tsei  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    Name:
    TseI
    Description:
    TseI 375 units
    Catalog Number:
    R0591L
    Price:
    269
    Category:
    Restriction Enzymes
    Size:
    375 units
    Buy from Supplier


    Structured Review

    New England Biolabs tsei
    TseI
    TseI 375 units
    https://www.bioz.com/result/tsei/product/New England Biolabs
    Average 96 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    tsei - by Bioz Stars, 2021-06
    96/100 stars

    Images

    1) Product Images from "CRISPR/Cas9-Mediated Genome Editing Corrects Dystrophin Mutation in Skeletal Muscle Stem Cells in a Mouse Model of Muscle Dystrophy"

    Article Title: CRISPR/Cas9-Mediated Genome Editing Corrects Dystrophin Mutation in Skeletal Muscle Stem Cells in a Mouse Model of Muscle Dystrophy

    Journal: Molecular Therapy. Nucleic Acids

    doi: 10.1016/j.omtn.2017.02.007

    Correction of the Dmd Mutation Using ssODN Donor with CRISPR/Cas9 System in Fibrin-Expanded MuSCs (A) Representative images showing delivery of CRISPR/Cas9 components into fibrin-expanded cells. Bulk skeletal muscle cells were cultured in soft 3D fibrin gel. When round-shaped MuSCs became the dominant cell type in soft 3D fibrin gel, cells were transfected with a cocktail of gRNA, ssODN, and pmax-GFP by Lipofectamine 3000. Six hours after transfection, cells were then infected with adenovirus AdV-Cas9-RFP, which co-expresses RFP and CRISPR/Cas9. GFP was used to reflect transfection efficiency of ssODN and gRNA. Scale bar, 100 μm. (B) Genotyping PCR using Mdx-F2 and SM-R2 indicating HDR-mediated Dmd correction in the fibrin-expanded MuSCs (n = 3). P, positive control using synthesized donor DNA fragment; X, genomic DNA from uncorrected mdx muscle cells; FBC, genomic DNA from corrected fibrin-expanded bulk muscle cells from mdx mice; M, 100-bp DNA marker. (C) TseI digestion confirming HDR-mediated Dmd correction in fibrin gel-expanded MuSCs. Allele-specific PCR products amplified by Mdx-F1 and SM-R2 from genomic DNA of expanded MuSC were sub-cloned into TOPO cloning vector, followed by colony-PCR with the same pair of allele-specific primers. The 97-bp PCR products from individual colonies were directly digested by TseI, which was incorporated by ssODN-directed HDR, and resulted in two fragments of 73 and 24 bp, respectively. Only the 73-bp fragment was visible by electrophoresis in 3% agarose gel. (D) Confirmation of HDR-mediated Dmd correction in fibrin-expanded MuSCs by DNA sequencing. TOPO clones referred to in (C) were sequenced. Silent mutations were indicated with green letters. Point mutations were highlighted in red.
    Figure Legend Snippet: Correction of the Dmd Mutation Using ssODN Donor with CRISPR/Cas9 System in Fibrin-Expanded MuSCs (A) Representative images showing delivery of CRISPR/Cas9 components into fibrin-expanded cells. Bulk skeletal muscle cells were cultured in soft 3D fibrin gel. When round-shaped MuSCs became the dominant cell type in soft 3D fibrin gel, cells were transfected with a cocktail of gRNA, ssODN, and pmax-GFP by Lipofectamine 3000. Six hours after transfection, cells were then infected with adenovirus AdV-Cas9-RFP, which co-expresses RFP and CRISPR/Cas9. GFP was used to reflect transfection efficiency of ssODN and gRNA. Scale bar, 100 μm. (B) Genotyping PCR using Mdx-F2 and SM-R2 indicating HDR-mediated Dmd correction in the fibrin-expanded MuSCs (n = 3). P, positive control using synthesized donor DNA fragment; X, genomic DNA from uncorrected mdx muscle cells; FBC, genomic DNA from corrected fibrin-expanded bulk muscle cells from mdx mice; M, 100-bp DNA marker. (C) TseI digestion confirming HDR-mediated Dmd correction in fibrin gel-expanded MuSCs. Allele-specific PCR products amplified by Mdx-F1 and SM-R2 from genomic DNA of expanded MuSC were sub-cloned into TOPO cloning vector, followed by colony-PCR with the same pair of allele-specific primers. The 97-bp PCR products from individual colonies were directly digested by TseI, which was incorporated by ssODN-directed HDR, and resulted in two fragments of 73 and 24 bp, respectively. Only the 73-bp fragment was visible by electrophoresis in 3% agarose gel. (D) Confirmation of HDR-mediated Dmd correction in fibrin-expanded MuSCs by DNA sequencing. TOPO clones referred to in (C) were sequenced. Silent mutations were indicated with green letters. Point mutations were highlighted in red.

    Techniques Used: Mutagenesis, CRISPR, Cell Culture, Transfection, Infection, Polymerase Chain Reaction, Positive Control, Synthesized, Mouse Assay, Marker, Amplification, Clone Assay, Plasmid Preparation, Electrophoresis, Agarose Gel Electrophoresis, DNA Sequencing

    Correction of Dmd Gene in Soft 3D Fibrin-Expanded MuSCs Using Adenoviral Vector Delivery of RNA-Guided CRISPR/Cas9 and Donor DNA (A) Diagram of adenoviral vectors expressing Cas9 (AdV-Cas9) and harboring gRNA expression cassette and Dmd -specific donor template. The mdx-gRNA2 shown in Figure 2 B was used. The donor template was a 1,314-bp DNA fragment with 591- and 722-bp homology arms flanking the mutation site. The silent mutations constituting TseI restriction enzyme site in ssODN were also incorporated in this longer donor template. (B) Scheme of adult MuSC-based gene therapy for DMD in mdx mice. Bulk skeletal muscle cells were isolated from mdx mice and then cultured in soft 3D fibrin gel. When morphologically round MuSCs became evident (3∼4 days), CRISPR/Cas9 and donor DNA complexes were delivered to initiate targeted genome editing for correcting Dmd mutations. Cells were allowed to expand in fibrin gel for 3 more days to propagate Dmd-corrected MuSCs. Expanded MuSCs were then transplanted in mdx mice. (C) Representative images showing adenoviral delivery of CRISPR/Cas9 components into fibrin-expanded cells. Bulk skeletal muscle cells were cultured in soft 3D fibrin gel. When round MuSCs became the dominant cell type in soft 3D fibrin gel, cells were coinfected with adenoviruses expressing CRISPR/Cas9 (red) and carrying gRNA and donor DNA (green). RFP was used to track infection efficiency of adenovirus expressing Cas9, whereas GFP was used to reflect transfection efficiency of donor DNA and gRNA. Scale bar, 100 μm. (D) Schematic diagram for assessing correction of Dmd mutation by adenoviral delivery of CRISPR/Cas9 complexes. To avoid interference of donor DNA as template in PCR, genome DNA was amplified first by a pair of primers (Mdx-F1 and Mdx-R1) residing outside of donor DNA sequence. The resultant PCR products containing both original and mdx -corrected fragments were then purified and subcloned into TOPO-TA cloning vector. After transformation, single bacterial colonies were picked up for allele-specific PCR using primers of LA-F and SM-R2 to screen for the corrected clones. To confirm allele-specific PCR results, colony PCR was further performed using primers of Mdx-F2 and SM-R1, and the resultant product was subjected to TseI digestion. TseI site was designed and introduced in the donor DNA. (E) Genotyping result of HDR-mediated Dmd correction in the fibrin-expanded MuSCs (n = 3 independent experiments). M, 100-bp DNA marker; D, donor DNA plasmids; X, genomic DNA from uncorrected mdx muscle cells; C, genomic DNA from corrected fibrin-expanded mdx muscle cells. Mdx-F1 and Mdx-R1 were used for the first round of PCR, and LA-F and SM-R2 were used for the second round of PCR. (F) TseI digestion confirming HDR-mediated Dmd correction in fibrin gel-expanded MuSCs. DNA fragments (lane C, left panel of D) from first round of PCR were sub-cloned into TOPO-TA cloning vector, followed by colony-PCR with primers of Mdx-F2 and SM-R1. PCR products from individual colonies were directly digested by TseI.
    Figure Legend Snippet: Correction of Dmd Gene in Soft 3D Fibrin-Expanded MuSCs Using Adenoviral Vector Delivery of RNA-Guided CRISPR/Cas9 and Donor DNA (A) Diagram of adenoviral vectors expressing Cas9 (AdV-Cas9) and harboring gRNA expression cassette and Dmd -specific donor template. The mdx-gRNA2 shown in Figure 2 B was used. The donor template was a 1,314-bp DNA fragment with 591- and 722-bp homology arms flanking the mutation site. The silent mutations constituting TseI restriction enzyme site in ssODN were also incorporated in this longer donor template. (B) Scheme of adult MuSC-based gene therapy for DMD in mdx mice. Bulk skeletal muscle cells were isolated from mdx mice and then cultured in soft 3D fibrin gel. When morphologically round MuSCs became evident (3∼4 days), CRISPR/Cas9 and donor DNA complexes were delivered to initiate targeted genome editing for correcting Dmd mutations. Cells were allowed to expand in fibrin gel for 3 more days to propagate Dmd-corrected MuSCs. Expanded MuSCs were then transplanted in mdx mice. (C) Representative images showing adenoviral delivery of CRISPR/Cas9 components into fibrin-expanded cells. Bulk skeletal muscle cells were cultured in soft 3D fibrin gel. When round MuSCs became the dominant cell type in soft 3D fibrin gel, cells were coinfected with adenoviruses expressing CRISPR/Cas9 (red) and carrying gRNA and donor DNA (green). RFP was used to track infection efficiency of adenovirus expressing Cas9, whereas GFP was used to reflect transfection efficiency of donor DNA and gRNA. Scale bar, 100 μm. (D) Schematic diagram for assessing correction of Dmd mutation by adenoviral delivery of CRISPR/Cas9 complexes. To avoid interference of donor DNA as template in PCR, genome DNA was amplified first by a pair of primers (Mdx-F1 and Mdx-R1) residing outside of donor DNA sequence. The resultant PCR products containing both original and mdx -corrected fragments were then purified and subcloned into TOPO-TA cloning vector. After transformation, single bacterial colonies were picked up for allele-specific PCR using primers of LA-F and SM-R2 to screen for the corrected clones. To confirm allele-specific PCR results, colony PCR was further performed using primers of Mdx-F2 and SM-R1, and the resultant product was subjected to TseI digestion. TseI site was designed and introduced in the donor DNA. (E) Genotyping result of HDR-mediated Dmd correction in the fibrin-expanded MuSCs (n = 3 independent experiments). M, 100-bp DNA marker; D, donor DNA plasmids; X, genomic DNA from uncorrected mdx muscle cells; C, genomic DNA from corrected fibrin-expanded mdx muscle cells. Mdx-F1 and Mdx-R1 were used for the first round of PCR, and LA-F and SM-R2 were used for the second round of PCR. (F) TseI digestion confirming HDR-mediated Dmd correction in fibrin gel-expanded MuSCs. DNA fragments (lane C, left panel of D) from first round of PCR were sub-cloned into TOPO-TA cloning vector, followed by colony-PCR with primers of Mdx-F2 and SM-R1. PCR products from individual colonies were directly digested by TseI.

    Techniques Used: Plasmid Preparation, CRISPR, Expressing, Mutagenesis, Mouse Assay, Isolation, Cell Culture, Infection, Transfection, Polymerase Chain Reaction, Amplification, Sequencing, Purification, TA Cloning, Transformation Assay, Clone Assay, Marker

    Design of gRNAs and ssODN for CRISPR/Cas9-Mediated Gene Editing (A) Design of ssODN as HDR DNA template. ssODN, which contains 41 bp of homology arms flanking each side of the mutation site and targets the non-transcribed strand of Dmd gene. ssODN was phosphorothioate-modified at both ends (denoted with * [refer to Table S1 ]) and incorporated four silent mutations (green), which prevent binding of gRNA2/Cas9 and add a TseI restriction enzyme site for genotyping and verification of HDR-mediated gene correction. (B) Schematic of gRNAs targeting sequences of Dmd (blue) and PAM sequence (red). Red arrowhead indicates the cleavage site by CRISPR/Cas9. gRNA1 and gRNA2 were the two gRNAs specific for Dmd . (C) PCR validation of CRISPR/Cas9-mediated DNA cleavage of genomic DNA target. Mouse muscle-derived fibroblasts were transfected with CRISPR/Cas9, gRNA1, and gRNA2 by Lipofectamine 3000. CRISPR/Cas9 cut at each of the two gRNA-targeted sequences in Dmd , which resulted in 47-bp shorter PCR products when amplified with two primers of Mdx-F2 and Mdx-R2 (see Table S1 ), which locate in 5′ end of gRNA2 site and 3′ ends of gRNA1 site, respectively.
    Figure Legend Snippet: Design of gRNAs and ssODN for CRISPR/Cas9-Mediated Gene Editing (A) Design of ssODN as HDR DNA template. ssODN, which contains 41 bp of homology arms flanking each side of the mutation site and targets the non-transcribed strand of Dmd gene. ssODN was phosphorothioate-modified at both ends (denoted with * [refer to Table S1 ]) and incorporated four silent mutations (green), which prevent binding of gRNA2/Cas9 and add a TseI restriction enzyme site for genotyping and verification of HDR-mediated gene correction. (B) Schematic of gRNAs targeting sequences of Dmd (blue) and PAM sequence (red). Red arrowhead indicates the cleavage site by CRISPR/Cas9. gRNA1 and gRNA2 were the two gRNAs specific for Dmd . (C) PCR validation of CRISPR/Cas9-mediated DNA cleavage of genomic DNA target. Mouse muscle-derived fibroblasts were transfected with CRISPR/Cas9, gRNA1, and gRNA2 by Lipofectamine 3000. CRISPR/Cas9 cut at each of the two gRNA-targeted sequences in Dmd , which resulted in 47-bp shorter PCR products when amplified with two primers of Mdx-F2 and Mdx-R2 (see Table S1 ), which locate in 5′ end of gRNA2 site and 3′ ends of gRNA1 site, respectively.

    Techniques Used: CRISPR, Mutagenesis, Modification, Binding Assay, Sequencing, Polymerase Chain Reaction, Derivative Assay, Transfection, Amplification

    Related Articles

    Variant Assay:

    Article Title: The m.9143T > C Variant: Recurrent Infections and Immunodeficiency as an Extension of the Phenotypic Spectrum in MT-ATP6 Mutations?
    Article Snippet: Determination of mtDNA Heteroplasmy Levels (RFLP Analysis)For restriction fragment length polymorphism (RFLP) analysis, total DNA was extracted from different samples using the peqGOLD tissue DNA Mini Kit (Peqlab Biotechnologie GmbH, Erlangen, Germany) according to the manufacturer’s instructions. .. The presence of this variant m.9143T > C was determined by restriction digestion of the 220 bp PCR amplified product obtained using a forward 5′ ACC ATT AAC CTT CCC TCT ACA C 3′ and a reverse 5′ GAG GTC ATT AGG AGG GCT GAG A 3′ primer with TseI (New England Biolabs GmbH (NEB), Frankfurt am Main, Germany). ..

    Article Title: Sox11 Is Required to Maintain Proper Levels of Hedgehog Signaling during Vertebrate Ocular Morphogenesis
    Article Snippet: Mutations were confirmed by bi-directional Sanger sequencing and RFLP analysis of the SOX11 amplicons. .. Half of the 384 control DNA samples were screened by RFLP analysis, using TseI (NEB) for the G145C variant and SfcI (NEB) for the S351–S354dup variant, and the other half were screened by direct Sanger sequencing of the SOX11 coding region. ..

    Polymerase Chain Reaction:

    Article Title: The m.9143T > C Variant: Recurrent Infections and Immunodeficiency as an Extension of the Phenotypic Spectrum in MT-ATP6 Mutations?
    Article Snippet: Determination of mtDNA Heteroplasmy Levels (RFLP Analysis)For restriction fragment length polymorphism (RFLP) analysis, total DNA was extracted from different samples using the peqGOLD tissue DNA Mini Kit (Peqlab Biotechnologie GmbH, Erlangen, Germany) according to the manufacturer’s instructions. .. The presence of this variant m.9143T > C was determined by restriction digestion of the 220 bp PCR amplified product obtained using a forward 5′ ACC ATT AAC CTT CCC TCT ACA C 3′ and a reverse 5′ GAG GTC ATT AGG AGG GCT GAG A 3′ primer with TseI (New England Biolabs GmbH (NEB), Frankfurt am Main, Germany). ..

    Article Title: CRISPR/Cas9-Mediated Genome Editing Corrects Dystrophin Mutation in Skeletal Muscle Stem Cells in a Mouse Model of Muscle Dystrophy
    Article Snippet: Analysis of Indels in PCR Products Using Restriction Fragment Length Polymorphism To confirm allele-specific PCR products, individual clones containing pCR4-TOPO vector were used as templates for PCR using MF and MR2. .. PCR products were directly digested by TseI (New England BioLabs) for 3 hr at 65°C and analyzed by 3% agarose gel electrophoresis. .. Only PCR products amplified from HDR-mediated genomic editing DNA could be digested by TseI.

    Article Title: Diversity of microcystin genotypes among populations of the filamentous cyanobacteria Planktothrix rubescens and Planktothrix agardhii
    Article Snippet: The restriction profiles were compared with the mcy BA1 sequences. .. Restriction analysis was performed directly from the PCR amplification product using Alu I (MBI Fermentas, St Leon-Rot, Germany) and Tse I (New England Biolabs, Frankfurt am Main, Germany) according to the manufacturer's instructions. .. Digestions were performed in a volume of 20 μl, containing 0.2 μl of the restriction enzyme (5 u μl−1 ) and 7 μl of the PCR products and incubated at 37°C ( AluI ) and 65°C ( TseI ) for 3h.

    Article Title: RNF43 inhibits WNT5A driven signaling and suppresses melanoma invasion
    Article Snippet: Genomic DNA isolation was performed using DirectPCR Lysis Reagent (Cell) (Viagen Biotech), Proteinase K (EO0491, Thermo Fisher Scientific) and DreamTaq DNA Polymerase (EP0701, Thermo Fisher Scientific) according to the manufacturers. .. PCR products were analyzed by restriction digestion using Taal (ER1361, Thermo Fisher Scientific) in case of RNF43 , HpaII (ER0511, Thermo Fisher Scientific) – ZNRF3 , TaqI (ER0671, Thermo Fisher Scientific) - WNT5A and TseI (R0591S, New England BioLabs) - ROR1 for detection of Cas9 mediated disruptions in the recognition sites. .. For targeting RNF43 /ZNRF3 in the A375 and in the A375 IV melanoma lines, gRNAs: AGTTACGATGGAACTCATGG (RNF43) and CTCCAGACAGATGGCACAGTCGG (ZNRF3) were accordingly cloned by described protocol into the pU6-(BbsI)CBh-Cas9-T2A-mCherry (Addgene #64324) and pSpCas9(BB)-2A-GFP (PX458) (Addgene #48138) backbones, transfected and sorted as single, GFP and mCherry double positive cells.

    Amplification:

    Article Title: The m.9143T > C Variant: Recurrent Infections and Immunodeficiency as an Extension of the Phenotypic Spectrum in MT-ATP6 Mutations?
    Article Snippet: Determination of mtDNA Heteroplasmy Levels (RFLP Analysis)For restriction fragment length polymorphism (RFLP) analysis, total DNA was extracted from different samples using the peqGOLD tissue DNA Mini Kit (Peqlab Biotechnologie GmbH, Erlangen, Germany) according to the manufacturer’s instructions. .. The presence of this variant m.9143T > C was determined by restriction digestion of the 220 bp PCR amplified product obtained using a forward 5′ ACC ATT AAC CTT CCC TCT ACA C 3′ and a reverse 5′ GAG GTC ATT AGG AGG GCT GAG A 3′ primer with TseI (New England Biolabs GmbH (NEB), Frankfurt am Main, Germany). ..

    Article Title: Diversity of microcystin genotypes among populations of the filamentous cyanobacteria Planktothrix rubescens and Planktothrix agardhii
    Article Snippet: The restriction profiles were compared with the mcy BA1 sequences. .. Restriction analysis was performed directly from the PCR amplification product using Alu I (MBI Fermentas, St Leon-Rot, Germany) and Tse I (New England Biolabs, Frankfurt am Main, Germany) according to the manufacturer's instructions. .. Digestions were performed in a volume of 20 μl, containing 0.2 μl of the restriction enzyme (5 u μl−1 ) and 7 μl of the PCR products and incubated at 37°C ( AluI ) and 65°C ( TseI ) for 3h.

    Countercurrent Chromatography:

    Article Title: The m.9143T > C Variant: Recurrent Infections and Immunodeficiency as an Extension of the Phenotypic Spectrum in MT-ATP6 Mutations?
    Article Snippet: Determination of mtDNA Heteroplasmy Levels (RFLP Analysis)For restriction fragment length polymorphism (RFLP) analysis, total DNA was extracted from different samples using the peqGOLD tissue DNA Mini Kit (Peqlab Biotechnologie GmbH, Erlangen, Germany) according to the manufacturer’s instructions. .. The presence of this variant m.9143T > C was determined by restriction digestion of the 220 bp PCR amplified product obtained using a forward 5′ ACC ATT AAC CTT CCC TCT ACA C 3′ and a reverse 5′ GAG GTC ATT AGG AGG GCT GAG A 3′ primer with TseI (New England Biolabs GmbH (NEB), Frankfurt am Main, Germany). ..

    Agarose Gel Electrophoresis:

    Article Title: CRISPR/Cas9-Mediated Genome Editing Corrects Dystrophin Mutation in Skeletal Muscle Stem Cells in a Mouse Model of Muscle Dystrophy
    Article Snippet: Analysis of Indels in PCR Products Using Restriction Fragment Length Polymorphism To confirm allele-specific PCR products, individual clones containing pCR4-TOPO vector were used as templates for PCR using MF and MR2. .. PCR products were directly digested by TseI (New England BioLabs) for 3 hr at 65°C and analyzed by 3% agarose gel electrophoresis. .. Only PCR products amplified from HDR-mediated genomic editing DNA could be digested by TseI.

    Sequencing:

    Article Title: Sox11 Is Required to Maintain Proper Levels of Hedgehog Signaling during Vertebrate Ocular Morphogenesis
    Article Snippet: Mutations were confirmed by bi-directional Sanger sequencing and RFLP analysis of the SOX11 amplicons. .. Half of the 384 control DNA samples were screened by RFLP analysis, using TseI (NEB) for the G145C variant and SfcI (NEB) for the S351–S354dup variant, and the other half were screened by direct Sanger sequencing of the SOX11 coding region. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    New England Biolabs tse i
    Proportion of Alu I+ <t>Tse</t> I restriction types obtained from amplified and cloned mcy BA1 <t>PCR</t> products from eight different Planktothrix spp. populations for three sampling dates. For each sample, 40 clones of mcy BA1 PCR products were analysed and the percentage of a specific restriction type was calculated. The proportion for the total population and for the 49 sequenced strains is provided in the lower two graphs. Note that the scales of the y-axes are different. Significant differences of the proportions of restriction profiles between the eight lakes are marked by crosses at the top (xxx, p
    Tse I, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tse i/product/New England Biolabs
    Average 96 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    tse i - by Bioz Stars, 2021-06
    96/100 stars
      Buy from Supplier

    Image Search Results


    Proportion of Alu I+ Tse I restriction types obtained from amplified and cloned mcy BA1 PCR products from eight different Planktothrix spp. populations for three sampling dates. For each sample, 40 clones of mcy BA1 PCR products were analysed and the percentage of a specific restriction type was calculated. The proportion for the total population and for the 49 sequenced strains is provided in the lower two graphs. Note that the scales of the y-axes are different. Significant differences of the proportions of restriction profiles between the eight lakes are marked by crosses at the top (xxx, p

    Journal: Molecular ecology

    Article Title: Diversity of microcystin genotypes among populations of the filamentous cyanobacteria Planktothrix rubescens and Planktothrix agardhii

    doi: 10.1111/j.1365-294X.2006.03044.x

    Figure Lengend Snippet: Proportion of Alu I+ Tse I restriction types obtained from amplified and cloned mcy BA1 PCR products from eight different Planktothrix spp. populations for three sampling dates. For each sample, 40 clones of mcy BA1 PCR products were analysed and the percentage of a specific restriction type was calculated. The proportion for the total population and for the 49 sequenced strains is provided in the lower two graphs. Note that the scales of the y-axes are different. Significant differences of the proportions of restriction profiles between the eight lakes are marked by crosses at the top (xxx, p

    Article Snippet: Restriction analysis was performed directly from the PCR amplification product using Alu I (MBI Fermentas, St Leon-Rot, Germany) and Tse I (New England Biolabs, Frankfurt am Main, Germany) according to the manufacturer's instructions.

    Techniques: Amplification, Clone Assay, Polymerase Chain Reaction, Sampling

    Correction of the Dmd Mutation Using ssODN Donor with CRISPR/Cas9 System in Fibrin-Expanded MuSCs (A) Representative images showing delivery of CRISPR/Cas9 components into fibrin-expanded cells. Bulk skeletal muscle cells were cultured in soft 3D fibrin gel. When round-shaped MuSCs became the dominant cell type in soft 3D fibrin gel, cells were transfected with a cocktail of gRNA, ssODN, and pmax-GFP by Lipofectamine 3000. Six hours after transfection, cells were then infected with adenovirus AdV-Cas9-RFP, which co-expresses RFP and CRISPR/Cas9. GFP was used to reflect transfection efficiency of ssODN and gRNA. Scale bar, 100 μm. (B) Genotyping PCR using Mdx-F2 and SM-R2 indicating HDR-mediated Dmd correction in the fibrin-expanded MuSCs (n = 3). P, positive control using synthesized donor DNA fragment; X, genomic DNA from uncorrected mdx muscle cells; FBC, genomic DNA from corrected fibrin-expanded bulk muscle cells from mdx mice; M, 100-bp DNA marker. (C) TseI digestion confirming HDR-mediated Dmd correction in fibrin gel-expanded MuSCs. Allele-specific PCR products amplified by Mdx-F1 and SM-R2 from genomic DNA of expanded MuSC were sub-cloned into TOPO cloning vector, followed by colony-PCR with the same pair of allele-specific primers. The 97-bp PCR products from individual colonies were directly digested by TseI, which was incorporated by ssODN-directed HDR, and resulted in two fragments of 73 and 24 bp, respectively. Only the 73-bp fragment was visible by electrophoresis in 3% agarose gel. (D) Confirmation of HDR-mediated Dmd correction in fibrin-expanded MuSCs by DNA sequencing. TOPO clones referred to in (C) were sequenced. Silent mutations were indicated with green letters. Point mutations were highlighted in red.

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: CRISPR/Cas9-Mediated Genome Editing Corrects Dystrophin Mutation in Skeletal Muscle Stem Cells in a Mouse Model of Muscle Dystrophy

    doi: 10.1016/j.omtn.2017.02.007

    Figure Lengend Snippet: Correction of the Dmd Mutation Using ssODN Donor with CRISPR/Cas9 System in Fibrin-Expanded MuSCs (A) Representative images showing delivery of CRISPR/Cas9 components into fibrin-expanded cells. Bulk skeletal muscle cells were cultured in soft 3D fibrin gel. When round-shaped MuSCs became the dominant cell type in soft 3D fibrin gel, cells were transfected with a cocktail of gRNA, ssODN, and pmax-GFP by Lipofectamine 3000. Six hours after transfection, cells were then infected with adenovirus AdV-Cas9-RFP, which co-expresses RFP and CRISPR/Cas9. GFP was used to reflect transfection efficiency of ssODN and gRNA. Scale bar, 100 μm. (B) Genotyping PCR using Mdx-F2 and SM-R2 indicating HDR-mediated Dmd correction in the fibrin-expanded MuSCs (n = 3). P, positive control using synthesized donor DNA fragment; X, genomic DNA from uncorrected mdx muscle cells; FBC, genomic DNA from corrected fibrin-expanded bulk muscle cells from mdx mice; M, 100-bp DNA marker. (C) TseI digestion confirming HDR-mediated Dmd correction in fibrin gel-expanded MuSCs. Allele-specific PCR products amplified by Mdx-F1 and SM-R2 from genomic DNA of expanded MuSC were sub-cloned into TOPO cloning vector, followed by colony-PCR with the same pair of allele-specific primers. The 97-bp PCR products from individual colonies were directly digested by TseI, which was incorporated by ssODN-directed HDR, and resulted in two fragments of 73 and 24 bp, respectively. Only the 73-bp fragment was visible by electrophoresis in 3% agarose gel. (D) Confirmation of HDR-mediated Dmd correction in fibrin-expanded MuSCs by DNA sequencing. TOPO clones referred to in (C) were sequenced. Silent mutations were indicated with green letters. Point mutations were highlighted in red.

    Article Snippet: PCR products were directly digested by TseI (New England BioLabs) for 3 hr at 65°C and analyzed by 3% agarose gel electrophoresis.

    Techniques: Mutagenesis, CRISPR, Cell Culture, Transfection, Infection, Polymerase Chain Reaction, Positive Control, Synthesized, Mouse Assay, Marker, Amplification, Clone Assay, Plasmid Preparation, Electrophoresis, Agarose Gel Electrophoresis, DNA Sequencing

    Correction of Dmd Gene in Soft 3D Fibrin-Expanded MuSCs Using Adenoviral Vector Delivery of RNA-Guided CRISPR/Cas9 and Donor DNA (A) Diagram of adenoviral vectors expressing Cas9 (AdV-Cas9) and harboring gRNA expression cassette and Dmd -specific donor template. The mdx-gRNA2 shown in Figure 2 B was used. The donor template was a 1,314-bp DNA fragment with 591- and 722-bp homology arms flanking the mutation site. The silent mutations constituting TseI restriction enzyme site in ssODN were also incorporated in this longer donor template. (B) Scheme of adult MuSC-based gene therapy for DMD in mdx mice. Bulk skeletal muscle cells were isolated from mdx mice and then cultured in soft 3D fibrin gel. When morphologically round MuSCs became evident (3∼4 days), CRISPR/Cas9 and donor DNA complexes were delivered to initiate targeted genome editing for correcting Dmd mutations. Cells were allowed to expand in fibrin gel for 3 more days to propagate Dmd-corrected MuSCs. Expanded MuSCs were then transplanted in mdx mice. (C) Representative images showing adenoviral delivery of CRISPR/Cas9 components into fibrin-expanded cells. Bulk skeletal muscle cells were cultured in soft 3D fibrin gel. When round MuSCs became the dominant cell type in soft 3D fibrin gel, cells were coinfected with adenoviruses expressing CRISPR/Cas9 (red) and carrying gRNA and donor DNA (green). RFP was used to track infection efficiency of adenovirus expressing Cas9, whereas GFP was used to reflect transfection efficiency of donor DNA and gRNA. Scale bar, 100 μm. (D) Schematic diagram for assessing correction of Dmd mutation by adenoviral delivery of CRISPR/Cas9 complexes. To avoid interference of donor DNA as template in PCR, genome DNA was amplified first by a pair of primers (Mdx-F1 and Mdx-R1) residing outside of donor DNA sequence. The resultant PCR products containing both original and mdx -corrected fragments were then purified and subcloned into TOPO-TA cloning vector. After transformation, single bacterial colonies were picked up for allele-specific PCR using primers of LA-F and SM-R2 to screen for the corrected clones. To confirm allele-specific PCR results, colony PCR was further performed using primers of Mdx-F2 and SM-R1, and the resultant product was subjected to TseI digestion. TseI site was designed and introduced in the donor DNA. (E) Genotyping result of HDR-mediated Dmd correction in the fibrin-expanded MuSCs (n = 3 independent experiments). M, 100-bp DNA marker; D, donor DNA plasmids; X, genomic DNA from uncorrected mdx muscle cells; C, genomic DNA from corrected fibrin-expanded mdx muscle cells. Mdx-F1 and Mdx-R1 were used for the first round of PCR, and LA-F and SM-R2 were used for the second round of PCR. (F) TseI digestion confirming HDR-mediated Dmd correction in fibrin gel-expanded MuSCs. DNA fragments (lane C, left panel of D) from first round of PCR were sub-cloned into TOPO-TA cloning vector, followed by colony-PCR with primers of Mdx-F2 and SM-R1. PCR products from individual colonies were directly digested by TseI.

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: CRISPR/Cas9-Mediated Genome Editing Corrects Dystrophin Mutation in Skeletal Muscle Stem Cells in a Mouse Model of Muscle Dystrophy

    doi: 10.1016/j.omtn.2017.02.007

    Figure Lengend Snippet: Correction of Dmd Gene in Soft 3D Fibrin-Expanded MuSCs Using Adenoviral Vector Delivery of RNA-Guided CRISPR/Cas9 and Donor DNA (A) Diagram of adenoviral vectors expressing Cas9 (AdV-Cas9) and harboring gRNA expression cassette and Dmd -specific donor template. The mdx-gRNA2 shown in Figure 2 B was used. The donor template was a 1,314-bp DNA fragment with 591- and 722-bp homology arms flanking the mutation site. The silent mutations constituting TseI restriction enzyme site in ssODN were also incorporated in this longer donor template. (B) Scheme of adult MuSC-based gene therapy for DMD in mdx mice. Bulk skeletal muscle cells were isolated from mdx mice and then cultured in soft 3D fibrin gel. When morphologically round MuSCs became evident (3∼4 days), CRISPR/Cas9 and donor DNA complexes were delivered to initiate targeted genome editing for correcting Dmd mutations. Cells were allowed to expand in fibrin gel for 3 more days to propagate Dmd-corrected MuSCs. Expanded MuSCs were then transplanted in mdx mice. (C) Representative images showing adenoviral delivery of CRISPR/Cas9 components into fibrin-expanded cells. Bulk skeletal muscle cells were cultured in soft 3D fibrin gel. When round MuSCs became the dominant cell type in soft 3D fibrin gel, cells were coinfected with adenoviruses expressing CRISPR/Cas9 (red) and carrying gRNA and donor DNA (green). RFP was used to track infection efficiency of adenovirus expressing Cas9, whereas GFP was used to reflect transfection efficiency of donor DNA and gRNA. Scale bar, 100 μm. (D) Schematic diagram for assessing correction of Dmd mutation by adenoviral delivery of CRISPR/Cas9 complexes. To avoid interference of donor DNA as template in PCR, genome DNA was amplified first by a pair of primers (Mdx-F1 and Mdx-R1) residing outside of donor DNA sequence. The resultant PCR products containing both original and mdx -corrected fragments were then purified and subcloned into TOPO-TA cloning vector. After transformation, single bacterial colonies were picked up for allele-specific PCR using primers of LA-F and SM-R2 to screen for the corrected clones. To confirm allele-specific PCR results, colony PCR was further performed using primers of Mdx-F2 and SM-R1, and the resultant product was subjected to TseI digestion. TseI site was designed and introduced in the donor DNA. (E) Genotyping result of HDR-mediated Dmd correction in the fibrin-expanded MuSCs (n = 3 independent experiments). M, 100-bp DNA marker; D, donor DNA plasmids; X, genomic DNA from uncorrected mdx muscle cells; C, genomic DNA from corrected fibrin-expanded mdx muscle cells. Mdx-F1 and Mdx-R1 were used for the first round of PCR, and LA-F and SM-R2 were used for the second round of PCR. (F) TseI digestion confirming HDR-mediated Dmd correction in fibrin gel-expanded MuSCs. DNA fragments (lane C, left panel of D) from first round of PCR were sub-cloned into TOPO-TA cloning vector, followed by colony-PCR with primers of Mdx-F2 and SM-R1. PCR products from individual colonies were directly digested by TseI.

    Article Snippet: PCR products were directly digested by TseI (New England BioLabs) for 3 hr at 65°C and analyzed by 3% agarose gel electrophoresis.

    Techniques: Plasmid Preparation, CRISPR, Expressing, Mutagenesis, Mouse Assay, Isolation, Cell Culture, Infection, Transfection, Polymerase Chain Reaction, Amplification, Sequencing, Purification, TA Cloning, Transformation Assay, Clone Assay, Marker

    Design of gRNAs and ssODN for CRISPR/Cas9-Mediated Gene Editing (A) Design of ssODN as HDR DNA template. ssODN, which contains 41 bp of homology arms flanking each side of the mutation site and targets the non-transcribed strand of Dmd gene. ssODN was phosphorothioate-modified at both ends (denoted with * [refer to Table S1 ]) and incorporated four silent mutations (green), which prevent binding of gRNA2/Cas9 and add a TseI restriction enzyme site for genotyping and verification of HDR-mediated gene correction. (B) Schematic of gRNAs targeting sequences of Dmd (blue) and PAM sequence (red). Red arrowhead indicates the cleavage site by CRISPR/Cas9. gRNA1 and gRNA2 were the two gRNAs specific for Dmd . (C) PCR validation of CRISPR/Cas9-mediated DNA cleavage of genomic DNA target. Mouse muscle-derived fibroblasts were transfected with CRISPR/Cas9, gRNA1, and gRNA2 by Lipofectamine 3000. CRISPR/Cas9 cut at each of the two gRNA-targeted sequences in Dmd , which resulted in 47-bp shorter PCR products when amplified with two primers of Mdx-F2 and Mdx-R2 (see Table S1 ), which locate in 5′ end of gRNA2 site and 3′ ends of gRNA1 site, respectively.

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: CRISPR/Cas9-Mediated Genome Editing Corrects Dystrophin Mutation in Skeletal Muscle Stem Cells in a Mouse Model of Muscle Dystrophy

    doi: 10.1016/j.omtn.2017.02.007

    Figure Lengend Snippet: Design of gRNAs and ssODN for CRISPR/Cas9-Mediated Gene Editing (A) Design of ssODN as HDR DNA template. ssODN, which contains 41 bp of homology arms flanking each side of the mutation site and targets the non-transcribed strand of Dmd gene. ssODN was phosphorothioate-modified at both ends (denoted with * [refer to Table S1 ]) and incorporated four silent mutations (green), which prevent binding of gRNA2/Cas9 and add a TseI restriction enzyme site for genotyping and verification of HDR-mediated gene correction. (B) Schematic of gRNAs targeting sequences of Dmd (blue) and PAM sequence (red). Red arrowhead indicates the cleavage site by CRISPR/Cas9. gRNA1 and gRNA2 were the two gRNAs specific for Dmd . (C) PCR validation of CRISPR/Cas9-mediated DNA cleavage of genomic DNA target. Mouse muscle-derived fibroblasts were transfected with CRISPR/Cas9, gRNA1, and gRNA2 by Lipofectamine 3000. CRISPR/Cas9 cut at each of the two gRNA-targeted sequences in Dmd , which resulted in 47-bp shorter PCR products when amplified with two primers of Mdx-F2 and Mdx-R2 (see Table S1 ), which locate in 5′ end of gRNA2 site and 3′ ends of gRNA1 site, respectively.

    Article Snippet: PCR products were directly digested by TseI (New England BioLabs) for 3 hr at 65°C and analyzed by 3% agarose gel electrophoresis.

    Techniques: CRISPR, Mutagenesis, Modification, Binding Assay, Sequencing, Polymerase Chain Reaction, Derivative Assay, Transfection, Amplification