acli  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    AclI
    Description:
    AclI 1 500 units
    Catalog Number:
    r0598l
    Price:
    282
    Size:
    1 500 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs acli
    AclI
    AclI 1 500 units
    https://www.bioz.com/result/acli/product/New England Biolabs
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    acli - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Rad51 Promoter-Targeted Gene Therapy Is Effective for In Vivo Visualization and Treatment of Cancer
    Article Snippet: DNA plasmids containing the 6,532-bp Rad51 regulatory region, containing nucleotides 2,931 bp upstream to 3,601 bp downstream to the start of transcription, controlling the expression of firefly luciferase, green fluorescent protein (GFP), or bacteria diphtheria toxin A (DTA), were cloned and constructed as previously described. .. HeLa cells stably expressing firefly luciferase, termed HeLa-Luc, were made by transfecting HeLa cells at 50% confluence with 2 µg of Acl I (New England Biolabs, Ipswich, MA) linearized pCDNA3-Lucferase (Addgene plasmid 18964, William G. Kaelin) using Fugene 6 transfection agent (Roche).

    Amplification:

    Article Title: CX3CR1 Receptor Polymorphisms, Th1 Cell Recruitment, and Acute Myocardial Infarction Outcome: Looking for a Link
    Article Snippet: Amplification reactions were performed using 35 cycles of 95°C, 69°C, and 72°C for 30 seconds each, preceded by a single cycle of 95°C for 3 minutes and followed by a single cycle of 72°C for 10 minutes. .. In order to type the alleles at codons 249 and 280, 5 μ L of PCR reaction was digested, respectively, with Acl I (New England Biolabs, Beverly, MA) or BsbmB1 (New England Biolabs, Beverly, MA) in 20 μ L of reaction as previously described [ ].

    Article Title: Molecular evidence of iron limitation and availability in the global diazotroph Trichodesmium
    Article Snippet: Briefly, cDNA was amplified from all KM0701 and SJ0609 stations (where prior qRT-PCR detected Tten isiB ) using Tten isiB primers at a concentration of 200 nmol l−1 , BIO-X-ACT Short Mix (Bioline, London, UK) at 1 × concentration in a 20 μl reaction with 1–2 nmol l−1 template on a Mastercycler thermal cycler (Eppendorf AG). .. For the Acl I restriction digest, 5 μl of PCR product was incubated with 7.5 units of Acl I (New England Biolabs) and 1 × NEB4 buffer in a final volume of 45 μl for 3 h at 37 °C.

    Article Title: FPA, a Gene Involved in Floral Induction in Arabidopsis, Encodes a Protein Containing RNA-Recognition Motifs
    Article Snippet: Cleaved amplified polymorphic sequences were designed for the alleles of fpa . fpa-1 can be identified using primers 5′-cacaaggtacga-ggcgccctatga-3′ and 5′-ccactgatccatctcttcctggaa-3′. .. These primers result in a 100-bp fragment that is cleaved with AclI (New England Biolabs, Beverly, MA) to yield 76- and 24-nucleotide fragments in the wild type but is not cleaved in fpa-1 . fpa-2 can be identified using 5′-ttgtgttatcttcaggaacac-3′ and 5′-ctagtaacaagagacatactt-3′.

    Article Title: Risk stratification of adult T‐cell leukemia/lymphoma using immunophenotyping
    Article Snippet: Briefly, genomic DNA is digested with four restriction enzymes, AclI, ApaLI, EcoRI, and PciI, (New England Biolab, UK) that do not cut HTLV‐1, generating DNA fragments with an average size of 1000 bp. .. The sequences flanking the integration sites of the virus are then amplified using two HTLV‐1‐specific primers and two vectorette‐specific primers.

    Stable Transfection:

    Article Title: Rad51 Promoter-Targeted Gene Therapy Is Effective for In Vivo Visualization and Treatment of Cancer
    Article Snippet: .. HeLa cells stably expressing firefly luciferase, termed HeLa-Luc, were made by transfecting HeLa cells at 50% confluence with 2 µg of Acl I (New England Biolabs, Ipswich, MA) linearized pCDNA3-Lucferase (Addgene plasmid 18964, William G. Kaelin) using Fugene 6 transfection agent (Roche). .. Twenty-four hours after transfection, cells were selected for antibiotic resistance by replacing the media with new media containing Geneticin at a final concentrating of 2 mg/ml.

    Polymerase Chain Reaction:

    Article Title: CX3CR1 Receptor Polymorphisms, Th1 Cell Recruitment, and Acute Myocardial Infarction Outcome: Looking for a Link
    Article Snippet: .. In order to type the alleles at codons 249 and 280, 5 μ L of PCR reaction was digested, respectively, with Acl I (New England Biolabs, Beverly, MA) or BsbmB1 (New England Biolabs, Beverly, MA) in 20 μ L of reaction as previously described [ ]. .. In order to evaluate the efficiency of endonucleases enzymes, control DNA with Acl I and Bst 4CI restriction sites was used, and DNA was loaded at different times on agarose gel.

    Article Title: Epigenetic regulation of Sox4 during palate development
    Article Snippet: The efficacy of DNA methylation was assessed by digestion of the unmethylated and methylated plasmids with Acl I (Cat. No. R0598S; New England BioLabs) and Bst UI (Cat. No. R0518S; New England BioLabs). .. The plasmids were purified using Qiagen's PCR kit and the DNA used for transfection in MEMM cells, as described above.

    Article Title: Molecular evidence of iron limitation and availability in the global diazotroph Trichodesmium
    Article Snippet: .. For the Acl I restriction digest, 5 μl of PCR product was incubated with 7.5 units of Acl I (New England Biolabs) and 1 × NEB4 buffer in a final volume of 45 μl for 3 h at 37 °C. .. Uncut and cut PCR products were run side by side on a 1.5% agarose gel and imaged using GeneSnap imaging software on a ChemiGenius2 gel documentation system (Synoptics Ltd, Cambridge, UK).

    Article Title: FPA, a Gene Involved in Floral Induction in Arabidopsis, Encodes a Protein Containing RNA-Recognition Motifs
    Article Snippet: These primers result in a 100-bp fragment that is cleaved with AclI (New England Biolabs, Beverly, MA) to yield 76- and 24-nucleotide fragments in the wild type but is not cleaved in fpa-1 . fpa-2 can be identified using 5′-ttgtgttatcttcaggaacac-3′ and 5′-ctagtaacaagagacatactt-3′. .. These primers give a 100-bp PCR product that in fpa-2 cleaves at 22 bp with BfaI (New England Biolabs) but that is not cleaved in the wild type.

    Article Title: Two Distinct Genetic Elements Are Responsible for erm(TR)-Mediated Erythromycin Resistance in Tetracycline-Susceptible and Tetracycline-Resistant Strains of Streptococcus pyogenes ▿ ▿ †
    Article Snippet: .. Genomic DNA digested with endonucleases MunI, HindIII (Roche Applied Science, Basel, Switzerland), BanI, Hpy188I, or AclI (New England Biolabs, Ipswich, MA) was ligated and used as the template in the PCR assays. .. Overlapping fragments of the erm (TR)-carrying elements were obtained by PCR assays and primer walking techniques using suitable primer pairs.

    Article Title: Geographic separation and genetic differentiation of populations are not coupled with niche differentiation in threatened Kaiser’s spotted newt (Neurergus kaiseri)
    Article Snippet: We performed double-digest Restriction Site Associated DNA sequencing (ddRADseq ) preparing the library as follows : 1 μg of DNA from each individual was double-digested using the PstI-HF and AclI restriction enzymes (NewEngland Biolabs) and modified Illumina adaptors with unique barcodes for each individual were ligated to obtained DNA fragments. .. Finally, enrichment PCR was performed to amplify the library using forward and reverse RAD primers.

    Autoradiography:

    Article Title: EnD-Seq and AppEnD: sequencing 3′ ends to identify nontemplated tails and degradation intermediates
    Article Snippet: Briefly, the probe was generated by end labeling H2a DNA digested with AclI with α-32 P-dCTP and Klenow Polymerase (NEB). .. Following digestion by S1 nuclease (Promega), protected DNA fragments were resolved on a 6% acrylamide-7M Urea gel and visualized by autoradiography.

    Quantitative RT-PCR:

    Article Title: Molecular evidence of iron limitation and availability in the global diazotroph Trichodesmium
    Article Snippet: Briefly, cDNA was amplified from all KM0701 and SJ0609 stations (where prior qRT-PCR detected Tten isiB ) using Tten isiB primers at a concentration of 200 nmol l−1 , BIO-X-ACT Short Mix (Bioline, London, UK) at 1 × concentration in a 20 μl reaction with 1–2 nmol l−1 template on a Mastercycler thermal cycler (Eppendorf AG). .. For the Acl I restriction digest, 5 μl of PCR product was incubated with 7.5 units of Acl I (New England Biolabs) and 1 × NEB4 buffer in a final volume of 45 μl for 3 h at 37 °C.

    Real-time Polymerase Chain Reaction:

    Article Title: Neutralizing the function of a ?-globin-associated cis-regulatory DNA element using an artificial zinc finger DNA-binding domain
    Article Snippet: The plasmid pMSCV-neo containing the −90 β-ZF-DBD was linearized with Acl I (NEB), and purified from an agarose gel using the Qiagen gel extraction kit, resuspended in injection buffer at a concentration of 2 ng/μL, and injected into FvB oocytes as described previously ( ). .. The cDNA was analyzed by qPCR using primers specific for the βmin-globin gene as described previously and using primers specific for the −90 β-ZF-DBD cDNA: 5′-CTCGAGCCCGGGGAGAAAC-3′ (US) and 5′-TCACTTGTCATCGTCGTCCT-3′ (DS).

    Article Title: Prenatal Exposure to the Environmental Obesogen Tributyltin Predisposes Multipotent Stem Cells to Become Adipocytes
    Article Snippet: DNA (10 μg) was digested with excess Aci I or Acl I (New England Biolabs, Beverly, MA). .. The occurrence of methylation-sensitive digestion was assayed by QPCR with primers designed to span the three Aci I restriction sites for the study of the methylation status of Fapb4 promoter/enhancer region (Fapb4-Met1-F/R: ccttcagtcagtgtgggtttgc/ ggtggtgtcatcgggaaaatg; Fapb4-Met2-F/R: cacacacacacacacacacaca/ gcattacttttattttggttctggta; and Fapb4-Met3-F/R: cagcgtaactcaccaccacca/ tgcccacagagcatcataacc), and primers designed to span the Acl I restriction site for the study of the methylation status of PPARγ2 (PPARγ2-Met1-F/R: cacgcccctcacagaacagt/ tgggaataaacacagaaagaatcagg).

    Two Tailed Test:

    Article Title: Epigenetic regulation of Sox4 during palate development
    Article Snippet: The efficacy of DNA methylation was assessed by digestion of the unmethylated and methylated plasmids with Acl I (Cat. No. R0598S; New England BioLabs) and Bst UI (Cat. No. R0518S; New England BioLabs). .. Statistical significance was analyzed by unpaired, two-tailed Student's t-test using GraphPad software.

    Luciferase:

    Article Title: Rad51 Promoter-Targeted Gene Therapy Is Effective for In Vivo Visualization and Treatment of Cancer
    Article Snippet: .. HeLa cells stably expressing firefly luciferase, termed HeLa-Luc, were made by transfecting HeLa cells at 50% confluence with 2 µg of Acl I (New England Biolabs, Ipswich, MA) linearized pCDNA3-Lucferase (Addgene plasmid 18964, William G. Kaelin) using Fugene 6 transfection agent (Roche). .. Twenty-four hours after transfection, cells were selected for antibiotic resistance by replacing the media with new media containing Geneticin at a final concentrating of 2 mg/ml.

    Activity Assay:

    Article Title: Epigenetic regulation of Sox4 during palate development
    Article Snippet: Thus, any effect on promoter activity can be directly attributed to CpG residues present in the insert and not to the vector. .. The efficacy of DNA methylation was assessed by digestion of the unmethylated and methylated plasmids with Acl I (Cat. No. R0598S; New England BioLabs) and Bst UI (Cat. No. R0518S; New England BioLabs).

    Article Title: Rad51 Promoter-Targeted Gene Therapy Is Effective for In Vivo Visualization and Treatment of Cancer
    Article Snippet: HeLa cells stably expressing firefly luciferase, termed HeLa-Luc, were made by transfecting HeLa cells at 50% confluence with 2 µg of Acl I (New England Biolabs, Ipswich, MA) linearized pCDNA3-Lucferase (Addgene plasmid 18964, William G. Kaelin) using Fugene 6 transfection agent (Roche). .. After two weeks on selection, antibiotic resistant clones with strong luciferase activity were selected using the Luciferase Assay System (Promega, Madison, WI) on a GloMax 20/20 Luminometer (Promega).

    Expressing:

    Article Title: Rad51 Promoter-Targeted Gene Therapy Is Effective for In Vivo Visualization and Treatment of Cancer
    Article Snippet: .. HeLa cells stably expressing firefly luciferase, termed HeLa-Luc, were made by transfecting HeLa cells at 50% confluence with 2 µg of Acl I (New England Biolabs, Ipswich, MA) linearized pCDNA3-Lucferase (Addgene plasmid 18964, William G. Kaelin) using Fugene 6 transfection agent (Roche). .. Twenty-four hours after transfection, cells were selected for antibiotic resistance by replacing the media with new media containing Geneticin at a final concentrating of 2 mg/ml.

    Modification:

    Article Title: Geographic separation and genetic differentiation of populations are not coupled with niche differentiation in threatened Kaiser’s spotted newt (Neurergus kaiseri)
    Article Snippet: .. We performed double-digest Restriction Site Associated DNA sequencing (ddRADseq ) preparing the library as follows : 1 μg of DNA from each individual was double-digested using the PstI-HF and AclI restriction enzymes (NewEngland Biolabs) and modified Illumina adaptors with unique barcodes for each individual were ligated to obtained DNA fragments. .. Samples were multiplexed (pooled) and a Pippin Prep was used to select for fragments with a size around a tight range of 383 bp, based on the fragment length distribution identified using a 2200 TapeStation instrument (Agilent Technologies).

    Transformation Assay:

    Article Title: Rad51 Promoter-Targeted Gene Therapy Is Effective for In Vivo Visualization and Treatment of Cancer
    Article Snippet: DNA plasmids for use in in vivo delivery were produced using the EndoFree Plasmid Maxi Kit (Qiagen, Valencia, CA) on MAX Efficiency Stbl2 (Invitrogen, Carlsbad, CA) competent cells transformed with the respective plasmid. .. HeLa cells stably expressing firefly luciferase, termed HeLa-Luc, were made by transfecting HeLa cells at 50% confluence with 2 µg of Acl I (New England Biolabs, Ipswich, MA) linearized pCDNA3-Lucferase (Addgene plasmid 18964, William G. Kaelin) using Fugene 6 transfection agent (Roche).

    DNA Methylation Assay:

    Article Title: Epigenetic regulation of Sox4 during palate development
    Article Snippet: .. The efficacy of DNA methylation was assessed by digestion of the unmethylated and methylated plasmids with Acl I (Cat. No. R0598S; New England BioLabs) and Bst UI (Cat. No. R0518S; New England BioLabs). .. The plasmids were purified using Qiagen's PCR kit and the DNA used for transfection in MEMM cells, as described above.

    Derivative Assay:

    Article Title: Prenatal Exposure to the Environmental Obesogen Tributyltin Predisposes Multipotent Stem Cells to Become Adipocytes
    Article Snippet: The PPARγ2 promoter/enhancer region examined (GenBank accession no. ) spanned 11 potentially methylated cytosines within nucleotides −1500 to +1000 and contains one restriction site (PPARγ2-Met1) for the methylation-sensitive enzyme Acl I. Genomic DNA was isolated from undifferentiated mADSCs derived from animals exposed in utero to TBT or CMC by lysis in proteinase K (0.25 mg/ml) and sodium dodecyl sulfate 1% followed by phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation. .. DNA (10 μg) was digested with excess Aci I or Acl I (New England Biolabs, Beverly, MA).

    Gel Purification:

    Article Title: Conditional over-expression of PITX1 causes skeletal muscle dystrophy in mice
    Article Snippet: .. The backbone of the pBI-G -Pitx1 vector was removed via AclI and Asel (New England Biolabs, Ipswich, MA, USA) digestion, followed by gel purification with a GELase Agrose gel-digestion preparation kit (Epicentre Biotechnologies, Madison, WI, USA). .. The purified construct was microinjected (10 ng/μl) into the pronuclei of B6CBAF1 fertilized 0.5 day old mouse oocytes.

    Transfection:

    Article Title: Epigenetic regulation of Sox4 during palate development
    Article Snippet: This also facilitates methylation of the entire plasmid, obviating the need for first isolating and methylating the insert, then religating the methylated insert back into the vector, followed by isolation and purification of the ligated plasmid for transfection analysis. .. The efficacy of DNA methylation was assessed by digestion of the unmethylated and methylated plasmids with Acl I (Cat. No. R0598S; New England BioLabs) and Bst UI (Cat. No. R0518S; New England BioLabs).

    Article Title: Rad51 Promoter-Targeted Gene Therapy Is Effective for In Vivo Visualization and Treatment of Cancer
    Article Snippet: .. HeLa cells stably expressing firefly luciferase, termed HeLa-Luc, were made by transfecting HeLa cells at 50% confluence with 2 µg of Acl I (New England Biolabs, Ipswich, MA) linearized pCDNA3-Lucferase (Addgene plasmid 18964, William G. Kaelin) using Fugene 6 transfection agent (Roche). .. Twenty-four hours after transfection, cells were selected for antibiotic resistance by replacing the media with new media containing Geneticin at a final concentrating of 2 mg/ml.

    Inverse PCR:

    Article Title: Two Distinct Genetic Elements Are Responsible for erm(TR)-Mediated Erythromycin Resistance in Tetracycline-Susceptible and Tetracycline-Resistant Strains of Streptococcus pyogenes ▿ ▿ †
    Article Snippet: Inverse PCR ( ) was carried out to analyze unknown DNA regions. .. Genomic DNA digested with endonucleases MunI, HindIII (Roche Applied Science, Basel, Switzerland), BanI, Hpy188I, or AclI (New England Biolabs, Ipswich, MA) was ligated and used as the template in the PCR assays.

    Ligation:

    Article Title: Risk stratification of adult T‐cell leukemia/lymphoma using immunophenotyping
    Article Snippet: Briefly, genomic DNA is digested with four restriction enzymes, AclI, ApaLI, EcoRI, and PciI, (New England Biolab, UK) that do not cut HTLV‐1, generating DNA fragments with an average size of 1000 bp. .. Digestion is followed by ligation of a linker (with the same overhang sequence) to the digested DNA.

    Cell Culture:

    Article Title: Rad51 Promoter-Targeted Gene Therapy Is Effective for In Vivo Visualization and Treatment of Cancer
    Article Snippet: Cells were grown on treated polystyrene cell culture dishes (Corning) at 37 °C in 3% O2 , 5% CO2 , and 97% relative humidity in HERA Cell 240 incubators. .. HeLa cells stably expressing firefly luciferase, termed HeLa-Luc, were made by transfecting HeLa cells at 50% confluence with 2 µg of Acl I (New England Biolabs, Ipswich, MA) linearized pCDNA3-Lucferase (Addgene plasmid 18964, William G. Kaelin) using Fugene 6 transfection agent (Roche).

    Generated:

    Article Title: EnD-Seq and AppEnD: sequencing 3′ ends to identify nontemplated tails and degradation intermediates
    Article Snippet: .. Briefly, the probe was generated by end labeling H2a DNA digested with AclI with α-32 P-dCTP and Klenow Polymerase (NEB). .. After release from the TOPO TA vector (Invitrogen) by digestion with HindIII (NEB), the probe was gel purified and hybridized with the indicated RNA sample at either at 40°C overnight.

    Gel Extraction:

    Article Title: Neutralizing the function of a ?-globin-associated cis-regulatory DNA element using an artificial zinc finger DNA-binding domain
    Article Snippet: .. The plasmid pMSCV-neo containing the −90 β-ZF-DBD was linearized with Acl I (NEB), and purified from an agarose gel using the Qiagen gel extraction kit, resuspended in injection buffer at a concentration of 2 ng/μL, and injected into FvB oocytes as described previously ( ). .. After transfer to pseudopregnant recipients, embryos were taken at day 13.5 dpc and imaged with a stereomicroscope (Leica MZ16-FA, Houston, TX) and processed with Q-capture software (Q-imaging, BC, Canada).

    Imaging:

    Article Title: Molecular evidence of iron limitation and availability in the global diazotroph Trichodesmium
    Article Snippet: For the Acl I restriction digest, 5 μl of PCR product was incubated with 7.5 units of Acl I (New England Biolabs) and 1 × NEB4 buffer in a final volume of 45 μl for 3 h at 37 °C. .. Uncut and cut PCR products were run side by side on a 1.5% agarose gel and imaged using GeneSnap imaging software on a ChemiGenius2 gel documentation system (Synoptics Ltd, Cambridge, UK).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Molecular evidence of iron limitation and availability in the global diazotroph Trichodesmium
    Article Snippet: Using the Tten isiB sequences defined above from stations WP16 and WP14, we were able to screen our RT-PCR products from all stations for the presence of uncultured, novel Trichodesmium Tten phylotypes in our amplicons from other stations via the presence of two separate, conserved restriction sites ( ). .. For the Acl I restriction digest, 5 μl of PCR product was incubated with 7.5 units of Acl I (New England Biolabs) and 1 × NEB4 buffer in a final volume of 45 μl for 3 h at 37 °C.

    Injection:

    Article Title: Neutralizing the function of a ?-globin-associated cis-regulatory DNA element using an artificial zinc finger DNA-binding domain
    Article Snippet: .. The plasmid pMSCV-neo containing the −90 β-ZF-DBD was linearized with Acl I (NEB), and purified from an agarose gel using the Qiagen gel extraction kit, resuspended in injection buffer at a concentration of 2 ng/μL, and injected into FvB oocytes as described previously ( ). .. After transfer to pseudopregnant recipients, embryos were taken at day 13.5 dpc and imaged with a stereomicroscope (Leica MZ16-FA, Houston, TX) and processed with Q-capture software (Q-imaging, BC, Canada).

    Article Title: Conditional over-expression of PITX1 causes skeletal muscle dystrophy in mice
    Article Snippet: The backbone of the pBI-G -Pitx1 vector was removed via AclI and Asel (New England Biolabs, Ipswich, MA, USA) digestion, followed by gel purification with a GELase Agrose gel-digestion preparation kit (Epicentre Biotechnologies, Madison, WI, USA). .. The injected oocytes were then transferred to the oviducts of pseudopregnant ND4 outbred foster mothers.

    DNA Sequencing:

    Article Title: Geographic separation and genetic differentiation of populations are not coupled with niche differentiation in threatened Kaiser’s spotted newt (Neurergus kaiseri)
    Article Snippet: .. We performed double-digest Restriction Site Associated DNA sequencing (ddRADseq ) preparing the library as follows : 1 μg of DNA from each individual was double-digested using the PstI-HF and AclI restriction enzymes (NewEngland Biolabs) and modified Illumina adaptors with unique barcodes for each individual were ligated to obtained DNA fragments. .. Samples were multiplexed (pooled) and a Pippin Prep was used to select for fragments with a size around a tight range of 383 bp, based on the fragment length distribution identified using a 2200 TapeStation instrument (Agilent Technologies).

    In Vivo:

    Article Title: Rad51 Promoter-Targeted Gene Therapy Is Effective for In Vivo Visualization and Treatment of Cancer
    Article Snippet: DNA plasmids for use in in vivo delivery were produced using the EndoFree Plasmid Maxi Kit (Qiagen, Valencia, CA) on MAX Efficiency Stbl2 (Invitrogen, Carlsbad, CA) competent cells transformed with the respective plasmid. .. HeLa cells stably expressing firefly luciferase, termed HeLa-Luc, were made by transfecting HeLa cells at 50% confluence with 2 µg of Acl I (New England Biolabs, Ipswich, MA) linearized pCDNA3-Lucferase (Addgene plasmid 18964, William G. Kaelin) using Fugene 6 transfection agent (Roche).

    Methylation:

    Article Title: Epigenetic regulation of Sox4 during palate development
    Article Snippet: .. The efficacy of DNA methylation was assessed by digestion of the unmethylated and methylated plasmids with Acl I (Cat. No. R0598S; New England BioLabs) and Bst UI (Cat. No. R0518S; New England BioLabs). .. The plasmids were purified using Qiagen's PCR kit and the DNA used for transfection in MEMM cells, as described above.

    Article Title: Prenatal Exposure to the Environmental Obesogen Tributyltin Predisposes Multipotent Stem Cells to Become Adipocytes
    Article Snippet: Paragraph title: Methylation status of Fabp4 promoter/enhancer region ... DNA (10 μg) was digested with excess Aci I or Acl I (New England Biolabs, Beverly, MA).

    Isolation:

    Article Title: Epigenetic regulation of Sox4 during palate development
    Article Snippet: This also facilitates methylation of the entire plasmid, obviating the need for first isolating and methylating the insert, then religating the methylated insert back into the vector, followed by isolation and purification of the ligated plasmid for transfection analysis. .. The efficacy of DNA methylation was assessed by digestion of the unmethylated and methylated plasmids with Acl I (Cat. No. R0598S; New England BioLabs) and Bst UI (Cat. No. R0518S; New England BioLabs).

    Article Title: Prenatal Exposure to the Environmental Obesogen Tributyltin Predisposes Multipotent Stem Cells to Become Adipocytes
    Article Snippet: The PPARγ2 promoter/enhancer region examined (GenBank accession no. ) spanned 11 potentially methylated cytosines within nucleotides −1500 to +1000 and contains one restriction site (PPARγ2-Met1) for the methylation-sensitive enzyme Acl I. Genomic DNA was isolated from undifferentiated mADSCs derived from animals exposed in utero to TBT or CMC by lysis in proteinase K (0.25 mg/ml) and sodium dodecyl sulfate 1% followed by phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation. .. DNA (10 μg) was digested with excess Aci I or Acl I (New England Biolabs, Beverly, MA).

    Mouse Assay:

    Article Title: Neutralizing the function of a ?-globin-associated cis-regulatory DNA element using an artificial zinc finger DNA-binding domain
    Article Snippet: Paragraph title: Generation of Transient Transgenic Mice. ... The plasmid pMSCV-neo containing the −90 β-ZF-DBD was linearized with Acl I (NEB), and purified from an agarose gel using the Qiagen gel extraction kit, resuspended in injection buffer at a concentration of 2 ng/μL, and injected into FvB oocytes as described previously ( ).

    Article Title: Conditional over-expression of PITX1 causes skeletal muscle dystrophy in mice
    Article Snippet: To generate the TRE-Pitx1 mice, the Pitx1 coding sequence from MGC-13954 (ATCC) was subcloned into the pBI-G vector (Clontech, Mountain View, CA, USA) by Not1 and Sal1 digestion (Invitrogen, Carlsbad, CA, USA), followed by restriction site blunting with klenow DNA Polymerase I (Invitrogen, Carlsbad, CA, USA). .. The backbone of the pBI-G -Pitx1 vector was removed via AclI and Asel (New England Biolabs, Ipswich, MA, USA) digestion, followed by gel purification with a GELase Agrose gel-digestion preparation kit (Epicentre Biotechnologies, Madison, WI, USA).

    Article Title: Rad51 Promoter-Targeted Gene Therapy Is Effective for In Vivo Visualization and Treatment of Cancer
    Article Snippet: HeLa cells stably expressing firefly luciferase, termed HeLa-Luc, were made by transfecting HeLa cells at 50% confluence with 2 µg of Acl I (New England Biolabs, Ipswich, MA) linearized pCDNA3-Lucferase (Addgene plasmid 18964, William G. Kaelin) using Fugene 6 transfection agent (Roche). .. We used 8- to 12-week-old female athymic nude- Foxn1 nu mice to establish xenografts.

    Sequencing:

    Article Title: Conditional over-expression of PITX1 causes skeletal muscle dystrophy in mice
    Article Snippet: The insertion of the Pitx1 fragment into the vector was validated by nucleotide sequencing (Beckman Coulter, Danvers, MA, USA). .. The backbone of the pBI-G -Pitx1 vector was removed via AclI and Asel (New England Biolabs, Ipswich, MA, USA) digestion, followed by gel purification with a GELase Agrose gel-digestion preparation kit (Epicentre Biotechnologies, Madison, WI, USA).

    Article Title: Risk stratification of adult T‐cell leukemia/lymphoma using immunophenotyping
    Article Snippet: Briefly, genomic DNA is digested with four restriction enzymes, AclI, ApaLI, EcoRI, and PciI, (New England Biolab, UK) that do not cut HTLV‐1, generating DNA fragments with an average size of 1000 bp. .. Digestion is followed by ligation of a linker (with the same overhang sequence) to the digested DNA.

    Article Title: Geographic separation and genetic differentiation of populations are not coupled with niche differentiation in threatened Kaiser’s spotted newt (Neurergus kaiseri)
    Article Snippet: We performed double-digest Restriction Site Associated DNA sequencing (ddRADseq ) preparing the library as follows : 1 μg of DNA from each individual was double-digested using the PstI-HF and AclI restriction enzymes (NewEngland Biolabs) and modified Illumina adaptors with unique barcodes for each individual were ligated to obtained DNA fragments. .. Sequencing was conducted on an Illumina Next-Seq machine at Glasgow Polyomics to generate paired-end reads 75 bp in length.

    Construct:

    Article Title: Conditional over-expression of PITX1 causes skeletal muscle dystrophy in mice
    Article Snippet: The backbone of the pBI-G -Pitx1 vector was removed via AclI and Asel (New England Biolabs, Ipswich, MA, USA) digestion, followed by gel purification with a GELase Agrose gel-digestion preparation kit (Epicentre Biotechnologies, Madison, WI, USA). .. The purified construct was microinjected (10 ng/μl) into the pronuclei of B6CBAF1 fertilized 0.5 day old mouse oocytes.

    Article Title: Rad51 Promoter-Targeted Gene Therapy Is Effective for In Vivo Visualization and Treatment of Cancer
    Article Snippet: DNA plasmids containing the 6,532-bp Rad51 regulatory region, containing nucleotides 2,931 bp upstream to 3,601 bp downstream to the start of transcription, controlling the expression of firefly luciferase, green fluorescent protein (GFP), or bacteria diphtheria toxin A (DTA), were cloned and constructed as previously described. .. HeLa cells stably expressing firefly luciferase, termed HeLa-Luc, were made by transfecting HeLa cells at 50% confluence with 2 µg of Acl I (New England Biolabs, Ipswich, MA) linearized pCDNA3-Lucferase (Addgene plasmid 18964, William G. Kaelin) using Fugene 6 transfection agent (Roche).

    Lysis:

    Article Title: Prenatal Exposure to the Environmental Obesogen Tributyltin Predisposes Multipotent Stem Cells to Become Adipocytes
    Article Snippet: The PPARγ2 promoter/enhancer region examined (GenBank accession no. ) spanned 11 potentially methylated cytosines within nucleotides −1500 to +1000 and contains one restriction site (PPARγ2-Met1) for the methylation-sensitive enzyme Acl I. Genomic DNA was isolated from undifferentiated mADSCs derived from animals exposed in utero to TBT or CMC by lysis in proteinase K (0.25 mg/ml) and sodium dodecyl sulfate 1% followed by phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation. .. DNA (10 μg) was digested with excess Aci I or Acl I (New England Biolabs, Beverly, MA).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: CX3CR1 Receptor Polymorphisms, Th1 Cell Recruitment, and Acute Myocardial Infarction Outcome: Looking for a Link
    Article Snippet: CX3CR1 gene T280M and V249I mutations were identified after amplification of 311 base pairs (bp) (primers: forward: 5′ AGA ATC ATC CAG ACG CTG TTT TCC 3′; reverse: 5′ CAG AGG ACA GCC AGG CAT TTC C 3′). .. In order to type the alleles at codons 249 and 280, 5 μ L of PCR reaction was digested, respectively, with Acl I (New England Biolabs, Beverly, MA) or BsbmB1 (New England Biolabs, Beverly, MA) in 20 μ L of reaction as previously described [ ].

    Purification:

    Article Title: Epigenetic regulation of Sox4 during palate development
    Article Snippet: This also facilitates methylation of the entire plasmid, obviating the need for first isolating and methylating the insert, then religating the methylated insert back into the vector, followed by isolation and purification of the ligated plasmid for transfection analysis. .. The efficacy of DNA methylation was assessed by digestion of the unmethylated and methylated plasmids with Acl I (Cat. No. R0598S; New England BioLabs) and Bst UI (Cat. No. R0518S; New England BioLabs).

    Article Title: Neutralizing the function of a ?-globin-associated cis-regulatory DNA element using an artificial zinc finger DNA-binding domain
    Article Snippet: .. The plasmid pMSCV-neo containing the −90 β-ZF-DBD was linearized with Acl I (NEB), and purified from an agarose gel using the Qiagen gel extraction kit, resuspended in injection buffer at a concentration of 2 ng/μL, and injected into FvB oocytes as described previously ( ). .. After transfer to pseudopregnant recipients, embryos were taken at day 13.5 dpc and imaged with a stereomicroscope (Leica MZ16-FA, Houston, TX) and processed with Q-capture software (Q-imaging, BC, Canada).

    Article Title: Conditional over-expression of PITX1 causes skeletal muscle dystrophy in mice
    Article Snippet: After being purified by Qiagen purification kit (Qiagen, Germantown, MD, USA), the blunt ends were dephosphorylated with calf intestine phosphatase (CIP) (New England Biolabs, Ipswich, MA, USA) at 37°C for one hour. .. The backbone of the pBI-G -Pitx1 vector was removed via AclI and Asel (New England Biolabs, Ipswich, MA, USA) digestion, followed by gel purification with a GELase Agrose gel-digestion preparation kit (Epicentre Biotechnologies, Madison, WI, USA).

    Article Title: EnD-Seq and AppEnD: sequencing 3′ ends to identify nontemplated tails and degradation intermediates
    Article Snippet: Briefly, the probe was generated by end labeling H2a DNA digested with AclI with α-32 P-dCTP and Klenow Polymerase (NEB). .. After release from the TOPO TA vector (Invitrogen) by digestion with HindIII (NEB), the probe was gel purified and hybridized with the indicated RNA sample at either at 40°C overnight.

    Plasmid Preparation:

    Article Title: Epigenetic regulation of Sox4 during palate development
    Article Snippet: This also facilitates methylation of the entire plasmid, obviating the need for first isolating and methylating the insert, then religating the methylated insert back into the vector, followed by isolation and purification of the ligated plasmid for transfection analysis. .. The efficacy of DNA methylation was assessed by digestion of the unmethylated and methylated plasmids with Acl I (Cat. No. R0598S; New England BioLabs) and Bst UI (Cat. No. R0518S; New England BioLabs).

    Article Title: Neutralizing the function of a ?-globin-associated cis-regulatory DNA element using an artificial zinc finger DNA-binding domain
    Article Snippet: .. The plasmid pMSCV-neo containing the −90 β-ZF-DBD was linearized with Acl I (NEB), and purified from an agarose gel using the Qiagen gel extraction kit, resuspended in injection buffer at a concentration of 2 ng/μL, and injected into FvB oocytes as described previously ( ). .. After transfer to pseudopregnant recipients, embryos were taken at day 13.5 dpc and imaged with a stereomicroscope (Leica MZ16-FA, Houston, TX) and processed with Q-capture software (Q-imaging, BC, Canada).

    Article Title: Conditional over-expression of PITX1 causes skeletal muscle dystrophy in mice
    Article Snippet: .. The backbone of the pBI-G -Pitx1 vector was removed via AclI and Asel (New England Biolabs, Ipswich, MA, USA) digestion, followed by gel purification with a GELase Agrose gel-digestion preparation kit (Epicentre Biotechnologies, Madison, WI, USA). .. The purified construct was microinjected (10 ng/μl) into the pronuclei of B6CBAF1 fertilized 0.5 day old mouse oocytes.

    Article Title: Rad51 Promoter-Targeted Gene Therapy Is Effective for In Vivo Visualization and Treatment of Cancer
    Article Snippet: .. HeLa cells stably expressing firefly luciferase, termed HeLa-Luc, were made by transfecting HeLa cells at 50% confluence with 2 µg of Acl I (New England Biolabs, Ipswich, MA) linearized pCDNA3-Lucferase (Addgene plasmid 18964, William G. Kaelin) using Fugene 6 transfection agent (Roche). .. Twenty-four hours after transfection, cells were selected for antibiotic resistance by replacing the media with new media containing Geneticin at a final concentrating of 2 mg/ml.

    Article Title: EnD-Seq and AppEnD: sequencing 3′ ends to identify nontemplated tails and degradation intermediates
    Article Snippet: Briefly, the probe was generated by end labeling H2a DNA digested with AclI with α-32 P-dCTP and Klenow Polymerase (NEB). .. After release from the TOPO TA vector (Invitrogen) by digestion with HindIII (NEB), the probe was gel purified and hybridized with the indicated RNA sample at either at 40°C overnight.

    Software:

    Article Title: Epigenetic regulation of Sox4 during palate development
    Article Snippet: The efficacy of DNA methylation was assessed by digestion of the unmethylated and methylated plasmids with Acl I (Cat. No. R0598S; New England BioLabs) and Bst UI (Cat. No. R0518S; New England BioLabs). .. Statistical significance was analyzed by unpaired, two-tailed Student's t-test using GraphPad software.

    Article Title: Neutralizing the function of a ?-globin-associated cis-regulatory DNA element using an artificial zinc finger DNA-binding domain
    Article Snippet: The plasmid pMSCV-neo containing the −90 β-ZF-DBD was linearized with Acl I (NEB), and purified from an agarose gel using the Qiagen gel extraction kit, resuspended in injection buffer at a concentration of 2 ng/μL, and injected into FvB oocytes as described previously ( ). .. After transfer to pseudopregnant recipients, embryos were taken at day 13.5 dpc and imaged with a stereomicroscope (Leica MZ16-FA, Houston, TX) and processed with Q-capture software (Q-imaging, BC, Canada).

    Article Title: Molecular evidence of iron limitation and availability in the global diazotroph Trichodesmium
    Article Snippet: For the Acl I restriction digest, 5 μl of PCR product was incubated with 7.5 units of Acl I (New England Biolabs) and 1 × NEB4 buffer in a final volume of 45 μl for 3 h at 37 °C. .. Uncut and cut PCR products were run side by side on a 1.5% agarose gel and imaged using GeneSnap imaging software on a ChemiGenius2 gel documentation system (Synoptics Ltd, Cambridge, UK).

    Electrophoresis:

    Article Title: Risk stratification of adult T‐cell leukemia/lymphoma using immunophenotyping
    Article Snippet: Briefly, genomic DNA is digested with four restriction enzymes, AclI, ApaLI, EcoRI, and PciI, (New England Biolab, UK) that do not cut HTLV‐1, generating DNA fragments with an average size of 1000 bp. .. The amplicons are detected by electrophoresis in a 1.5% agarose gel.

    Selection:

    Article Title: Rad51 Promoter-Targeted Gene Therapy Is Effective for In Vivo Visualization and Treatment of Cancer
    Article Snippet: HeLa cells stably expressing firefly luciferase, termed HeLa-Luc, were made by transfecting HeLa cells at 50% confluence with 2 µg of Acl I (New England Biolabs, Ipswich, MA) linearized pCDNA3-Lucferase (Addgene plasmid 18964, William G. Kaelin) using Fugene 6 transfection agent (Roche). .. After two weeks on selection, antibiotic resistant clones with strong luciferase activity were selected using the Luciferase Assay System (Promega, Madison, WI) on a GloMax 20/20 Luminometer (Promega).

    Agarose Gel Electrophoresis:

    Article Title: CX3CR1 Receptor Polymorphisms, Th1 Cell Recruitment, and Acute Myocardial Infarction Outcome: Looking for a Link
    Article Snippet: The PCR product was analyzed in 2% agarose gel stained with ethidium bromide. .. In order to type the alleles at codons 249 and 280, 5 μ L of PCR reaction was digested, respectively, with Acl I (New England Biolabs, Beverly, MA) or BsbmB1 (New England Biolabs, Beverly, MA) in 20 μ L of reaction as previously described [ ].

    Article Title: Neutralizing the function of a ?-globin-associated cis-regulatory DNA element using an artificial zinc finger DNA-binding domain
    Article Snippet: .. The plasmid pMSCV-neo containing the −90 β-ZF-DBD was linearized with Acl I (NEB), and purified from an agarose gel using the Qiagen gel extraction kit, resuspended in injection buffer at a concentration of 2 ng/μL, and injected into FvB oocytes as described previously ( ). .. After transfer to pseudopregnant recipients, embryos were taken at day 13.5 dpc and imaged with a stereomicroscope (Leica MZ16-FA, Houston, TX) and processed with Q-capture software (Q-imaging, BC, Canada).

    Article Title: Molecular evidence of iron limitation and availability in the global diazotroph Trichodesmium
    Article Snippet: For the Acl I restriction digest, 5 μl of PCR product was incubated with 7.5 units of Acl I (New England Biolabs) and 1 × NEB4 buffer in a final volume of 45 μl for 3 h at 37 °C. .. Uncut and cut PCR products were run side by side on a 1.5% agarose gel and imaged using GeneSnap imaging software on a ChemiGenius2 gel documentation system (Synoptics Ltd, Cambridge, UK).

    Article Title: Risk stratification of adult T‐cell leukemia/lymphoma using immunophenotyping
    Article Snippet: Briefly, genomic DNA is digested with four restriction enzymes, AclI, ApaLI, EcoRI, and PciI, (New England Biolab, UK) that do not cut HTLV‐1, generating DNA fragments with an average size of 1000 bp. .. The amplicons are detected by electrophoresis in a 1.5% agarose gel.

    Transgenic Assay:

    Article Title: Neutralizing the function of a ?-globin-associated cis-regulatory DNA element using an artificial zinc finger DNA-binding domain
    Article Snippet: Paragraph title: Generation of Transient Transgenic Mice. ... The plasmid pMSCV-neo containing the −90 β-ZF-DBD was linearized with Acl I (NEB), and purified from an agarose gel using the Qiagen gel extraction kit, resuspended in injection buffer at a concentration of 2 ng/μL, and injected into FvB oocytes as described previously ( ).

    Article Title: Conditional over-expression of PITX1 causes skeletal muscle dystrophy in mice
    Article Snippet: Paragraph title: Generation of the tet-repressible muscle-specific transgenic Pitx1 mouse ... The backbone of the pBI-G -Pitx1 vector was removed via AclI and Asel (New England Biolabs, Ipswich, MA, USA) digestion, followed by gel purification with a GELase Agrose gel-digestion preparation kit (Epicentre Biotechnologies, Madison, WI, USA).

    Ethanol Precipitation:

    Article Title: Prenatal Exposure to the Environmental Obesogen Tributyltin Predisposes Multipotent Stem Cells to Become Adipocytes
    Article Snippet: The PPARγ2 promoter/enhancer region examined (GenBank accession no. ) spanned 11 potentially methylated cytosines within nucleotides −1500 to +1000 and contains one restriction site (PPARγ2-Met1) for the methylation-sensitive enzyme Acl I. Genomic DNA was isolated from undifferentiated mADSCs derived from animals exposed in utero to TBT or CMC by lysis in proteinase K (0.25 mg/ml) and sodium dodecyl sulfate 1% followed by phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation. .. DNA (10 μg) was digested with excess Aci I or Acl I (New England Biolabs, Beverly, MA).

    Incubation:

    Article Title: Molecular evidence of iron limitation and availability in the global diazotroph Trichodesmium
    Article Snippet: .. For the Acl I restriction digest, 5 μl of PCR product was incubated with 7.5 units of Acl I (New England Biolabs) and 1 × NEB4 buffer in a final volume of 45 μl for 3 h at 37 °C. .. Uncut and cut PCR products were run side by side on a 1.5% agarose gel and imaged using GeneSnap imaging software on a ChemiGenius2 gel documentation system (Synoptics Ltd, Cambridge, UK).

    Article Title: Conditional over-expression of PITX1 causes skeletal muscle dystrophy in mice
    Article Snippet: The Pitx1 and vector fragments were ligated together via T4 DNA ligase overnight incubation at 16°C. .. The backbone of the pBI-G -Pitx1 vector was removed via AclI and Asel (New England Biolabs, Ipswich, MA, USA) digestion, followed by gel purification with a GELase Agrose gel-digestion preparation kit (Epicentre Biotechnologies, Madison, WI, USA).

    Sampling:

    Article Title: Geographic separation and genetic differentiation of populations are not coupled with niche differentiation in threatened Kaiser’s spotted newt (Neurergus kaiseri)
    Article Snippet: Paragraph title: Sampling and genetic analysis ... We performed double-digest Restriction Site Associated DNA sequencing (ddRADseq ) preparing the library as follows : 1 μg of DNA from each individual was double-digested using the PstI-HF and AclI restriction enzymes (NewEngland Biolabs) and modified Illumina adaptors with unique barcodes for each individual were ligated to obtained DNA fragments.

    Produced:

    Article Title: Rad51 Promoter-Targeted Gene Therapy Is Effective for In Vivo Visualization and Treatment of Cancer
    Article Snippet: DNA plasmids for use in in vivo delivery were produced using the EndoFree Plasmid Maxi Kit (Qiagen, Valencia, CA) on MAX Efficiency Stbl2 (Invitrogen, Carlsbad, CA) competent cells transformed with the respective plasmid. .. HeLa cells stably expressing firefly luciferase, termed HeLa-Luc, were made by transfecting HeLa cells at 50% confluence with 2 µg of Acl I (New England Biolabs, Ipswich, MA) linearized pCDNA3-Lucferase (Addgene plasmid 18964, William G. Kaelin) using Fugene 6 transfection agent (Roche).

    Concentration Assay:

    Article Title: Neutralizing the function of a ?-globin-associated cis-regulatory DNA element using an artificial zinc finger DNA-binding domain
    Article Snippet: .. The plasmid pMSCV-neo containing the −90 β-ZF-DBD was linearized with Acl I (NEB), and purified from an agarose gel using the Qiagen gel extraction kit, resuspended in injection buffer at a concentration of 2 ng/μL, and injected into FvB oocytes as described previously ( ). .. After transfer to pseudopregnant recipients, embryos were taken at day 13.5 dpc and imaged with a stereomicroscope (Leica MZ16-FA, Houston, TX) and processed with Q-capture software (Q-imaging, BC, Canada).

    Article Title: Molecular evidence of iron limitation and availability in the global diazotroph Trichodesmium
    Article Snippet: Briefly, cDNA was amplified from all KM0701 and SJ0609 stations (where prior qRT-PCR detected Tten isiB ) using Tten isiB primers at a concentration of 200 nmol l−1 , BIO-X-ACT Short Mix (Bioline, London, UK) at 1 × concentration in a 20 μl reaction with 1–2 nmol l−1 template on a Mastercycler thermal cycler (Eppendorf AG). .. For the Acl I restriction digest, 5 μl of PCR product was incubated with 7.5 units of Acl I (New England Biolabs) and 1 × NEB4 buffer in a final volume of 45 μl for 3 h at 37 °C.

    In Utero:

    Article Title: Prenatal Exposure to the Environmental Obesogen Tributyltin Predisposes Multipotent Stem Cells to Become Adipocytes
    Article Snippet: The PPARγ2 promoter/enhancer region examined (GenBank accession no. ) spanned 11 potentially methylated cytosines within nucleotides −1500 to +1000 and contains one restriction site (PPARγ2-Met1) for the methylation-sensitive enzyme Acl I. Genomic DNA was isolated from undifferentiated mADSCs derived from animals exposed in utero to TBT or CMC by lysis in proteinase K (0.25 mg/ml) and sodium dodecyl sulfate 1% followed by phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation. .. DNA (10 μg) was digested with excess Aci I or Acl I (New England Biolabs, Beverly, MA).

    End Labeling:

    Article Title: EnD-Seq and AppEnD: sequencing 3′ ends to identify nontemplated tails and degradation intermediates
    Article Snippet: .. Briefly, the probe was generated by end labeling H2a DNA digested with AclI with α-32 P-dCTP and Klenow Polymerase (NEB). .. After release from the TOPO TA vector (Invitrogen) by digestion with HindIII (NEB), the probe was gel purified and hybridized with the indicated RNA sample at either at 40°C overnight.

    CTG Assay:

    Article Title: CX3CR1 Receptor Polymorphisms, Th1 Cell Recruitment, and Acute Myocardial Infarction Outcome: Looking for a Link
    Article Snippet: CX3CR1 gene T280M and V249I mutations were identified after amplification of 311 base pairs (bp) (primers: forward: 5′ AGA ATC ATC CAG ACG CTG TTT TCC 3′; reverse: 5′ CAG AGG ACA GCC AGG CAT TTC C 3′). .. In order to type the alleles at codons 249 and 280, 5 μ L of PCR reaction was digested, respectively, with Acl I (New England Biolabs, Beverly, MA) or BsbmB1 (New England Biolabs, Beverly, MA) in 20 μ L of reaction as previously described [ ].

    Staining:

    Article Title: CX3CR1 Receptor Polymorphisms, Th1 Cell Recruitment, and Acute Myocardial Infarction Outcome: Looking for a Link
    Article Snippet: The PCR product was analyzed in 2% agarose gel stained with ethidium bromide. .. In order to type the alleles at codons 249 and 280, 5 μ L of PCR reaction was digested, respectively, with Acl I (New England Biolabs, Beverly, MA) or BsbmB1 (New England Biolabs, Beverly, MA) in 20 μ L of reaction as previously described [ ].

    T-Test:

    Article Title: Epigenetic regulation of Sox4 during palate development
    Article Snippet: The efficacy of DNA methylation was assessed by digestion of the unmethylated and methylated plasmids with Acl I (Cat. No. R0598S; New England BioLabs) and Bst UI (Cat. No. R0518S; New England BioLabs). .. Statistical significance was analyzed by unpaired, two-tailed Student's t-test using GraphPad software.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs acli
    Acli, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/acli/product/New England Biolabs
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    acli - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results