGE of SwaI- and PacI-digested DNA of PAO1 sublines PAO1-DSM (lanes a) and PAO1-UW (lanes b). Restriction fragments that are altered due to the chromosomal inversion are labeled. (B) Circular maps of PAO1 sublines

    Techniques Used: Labeling

    3) Product Images from "Topoisomerase 2 Is Dispensable for the Replication and Segregation of Small Yeast Artificial Chromosomes (YACs)"

    Article Title: Topoisomerase 2 Is Dispensable for the Replication and Segregation of Small Yeast Artificial Chromosomes (YACs)

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0104995

    Construction of pYAC_MEM_RFB+ and YAC_MEM_RFB+ and analysis of their replication intermediates. A: Name, mass and genetic map of the circular minichromosome. The relative positions of its most relevant features are indicated inside: The centromeric sequence CEN6, the autonomous replication sequence (ARS4), URA3, the lambda DNA marker sequence (L1), the ribosomal RFB, Tetrahymena telomeric repeats, HIS3, the lambda DNA marker sequence (L2), the ColE1 unidirectional origin (ColE1 Ori) and the ampicillin-resistance gene (AmpR). Outside, the relative positions of sites recognized by specific restriction endonucleases are indicated. B: The corresponding linear map of the restriction fragment used and its size. Below, the genetic map of YAC_MEM_RFB+. C: Synchronized top2-td cells transformed with either pYAC_MEM_RFB+ or YAC_MEM_RFB+ were fixed 40 minutes after their release into the S-phase. The DNA was isolated, digested with the restriction enzymes shown to the left or kept undigested and analyzed in 2D gels. The corresponding immunograms are shown at the far left column with their corresponding interpretative diagrams to their right. Bubble arcs in red and simple-Y arcs in green. Linear molecules, recombinants and accumulated forms are shown in black. The simulation program 2D gel [19] was used to predict the shape of twelve consecutive RIs. For the BamHI-SwaI restriction fragment of the circular minichromosome pYAC_MEM_RFB+, if replication initiates at ARS4 and both forks proceed unconstrained (i), if replication initiates at ARS4, the leftward moving fork stalls permanently at CEN6 and the rightward moving fork moves unconstrained through the RFB (ii), and if replication initiates at ARS4, the leftward moving fork stalls transiently at CEN6 and the rightward moving fork stalls permanently either at the first or the second closely spaced sites of the RFB (iii). Below, for the linear minichromosome YAC_MEM_RFB+ on top, if replication initiates at ARS4 and both forks proceed unconstrained (i), if replication initiates at ARS4 and the rightward moving fork stalls permanently at the RFB (ii) and if replication initiates at the left telomere and the rightward moving fork stalls permanently at the RFB (iii). A linear map is shown on top of each series showing the relative positions of ARS4 (in green), CEN6 (in magenta) and the RFB (in red). The relative masses of the RIs are shown to the left. Red arrows indicate the transition mass of the RIs from bubbles to simple-Ys whereas blue arrows indicate the transition mass from simple-Ys to double-Ys.
    Figure Legend Snippet: Construction of pYAC_MEM_RFB+ and YAC_MEM_RFB+ and analysis of their replication intermediates. A: Name, mass and genetic map of the circular minichromosome. The relative positions of its most relevant features are indicated inside: The centromeric sequence CEN6, the autonomous replication sequence (ARS4), URA3, the lambda DNA marker sequence (L1), the ribosomal RFB, Tetrahymena telomeric repeats, HIS3, the lambda DNA marker sequence (L2), the ColE1 unidirectional origin (ColE1 Ori) and the ampicillin-resistance gene (AmpR). Outside, the relative positions of sites recognized by specific restriction endonucleases are indicated. B: The corresponding linear map of the restriction fragment used and its size. Below, the genetic map of YAC_MEM_RFB+. C: Synchronized top2-td cells transformed with either pYAC_MEM_RFB+ or YAC_MEM_RFB+ were fixed 40 minutes after their release into the S-phase. The DNA was isolated, digested with the restriction enzymes shown to the left or kept undigested and analyzed in 2D gels. The corresponding immunograms are shown at the far left column with their corresponding interpretative diagrams to their right. Bubble arcs in red and simple-Y arcs in green. Linear molecules, recombinants and accumulated forms are shown in black. The simulation program 2D gel [19] was used to predict the shape of twelve consecutive RIs. For the BamHI-SwaI restriction fragment of the circular minichromosome pYAC_MEM_RFB+, if replication initiates at ARS4 and both forks proceed unconstrained (i), if replication initiates at ARS4, the leftward moving fork stalls permanently at CEN6 and the rightward moving fork moves unconstrained through the RFB (ii), and if replication initiates at ARS4, the leftward moving fork stalls transiently at CEN6 and the rightward moving fork stalls permanently either at the first or the second closely spaced sites of the RFB (iii). Below, for the linear minichromosome YAC_MEM_RFB+ on top, if replication initiates at ARS4 and both forks proceed unconstrained (i), if replication initiates at ARS4 and the rightward moving fork stalls permanently at the RFB (ii) and if replication initiates at the left telomere and the rightward moving fork stalls permanently at the RFB (iii). A linear map is shown on top of each series showing the relative positions of ARS4 (in green), CEN6 (in magenta) and the RFB (in red). The relative masses of the RIs are shown to the left. Red arrows indicate the transition mass of the RIs from bubbles to simple-Ys whereas blue arrows indicate the transition mass from simple-Ys to double-Ys.

    Techniques Used: Sequencing, Lambda DNA Preparation, Marker, Transformation Assay, Isolation, Two-Dimensional Gel Electrophoresis

    4) Product Images from "The abundance of Fob1 modulates the efficiency of rRFBs to stall replication forks"

    Article Title: The abundance of Fob1 modulates the efficiency of rRFBs to stall replication forks

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkx655

    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_MEM_3rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_MEM_3rRFBs+ (8908 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note the insertion of an EcoRI fragment containing the three putative Fob1 binding sites expected to act as RFBs (indicated in red), described by Kobayashi ( 20 ). ( B ) Map of the 3708 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with SwaI and BamHI showing the relative position of the three putative RFBs. ( C ) Map of the 5186 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with EcoRV and MluI showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3708 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5186-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them.
    Figure Legend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_MEM_3rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_MEM_3rRFBs+ (8908 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note the insertion of an EcoRI fragment containing the three putative Fob1 binding sites expected to act as RFBs (indicated in red), described by Kobayashi ( 20 ). ( B ) Map of the 3708 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with SwaI and BamHI showing the relative position of the three putative RFBs. ( C ) Map of the 5186 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with EcoRV and MluI showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3708 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5186-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them.

    Techniques Used: Two-Dimensional Gel Electrophoresis, Binding Assay, Activated Clotting Time Assay, Generated

    Genetic map and 2D gel analysis of linear fragments corresponding to pYAC_MEM. ( A ) Genetic map of pYAC_MEM (7966 bp) showing its most relevant features: clockwise starting with the replication origin ARS4 (indicated in green), URA3 gene active in Saccharomyces cerevisiae (indicated in light blue), L1 lambda DNA used for hybridization (indicated in yellow), HIS3 gene active in S. cerevisiae (indicated in light blue), L2 lambda DNA used for hybridization (indicated in yellow), the ColE1 replication origin active only in Escherichia coli (indicated in gray), the ampicillin resistance gene active only in E. coli (indicated in gray) and the budding yeast centromeric sequence CEN6 (indicated in orange). The sites for specific restriction endonucleases are indicated outside the map. In addition, a magenta triangle points the position located 180° apart from the replication origin ARS4. ( B ) Map of the 2764-bp linear fragment generated by digestion of pYAC_MEM with SwaI and BamHI. ( C ) Map of the 4245-bp linear fragment generated by digestion of pYAC_MEM with EcoRV and MluI. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 2764 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 4245-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). De-localized termination signals are indicated in magenta.
    Figure Legend Snippet: Genetic map and 2D gel analysis of linear fragments corresponding to pYAC_MEM. ( A ) Genetic map of pYAC_MEM (7966 bp) showing its most relevant features: clockwise starting with the replication origin ARS4 (indicated in green), URA3 gene active in Saccharomyces cerevisiae (indicated in light blue), L1 lambda DNA used for hybridization (indicated in yellow), HIS3 gene active in S. cerevisiae (indicated in light blue), L2 lambda DNA used for hybridization (indicated in yellow), the ColE1 replication origin active only in Escherichia coli (indicated in gray), the ampicillin resistance gene active only in E. coli (indicated in gray) and the budding yeast centromeric sequence CEN6 (indicated in orange). The sites for specific restriction endonucleases are indicated outside the map. In addition, a magenta triangle points the position located 180° apart from the replication origin ARS4. ( B ) Map of the 2764-bp linear fragment generated by digestion of pYAC_MEM with SwaI and BamHI. ( C ) Map of the 4245-bp linear fragment generated by digestion of pYAC_MEM with EcoRV and MluI. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 2764 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 4245-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). De-localized termination signals are indicated in magenta.

    Techniques Used: Two-Dimensional Gel Electrophoresis, Lambda DNA Preparation, Hybridization, Sequencing, Generated

    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ isolated from cells that overexpress Fob1 and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the ten putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194 bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in ( D ) is presented in ( H ) indicating the height of the peaks. For comparison, the densitometric profile corresponding to the 3705-bp SwaI-BamHI of pYAC_AC_10rRFBs isolated from the top2-td strain shown in Figure 4H is presented on top.
    Figure Legend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ isolated from cells that overexpress Fob1 and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the ten putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194 bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in ( D ) is presented in ( H ) indicating the height of the peaks. For comparison, the densitometric profile corresponding to the 3705-bp SwaI-BamHI of pYAC_AC_10rRFBs isolated from the top2-td strain shown in Figure 4H is presented on top.

    Techniques Used: Two-Dimensional Gel Electrophoresis, Isolation, Binding Assay, Activated Clotting Time Assay, In Vivo, Generated

    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the 10 putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705-bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks.
    Figure Legend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the 10 putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705-bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks.

    Techniques Used: Two-Dimensional Gel Electrophoresis, Binding Assay, Activated Clotting Time Assay, In Vivo, Generated

    5) Product Images from "Topoisomerase 2 Is Dispensable for the Replication and Segregation of Small Yeast Artificial Chromosomes (YACs)"

    Article Title: Topoisomerase 2 Is Dispensable for the Replication and Segregation of Small Yeast Artificial Chromosomes (YACs)

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0104995

    Construction of pYAC_MEM_RFB+ and YAC_MEM_RFB+ and analysis of their replication intermediates. A: Name, mass and genetic map of the circular minichromosome. The relative positions of its most relevant features are indicated inside: The centromeric sequence CEN6, the autonomous replication sequence (ARS4), URA3, the lambda DNA marker sequence (L1), the ribosomal RFB, Tetrahymena telomeric repeats, HIS3, the lambda DNA marker sequence (L2), the ColE1 unidirectional origin (ColE1 Ori) and the ampicillin-resistance gene (AmpR). Outside, the relative positions of sites recognized by specific restriction endonucleases are indicated. B: The corresponding linear map of the restriction fragment used and its size. Below, the genetic map of YAC_MEM_RFB+. C: Synchronized top2-td cells transformed with either pYAC_MEM_RFB+ or YAC_MEM_RFB+ were fixed 40 minutes after their release into the S-phase. The DNA was isolated, digested with the restriction enzymes shown to the left or kept undigested and analyzed in 2D gels. The corresponding immunograms are shown at the far left column with their corresponding interpretative diagrams to their right. Bubble arcs in red and simple-Y arcs in green. Linear molecules, recombinants and accumulated forms are shown in black. The simulation program 2D gel [19] was used to predict the shape of twelve consecutive RIs. For the BamHI-SwaI restriction fragment of the circular minichromosome pYAC_MEM_RFB+, if replication initiates at ARS4 and both forks proceed unconstrained (i), if replication initiates at ARS4, the leftward moving fork stalls permanently at CEN6 and the rightward moving fork moves unconstrained through the RFB (ii), and if replication initiates at ARS4, the leftward moving fork stalls transiently at CEN6 and the rightward moving fork stalls permanently either at the first or the second closely spaced sites of the RFB (iii). Below, for the linear minichromosome YAC_MEM_RFB+ on top, if replication initiates at ARS4 and both forks proceed unconstrained (i), if replication initiates at ARS4 and the rightward moving fork stalls permanently at the RFB (ii) and if replication initiates at the left telomere and the rightward moving fork stalls permanently at the RFB (iii). A linear map is shown on top of each series showing the relative positions of ARS4 (in green), CEN6 (in magenta) and the RFB (in red). The relative masses of the RIs are shown to the left. Red arrows indicate the transition mass of the RIs from bubbles to simple-Ys whereas blue arrows indicate the transition mass from simple-Ys to double-Ys.
    Figure Legend Snippet: Construction of pYAC_MEM_RFB+ and YAC_MEM_RFB+ and analysis of their replication intermediates. A: Name, mass and genetic map of the circular minichromosome. The relative positions of its most relevant features are indicated inside: The centromeric sequence CEN6, the autonomous replication sequence (ARS4), URA3, the lambda DNA marker sequence (L1), the ribosomal RFB, Tetrahymena telomeric repeats, HIS3, the lambda DNA marker sequence (L2), the ColE1 unidirectional origin (ColE1 Ori) and the ampicillin-resistance gene (AmpR). Outside, the relative positions of sites recognized by specific restriction endonucleases are indicated. B: The corresponding linear map of the restriction fragment used and its size. Below, the genetic map of YAC_MEM_RFB+. C: Synchronized top2-td cells transformed with either pYAC_MEM_RFB+ or YAC_MEM_RFB+ were fixed 40 minutes after their release into the S-phase. The DNA was isolated, digested with the restriction enzymes shown to the left or kept undigested and analyzed in 2D gels. The corresponding immunograms are shown at the far left column with their corresponding interpretative diagrams to their right. Bubble arcs in red and simple-Y arcs in green. Linear molecules, recombinants and accumulated forms are shown in black. The simulation program 2D gel [19] was used to predict the shape of twelve consecutive RIs. For the BamHI-SwaI restriction fragment of the circular minichromosome pYAC_MEM_RFB+, if replication initiates at ARS4 and both forks proceed unconstrained (i), if replication initiates at ARS4, the leftward moving fork stalls permanently at CEN6 and the rightward moving fork moves unconstrained through the RFB (ii), and if replication initiates at ARS4, the leftward moving fork stalls transiently at CEN6 and the rightward moving fork stalls permanently either at the first or the second closely spaced sites of the RFB (iii). Below, for the linear minichromosome YAC_MEM_RFB+ on top, if replication initiates at ARS4 and both forks proceed unconstrained (i), if replication initiates at ARS4 and the rightward moving fork stalls permanently at the RFB (ii) and if replication initiates at the left telomere and the rightward moving fork stalls permanently at the RFB (iii). A linear map is shown on top of each series showing the relative positions of ARS4 (in green), CEN6 (in magenta) and the RFB (in red). The relative masses of the RIs are shown to the left. Red arrows indicate the transition mass of the RIs from bubbles to simple-Ys whereas blue arrows indicate the transition mass from simple-Ys to double-Ys.

    Techniques Used: Sequencing, Lambda DNA Preparation, Marker, Transformation Assay, Isolation, Two-Dimensional Gel Electrophoresis

    6) Product Images from "Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis"

    Article Title: Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis

    Journal: Nature protocols

    doi: 10.1038/nprot.2010.131

    Diagrammatic representation of an A-homology (A-box) arm. The example chosen is the gene Chat (encoding choline acetyltransferase). The 5′ primer used in the amplification of the Chat A-box was 5′ GGCGCGCC AAGGTGCTCTAGTGCTCTGATCCCAG 3′. The first eight nucleotides in this sequence do not correspond to the genomic sequence of Chat but represent an added Asc I recognition site sequence 5′-GGCGCGCC-3′. A key step in designing the 5′ primer is the addition of an AscI or MluI enzyme site at the front of the primer. It serves in a later step when the A-homology arm is ligated into an AscI and SwaI-digested pLD53.SC2 vector at its AscI or SwaI cloning sites. If an internal AscI recognition sequence is present within the homology sequence (can be checked with the DNASTAR program), a MluI recognition site, 5′-ACGCGT-3′, should be added to the end of the primer instead. The enzyme MluI is then used in the digestion step. The 3′ primer used for Cha t in the homology amplification step was 5′ CCTAGCGATTCTTAATCCAGAGTAGC 3′. This is the reverse-complement of the 3′ sequence highlighted in the figure.
    Figure Legend Snippet: Diagrammatic representation of an A-homology (A-box) arm. The example chosen is the gene Chat (encoding choline acetyltransferase). The 5′ primer used in the amplification of the Chat A-box was 5′ GGCGCGCC AAGGTGCTCTAGTGCTCTGATCCCAG 3′. The first eight nucleotides in this sequence do not correspond to the genomic sequence of Chat but represent an added Asc I recognition site sequence 5′-GGCGCGCC-3′. A key step in designing the 5′ primer is the addition of an AscI or MluI enzyme site at the front of the primer. It serves in a later step when the A-homology arm is ligated into an AscI and SwaI-digested pLD53.SC2 vector at its AscI or SwaI cloning sites. If an internal AscI recognition sequence is present within the homology sequence (can be checked with the DNASTAR program), a MluI recognition site, 5′-ACGCGT-3′, should be added to the end of the primer instead. The enzyme MluI is then used in the digestion step. The 3′ primer used for Cha t in the homology amplification step was 5′ CCTAGCGATTCTTAATCCAGAGTAGC 3′. This is the reverse-complement of the 3′ sequence highlighted in the figure.

    Techniques Used: Amplification, Sequencing, Plasmid Preparation, Clone Assay

    Related Articles

    Mouse Assay:

    Article Title: Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis
    Article Snippet: .. Both available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) pSV.RecA vector: available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) Swiss Webster female mice (Taconic) Bacterial artificial chromosomes (BACs in DH10B host bacteria; Invitrogen Corporation, BACPAC Resources at CHORI or Riken Bioresources Center) PIR1 chemically competent E. coli (Invitrogen, cat. no. C1010-10) PIR2 chemically competent E. coli (Invitrogen, cat. no. C1111-10) MAX efficiency DH5α-competent cells (Invitrogen, cat. no. 18258-012) PCR primers (Invitrogen and Biosynthesis; see REAGENT SETUP) AscI restriction endonuclease (New England Biolabs, cat. no. R0558L) EcoRI restriction endonuclease (New England Biolabs, cat. no. R0101L) MluI restriction endonuclease (New England Biolabs, cat. no. R0198L) SwaI restriction endonuclease (New England Biolabs, cat. no. R0604L) T4 DNA ligase (New England Biolabs, cat. no. M0202L) XmaI restriction endonuclease (New England Biolabs, cat. no. R0180L) PI-SceI endonuclease (New England Biolabs, cat. no. R0696S) λ-DNA-HindIII Digest (New England Biolabs, cat. no. N3012S) Low-range PFG marker DNA ladder (New England Biolabs, cat. no. NO350S) 2-log DNA ladder (New England Biolabs, cat. no. N3200L) 1-Butanol (Fisher Scientific, cat. no. A399) 2-Propanol (Isopropanol, Fisher Scientific, cat. no. A416) Ammonium acetate (Fisher Scientific, cat. no. A637) Ampicillin (amp; Sigma-Aldrich, cat. no. A9518; see REAGENT SETUP) Calcium chloride dihydrate (CaCl2 , Fisher Scientific, cat. no. C70–500) Cesium chloride (CsCl, Fischer Scientific, cat. no. BP1595-500) Chloramphenicol (chlor; Sigma-Aldrich, cat. no. C0378; see REAGENT SETUP) Chloroform (Fisher Scientific, cat. no. C298–500) Ethidium bromide solution (10 mg ml−1 ; Sigma-Aldrich, cat. no. E1510) ! .. Ethanol (Pharmco-AAPER) EDTA (Sigma-Aldrich, cat. no. E5134) FailSafe PCR System (Epicentre, cat. no. FS99250) Glacial acetic acid (Fisher Scientific, cat. no. A38S) !

    Polymerase Chain Reaction:

    Article Title: Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis
    Article Snippet: .. Both available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) pSV.RecA vector: available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) Swiss Webster female mice (Taconic) Bacterial artificial chromosomes (BACs in DH10B host bacteria; Invitrogen Corporation, BACPAC Resources at CHORI or Riken Bioresources Center) PIR1 chemically competent E. coli (Invitrogen, cat. no. C1010-10) PIR2 chemically competent E. coli (Invitrogen, cat. no. C1111-10) MAX efficiency DH5α-competent cells (Invitrogen, cat. no. 18258-012) PCR primers (Invitrogen and Biosynthesis; see REAGENT SETUP) AscI restriction endonuclease (New England Biolabs, cat. no. R0558L) EcoRI restriction endonuclease (New England Biolabs, cat. no. R0101L) MluI restriction endonuclease (New England Biolabs, cat. no. R0198L) SwaI restriction endonuclease (New England Biolabs, cat. no. R0604L) T4 DNA ligase (New England Biolabs, cat. no. M0202L) XmaI restriction endonuclease (New England Biolabs, cat. no. R0180L) PI-SceI endonuclease (New England Biolabs, cat. no. R0696S) λ-DNA-HindIII Digest (New England Biolabs, cat. no. N3012S) Low-range PFG marker DNA ladder (New England Biolabs, cat. no. NO350S) 2-log DNA ladder (New England Biolabs, cat. no. N3200L) 1-Butanol (Fisher Scientific, cat. no. A399) 2-Propanol (Isopropanol, Fisher Scientific, cat. no. A416) Ammonium acetate (Fisher Scientific, cat. no. A637) Ampicillin (amp; Sigma-Aldrich, cat. no. A9518; see REAGENT SETUP) Calcium chloride dihydrate (CaCl2 , Fisher Scientific, cat. no. C70–500) Cesium chloride (CsCl, Fischer Scientific, cat. no. BP1595-500) Chloramphenicol (chlor; Sigma-Aldrich, cat. no. C0378; see REAGENT SETUP) Chloroform (Fisher Scientific, cat. no. C298–500) Ethidium bromide solution (10 mg ml−1 ; Sigma-Aldrich, cat. no. E1510) ! .. Ethanol (Pharmco-AAPER) EDTA (Sigma-Aldrich, cat. no. E5134) FailSafe PCR System (Epicentre, cat. no. FS99250) Glacial acetic acid (Fisher Scientific, cat. no. A38S) !

    Article Title: Heat Shock-Enhanced Conjugation Efficiency in Standard Campylobacter jejuni Strains
    Article Snippet: .. The recombinant plasmids were subsequently digested with SwaI (NEB) to release a 639-bp fragment containing a CRISPR array; the backbone fragment was then ligated with tetO PCR product. .. The resulting suicide plasmid was introduced into C. jejuni NCTC 11168 by natural transformation ( ).

    Incubation:

    Article Title: Topoisomerase 2 Is Dispensable for the Replication and Segregation of Small Yeast Artificial Chromosomes (YACs)
    Article Snippet: .. DNA treatments DNA was digested with BamHI, EcoRV, KpnI, NsiI, PvuI, PvuII, SalI, SwaI, XhoI, (New England Biolabs) and Nt.Bpu10I (Thermo Scientific) for at least 2 hours at 37°C except for SwaI that was incubated at 25°C. .. 2D agarose gel electrophoresis and southern transfer The first dimension was in a 0.35–0.5% agarose gel (Seakem; FMC Bioproducts) in TBE buffer (89 mM Tris-borate, 2 mM EDTA) at 0.9 V/cm at room temperature for 27–38 h. The second dimension was in a 0.9–1.2% agarose gel in TBE buffer and was run perpendicular to the first dimension.

    other:

    Article Title: The abundance of Fob1 modulates the efficiency of rRFBs to stall replication forks
    Article Snippet: DNA treatments DNA was digested with the restriction endonucleases BamHI, EcoRV, SwaI, FspI and MluI (New England Biolabs) for at least 2 h at 37°C except for SwaI that was digested at 25°C.

    CRISPR:

    Article Title: Heat Shock-Enhanced Conjugation Efficiency in Standard Campylobacter jejuni Strains
    Article Snippet: .. The recombinant plasmids were subsequently digested with SwaI (NEB) to release a 639-bp fragment containing a CRISPR array; the backbone fragment was then ligated with tetO PCR product. .. The resulting suicide plasmid was introduced into C. jejuni NCTC 11168 by natural transformation ( ).

    Marker:

    Article Title: Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis
    Article Snippet: .. Both available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) pSV.RecA vector: available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) Swiss Webster female mice (Taconic) Bacterial artificial chromosomes (BACs in DH10B host bacteria; Invitrogen Corporation, BACPAC Resources at CHORI or Riken Bioresources Center) PIR1 chemically competent E. coli (Invitrogen, cat. no. C1010-10) PIR2 chemically competent E. coli (Invitrogen, cat. no. C1111-10) MAX efficiency DH5α-competent cells (Invitrogen, cat. no. 18258-012) PCR primers (Invitrogen and Biosynthesis; see REAGENT SETUP) AscI restriction endonuclease (New England Biolabs, cat. no. R0558L) EcoRI restriction endonuclease (New England Biolabs, cat. no. R0101L) MluI restriction endonuclease (New England Biolabs, cat. no. R0198L) SwaI restriction endonuclease (New England Biolabs, cat. no. R0604L) T4 DNA ligase (New England Biolabs, cat. no. M0202L) XmaI restriction endonuclease (New England Biolabs, cat. no. R0180L) PI-SceI endonuclease (New England Biolabs, cat. no. R0696S) λ-DNA-HindIII Digest (New England Biolabs, cat. no. N3012S) Low-range PFG marker DNA ladder (New England Biolabs, cat. no. NO350S) 2-log DNA ladder (New England Biolabs, cat. no. N3200L) 1-Butanol (Fisher Scientific, cat. no. A399) 2-Propanol (Isopropanol, Fisher Scientific, cat. no. A416) Ammonium acetate (Fisher Scientific, cat. no. A637) Ampicillin (amp; Sigma-Aldrich, cat. no. A9518; see REAGENT SETUP) Calcium chloride dihydrate (CaCl2 , Fisher Scientific, cat. no. C70–500) Cesium chloride (CsCl, Fischer Scientific, cat. no. BP1595-500) Chloramphenicol (chlor; Sigma-Aldrich, cat. no. C0378; see REAGENT SETUP) Chloroform (Fisher Scientific, cat. no. C298–500) Ethidium bromide solution (10 mg ml−1 ; Sigma-Aldrich, cat. no. E1510) ! .. Ethanol (Pharmco-AAPER) EDTA (Sigma-Aldrich, cat. no. E5134) FailSafe PCR System (Epicentre, cat. no. FS99250) Glacial acetic acid (Fisher Scientific, cat. no. A38S) !

    Transformation Assay:

    Article Title: Toward a genetic system in the marine cyanobacterium Prochlorococcus
    Article Snippet: .. Both pBAMD1-4 and the insert were digested with EcoRI-HF and SwaI-HF (New England Biolabs #R0604S and # R3101S), ligated, and transformed in PIR1 E. coli as described above. ..

    Recombinant:

    Article Title: Heat Shock-Enhanced Conjugation Efficiency in Standard Campylobacter jejuni Strains
    Article Snippet: .. The recombinant plasmids were subsequently digested with SwaI (NEB) to release a 639-bp fragment containing a CRISPR array; the backbone fragment was then ligated with tetO PCR product. .. The resulting suicide plasmid was introduced into C. jejuni NCTC 11168 by natural transformation ( ).

    Plasmid Preparation:

    Article Title: Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis
    Article Snippet: .. Both available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) pSV.RecA vector: available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) Swiss Webster female mice (Taconic) Bacterial artificial chromosomes (BACs in DH10B host bacteria; Invitrogen Corporation, BACPAC Resources at CHORI or Riken Bioresources Center) PIR1 chemically competent E. coli (Invitrogen, cat. no. C1010-10) PIR2 chemically competent E. coli (Invitrogen, cat. no. C1111-10) MAX efficiency DH5α-competent cells (Invitrogen, cat. no. 18258-012) PCR primers (Invitrogen and Biosynthesis; see REAGENT SETUP) AscI restriction endonuclease (New England Biolabs, cat. no. R0558L) EcoRI restriction endonuclease (New England Biolabs, cat. no. R0101L) MluI restriction endonuclease (New England Biolabs, cat. no. R0198L) SwaI restriction endonuclease (New England Biolabs, cat. no. R0604L) T4 DNA ligase (New England Biolabs, cat. no. M0202L) XmaI restriction endonuclease (New England Biolabs, cat. no. R0180L) PI-SceI endonuclease (New England Biolabs, cat. no. R0696S) λ-DNA-HindIII Digest (New England Biolabs, cat. no. N3012S) Low-range PFG marker DNA ladder (New England Biolabs, cat. no. NO350S) 2-log DNA ladder (New England Biolabs, cat. no. N3200L) 1-Butanol (Fisher Scientific, cat. no. A399) 2-Propanol (Isopropanol, Fisher Scientific, cat. no. A416) Ammonium acetate (Fisher Scientific, cat. no. A637) Ampicillin (amp; Sigma-Aldrich, cat. no. A9518; see REAGENT SETUP) Calcium chloride dihydrate (CaCl2 , Fisher Scientific, cat. no. C70–500) Cesium chloride (CsCl, Fischer Scientific, cat. no. BP1595-500) Chloramphenicol (chlor; Sigma-Aldrich, cat. no. C0378; see REAGENT SETUP) Chloroform (Fisher Scientific, cat. no. C298–500) Ethidium bromide solution (10 mg ml−1 ; Sigma-Aldrich, cat. no. E1510) ! .. Ethanol (Pharmco-AAPER) EDTA (Sigma-Aldrich, cat. no. E5134) FailSafe PCR System (Epicentre, cat. no. FS99250) Glacial acetic acid (Fisher Scientific, cat. no. A38S) !

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs swai
    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_MEM_3rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_MEM_3rRFBs+ (8908 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note the insertion of an EcoRI fragment containing the three putative Fob1 binding sites expected to act as RFBs (indicated in red), described by Kobayashi ( 20 ). ( B ) Map of the 3708 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with <t>SwaI</t> and <t>BamHI</t> showing the relative position of the three putative RFBs. ( C ) Map of the 5186 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with EcoRV and MluI showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3708 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5186-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them.
    Swai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/swai/product/New England Biolabs
    Average 95 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    swai - by Bioz Stars, 2020-09
    95/100 stars
      Buy from Supplier

    Image Search Results


    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_MEM_3rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_MEM_3rRFBs+ (8908 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note the insertion of an EcoRI fragment containing the three putative Fob1 binding sites expected to act as RFBs (indicated in red), described by Kobayashi ( 20 ). ( B ) Map of the 3708 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with SwaI and BamHI showing the relative position of the three putative RFBs. ( C ) Map of the 5186 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with EcoRV and MluI showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3708 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5186-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them.

    Journal: Nucleic Acids Research

    Article Title: The abundance of Fob1 modulates the efficiency of rRFBs to stall replication forks

    doi: 10.1093/nar/gkx655

    Figure Lengend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_MEM_3rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_MEM_3rRFBs+ (8908 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note the insertion of an EcoRI fragment containing the three putative Fob1 binding sites expected to act as RFBs (indicated in red), described by Kobayashi ( 20 ). ( B ) Map of the 3708 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with SwaI and BamHI showing the relative position of the three putative RFBs. ( C ) Map of the 5186 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with EcoRV and MluI showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3708 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5186-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them.

    Article Snippet: DNA treatments DNA was digested with the restriction endonucleases BamHI, EcoRV, SwaI, FspI and MluI (New England Biolabs) for at least 2 h at 37°C except for SwaI that was digested at 25°C.

    Techniques: Two-Dimensional Gel Electrophoresis, Binding Assay, Activated Clotting Time Assay, Generated

    Genetic map and 2D gel analysis of linear fragments corresponding to pYAC_MEM. ( A ) Genetic map of pYAC_MEM (7966 bp) showing its most relevant features: clockwise starting with the replication origin ARS4 (indicated in green), URA3 gene active in Saccharomyces cerevisiae (indicated in light blue), L1 lambda DNA used for hybridization (indicated in yellow), HIS3 gene active in S. cerevisiae (indicated in light blue), L2 lambda DNA used for hybridization (indicated in yellow), the ColE1 replication origin active only in Escherichia coli (indicated in gray), the ampicillin resistance gene active only in E. coli (indicated in gray) and the budding yeast centromeric sequence CEN6 (indicated in orange). The sites for specific restriction endonucleases are indicated outside the map. In addition, a magenta triangle points the position located 180° apart from the replication origin ARS4. ( B ) Map of the 2764-bp linear fragment generated by digestion of pYAC_MEM with SwaI and BamHI. ( C ) Map of the 4245-bp linear fragment generated by digestion of pYAC_MEM with EcoRV and MluI. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 2764 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 4245-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). De-localized termination signals are indicated in magenta.

    Journal: Nucleic Acids Research

    Article Title: The abundance of Fob1 modulates the efficiency of rRFBs to stall replication forks

    doi: 10.1093/nar/gkx655

    Figure Lengend Snippet: Genetic map and 2D gel analysis of linear fragments corresponding to pYAC_MEM. ( A ) Genetic map of pYAC_MEM (7966 bp) showing its most relevant features: clockwise starting with the replication origin ARS4 (indicated in green), URA3 gene active in Saccharomyces cerevisiae (indicated in light blue), L1 lambda DNA used for hybridization (indicated in yellow), HIS3 gene active in S. cerevisiae (indicated in light blue), L2 lambda DNA used for hybridization (indicated in yellow), the ColE1 replication origin active only in Escherichia coli (indicated in gray), the ampicillin resistance gene active only in E. coli (indicated in gray) and the budding yeast centromeric sequence CEN6 (indicated in orange). The sites for specific restriction endonucleases are indicated outside the map. In addition, a magenta triangle points the position located 180° apart from the replication origin ARS4. ( B ) Map of the 2764-bp linear fragment generated by digestion of pYAC_MEM with SwaI and BamHI. ( C ) Map of the 4245-bp linear fragment generated by digestion of pYAC_MEM with EcoRV and MluI. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 2764 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 4245-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). De-localized termination signals are indicated in magenta.

    Article Snippet: DNA treatments DNA was digested with the restriction endonucleases BamHI, EcoRV, SwaI, FspI and MluI (New England Biolabs) for at least 2 h at 37°C except for SwaI that was digested at 25°C.

    Techniques: Two-Dimensional Gel Electrophoresis, Lambda DNA Preparation, Hybridization, Sequencing, Generated

    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ isolated from cells that overexpress Fob1 and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the ten putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194 bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in ( D ) is presented in ( H ) indicating the height of the peaks. For comparison, the densitometric profile corresponding to the 3705-bp SwaI-BamHI of pYAC_AC_10rRFBs isolated from the top2-td strain shown in Figure 4H is presented on top.

    Journal: Nucleic Acids Research

    Article Title: The abundance of Fob1 modulates the efficiency of rRFBs to stall replication forks

    doi: 10.1093/nar/gkx655

    Figure Lengend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ isolated from cells that overexpress Fob1 and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the ten putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194 bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in ( D ) is presented in ( H ) indicating the height of the peaks. For comparison, the densitometric profile corresponding to the 3705-bp SwaI-BamHI of pYAC_AC_10rRFBs isolated from the top2-td strain shown in Figure 4H is presented on top.

    Article Snippet: DNA treatments DNA was digested with the restriction endonucleases BamHI, EcoRV, SwaI, FspI and MluI (New England Biolabs) for at least 2 h at 37°C except for SwaI that was digested at 25°C.

    Techniques: Two-Dimensional Gel Electrophoresis, Isolation, Binding Assay, Activated Clotting Time Assay, In Vivo, Generated

    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the 10 putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705-bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks.

    Journal: Nucleic Acids Research

    Article Title: The abundance of Fob1 modulates the efficiency of rRFBs to stall replication forks

    doi: 10.1093/nar/gkx655

    Figure Lengend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the 10 putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705-bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks.

    Article Snippet: DNA treatments DNA was digested with the restriction endonucleases BamHI, EcoRV, SwaI, FspI and MluI (New England Biolabs) for at least 2 h at 37°C except for SwaI that was digested at 25°C.

    Techniques: Two-Dimensional Gel Electrophoresis, Binding Assay, Activated Clotting Time Assay, In Vivo, Generated

    Genomic differences in PAO1 sublines. (A) PFGE of SwaI- and PacI-digested DNA of PAO1 sublines PAO1-DSM (lanes a) and PAO1-UW (lanes b). Restriction fragments that are altered due to the chromosomal inversion are labeled. (B) Circular maps of PAO1 sublines

    Journal: Journal of Bacteriology

    Article Title: Genome Diversity of Pseudomonas aeruginosa PAO1 Laboratory Strains ▿ PAO1 Laboratory Strains ▿ †

    doi: 10.1128/JB.01515-09

    Figure Lengend Snippet: Genomic differences in PAO1 sublines. (A) PFGE of SwaI- and PacI-digested DNA of PAO1 sublines PAO1-DSM (lanes a) and PAO1-UW (lanes b). Restriction fragments that are altered due to the chromosomal inversion are labeled. (B) Circular maps of PAO1 sublines

    Article Snippet: Agarose plugs containing high-molecular-weight DNA were prepared by embedding 2 × 109 , 5 × 109 , or 1 × 1010 bacterial cells/ml in low-melting-point agarose (Sigma), followed by proteinase K digestion at 56°C for 48 h. Restriction digests of these agarose plugs with SwaI, PacI, DpnI, and SpeI were done as described previously , using the respective restriction buffer recommended by the manufacturer (New England Biolabs).

    Techniques: Labeling

    Construction of pYAC_MEM_RFB+ and YAC_MEM_RFB+ and analysis of their replication intermediates. A: Name, mass and genetic map of the circular minichromosome. The relative positions of its most relevant features are indicated inside: The centromeric sequence CEN6, the autonomous replication sequence (ARS4), URA3, the lambda DNA marker sequence (L1), the ribosomal RFB, Tetrahymena telomeric repeats, HIS3, the lambda DNA marker sequence (L2), the ColE1 unidirectional origin (ColE1 Ori) and the ampicillin-resistance gene (AmpR). Outside, the relative positions of sites recognized by specific restriction endonucleases are indicated. B: The corresponding linear map of the restriction fragment used and its size. Below, the genetic map of YAC_MEM_RFB+. C: Synchronized top2-td cells transformed with either pYAC_MEM_RFB+ or YAC_MEM_RFB+ were fixed 40 minutes after their release into the S-phase. The DNA was isolated, digested with the restriction enzymes shown to the left or kept undigested and analyzed in 2D gels. The corresponding immunograms are shown at the far left column with their corresponding interpretative diagrams to their right. Bubble arcs in red and simple-Y arcs in green. Linear molecules, recombinants and accumulated forms are shown in black. The simulation program 2D gel [19] was used to predict the shape of twelve consecutive RIs. For the BamHI-SwaI restriction fragment of the circular minichromosome pYAC_MEM_RFB+, if replication initiates at ARS4 and both forks proceed unconstrained (i), if replication initiates at ARS4, the leftward moving fork stalls permanently at CEN6 and the rightward moving fork moves unconstrained through the RFB (ii), and if replication initiates at ARS4, the leftward moving fork stalls transiently at CEN6 and the rightward moving fork stalls permanently either at the first or the second closely spaced sites of the RFB (iii). Below, for the linear minichromosome YAC_MEM_RFB+ on top, if replication initiates at ARS4 and both forks proceed unconstrained (i), if replication initiates at ARS4 and the rightward moving fork stalls permanently at the RFB (ii) and if replication initiates at the left telomere and the rightward moving fork stalls permanently at the RFB (iii). A linear map is shown on top of each series showing the relative positions of ARS4 (in green), CEN6 (in magenta) and the RFB (in red). The relative masses of the RIs are shown to the left. Red arrows indicate the transition mass of the RIs from bubbles to simple-Ys whereas blue arrows indicate the transition mass from simple-Ys to double-Ys.

    Journal: PLoS ONE

    Article Title: Topoisomerase 2 Is Dispensable for the Replication and Segregation of Small Yeast Artificial Chromosomes (YACs)

    doi: 10.1371/journal.pone.0104995

    Figure Lengend Snippet: Construction of pYAC_MEM_RFB+ and YAC_MEM_RFB+ and analysis of their replication intermediates. A: Name, mass and genetic map of the circular minichromosome. The relative positions of its most relevant features are indicated inside: The centromeric sequence CEN6, the autonomous replication sequence (ARS4), URA3, the lambda DNA marker sequence (L1), the ribosomal RFB, Tetrahymena telomeric repeats, HIS3, the lambda DNA marker sequence (L2), the ColE1 unidirectional origin (ColE1 Ori) and the ampicillin-resistance gene (AmpR). Outside, the relative positions of sites recognized by specific restriction endonucleases are indicated. B: The corresponding linear map of the restriction fragment used and its size. Below, the genetic map of YAC_MEM_RFB+. C: Synchronized top2-td cells transformed with either pYAC_MEM_RFB+ or YAC_MEM_RFB+ were fixed 40 minutes after their release into the S-phase. The DNA was isolated, digested with the restriction enzymes shown to the left or kept undigested and analyzed in 2D gels. The corresponding immunograms are shown at the far left column with their corresponding interpretative diagrams to their right. Bubble arcs in red and simple-Y arcs in green. Linear molecules, recombinants and accumulated forms are shown in black. The simulation program 2D gel [19] was used to predict the shape of twelve consecutive RIs. For the BamHI-SwaI restriction fragment of the circular minichromosome pYAC_MEM_RFB+, if replication initiates at ARS4 and both forks proceed unconstrained (i), if replication initiates at ARS4, the leftward moving fork stalls permanently at CEN6 and the rightward moving fork moves unconstrained through the RFB (ii), and if replication initiates at ARS4, the leftward moving fork stalls transiently at CEN6 and the rightward moving fork stalls permanently either at the first or the second closely spaced sites of the RFB (iii). Below, for the linear minichromosome YAC_MEM_RFB+ on top, if replication initiates at ARS4 and both forks proceed unconstrained (i), if replication initiates at ARS4 and the rightward moving fork stalls permanently at the RFB (ii) and if replication initiates at the left telomere and the rightward moving fork stalls permanently at the RFB (iii). A linear map is shown on top of each series showing the relative positions of ARS4 (in green), CEN6 (in magenta) and the RFB (in red). The relative masses of the RIs are shown to the left. Red arrows indicate the transition mass of the RIs from bubbles to simple-Ys whereas blue arrows indicate the transition mass from simple-Ys to double-Ys.

    Article Snippet: DNA treatments DNA was digested with BamHI, EcoRV, KpnI, NsiI, PvuI, PvuII, SalI, SwaI, XhoI, (New England Biolabs) and Nt.Bpu10I (Thermo Scientific) for at least 2 hours at 37°C except for SwaI that was incubated at 25°C.

    Techniques: Sequencing, Lambda DNA Preparation, Marker, Transformation Assay, Isolation, Two-Dimensional Gel Electrophoresis