bseri restriction enzyme  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    New England Biolabs bseri restriction enzyme
    Comparison between CTPPCR and RFLP results for <t>NRF2</t> -653A/G. Confronting two-pair primers–polymerase chain reaction of NRF2 rs35652124 (-653 A/G) single nucleotide polymorphism performed at two different T a (59°- 66°C) using 1 unit/sample of Kapa Hot Start Taq polymerase (A–C) . Restriction fragment length polymorphism analysis after amplicon digestion with <t>BseRI</t> (D–F) . Sample ID and genotype are indicated by numbers and letters at the top and bottom of figures. N: Negative control indicates DNA template omission in the polymerase chain reaction; MW: Molecular weights (100 bp up to 1000 bp). The black lanes are irrelevant samples for which the corresponding confronting two-pair primers–polymerase chain reaction was not reported.
    Bseri Restriction Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bseri restriction enzyme/product/New England Biolabs
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bseri restriction enzyme - by Bioz Stars, 2020-03
    90/100 stars

    Related Products / Commonly Used Together

    nrf2 -617 a/g amplicon
    enzymatic digestion

    Images

    1) Product Images from "Confronting two biomolecular techniques to detect NRF2 gene polymorphism biomarkers"

    Article Title: Confronting two biomolecular techniques to detect NRF2 gene polymorphism biomarkers

    Journal: Future Science OA

    doi: 10.4155/fsoa-2018-0075

    Comparison between CTPPCR and RFLP results for NRF2 -653A/G. Confronting two-pair primers–polymerase chain reaction of NRF2 rs35652124 (-653 A/G) single nucleotide polymorphism performed at two different T a (59°- 66°C) using 1 unit/sample of Kapa Hot Start Taq polymerase (A–C) . Restriction fragment length polymorphism analysis after amplicon digestion with BseRI (D–F) . Sample ID and genotype are indicated by numbers and letters at the top and bottom of figures. N: Negative control indicates DNA template omission in the polymerase chain reaction; MW: Molecular weights (100 bp up to 1000 bp). The black lanes are irrelevant samples for which the corresponding confronting two-pair primers–polymerase chain reaction was not reported.
    Figure Legend Snippet: Comparison between CTPPCR and RFLP results for NRF2 -653A/G. Confronting two-pair primers–polymerase chain reaction of NRF2 rs35652124 (-653 A/G) single nucleotide polymorphism performed at two different T a (59°- 66°C) using 1 unit/sample of Kapa Hot Start Taq polymerase (A–C) . Restriction fragment length polymorphism analysis after amplicon digestion with BseRI (D–F) . Sample ID and genotype are indicated by numbers and letters at the top and bottom of figures. N: Negative control indicates DNA template omission in the polymerase chain reaction; MW: Molecular weights (100 bp up to 1000 bp). The black lanes are irrelevant samples for which the corresponding confronting two-pair primers–polymerase chain reaction was not reported.

    Techniques Used: Polymerase Chain Reaction, Amplification, Negative Control

    Related Articles

    Clone Assay:

    Article Title: Controlling biofilm formation, prophage excision and cell death by rewiring global regulator H-NS of Escherichia coli
    Article Snippet: .. The epPCR product was cloned into pCA24N‐hha hns using BseRI and HindIII after treating the plasmid with Antarctic phosphatase (New England Biolabs, Beverly, MA, USA). .. The ligation mixture was electroporated into BW25113 hha hns as described previously ( ).

    Article Title: Probiotic Escherichia coli inhibits biofilm formation of pathogenic E. coli via extracellular activity of DegP
    Article Snippet: degP from EcN or BW was cloned into pCA24N plasmid (Table ). .. The pCA24N plasmid and degP PCR products were digested with restriction enzymes BseRI and HindIII (New England Biolabs, Ipswich, MA, USA) and purified.

    Article Title: Engineering global regulator Hha of Escherichia coli to control biofilm dispersal
    Article Snippet: .. The epPCR product was cloned into pCA24N‐hha using BseRI and HindIII after treating the plasmid with Antarctic phosphatase (New England Biolabs, Beverly, MA, USA). .. The ligation mixture was electroporated into BW25113 hha tnaA competent cells using the Gene Pulser/Pulse Controller (Bio‐Rad, Hercules, CA, USA) at 1.25 kV cm−1 , 25 µF and 200 Ω.

    Article Title: Probiotic Escherichia coli inhibits biofilm formation of pathogenic E. coli via extracellular activity of DegP
    Article Snippet: Construction of plasmid pCA24N-degP degP from EcN or BW was cloned into pCA24N plasmid (Table ). .. The pCA24N plasmid and degP PCR products were digested with restriction enzymes BseRI and HindIII (New England Biolabs, Ipswich, MA, USA) and purified.

    Article Title: Engineering a Novel c-di-GMP-Binding Protein for Biofilm Dispersal
    Article Snippet: .. The epPCR product was cloned into pCA24N_ bdcA using restriction enzymes BseRI and HindIII after treating the plasmid with Antarctic phosphatase (New England Biolabs). .. The ligation mixture was electroporated into BW25113 bdcA .

    Amplification:

    Article Title: Confronting two biomolecular techniques to detect NRF2 gene polymorphism biomarkers
    Article Snippet: .. Enzymatic digestion of NRF2 -617 A/G amplicon was performed with 15 Units per sample of BseRI restriction enzyme (New England Biolabs, Euroclone), incubated for 90 min at 37°C followed by 20 min at 80°C for enzyme inactivation. ..

    Article Title: A variation in KCNQ1 gene is associated with repaglinide efficacy on insulin resistance in Chinese Type 2 Diabetes Mellitus Patients
    Article Snippet: .. Amplified DNA was digested with BseRI (NEB, Beijing, China). .. OATP1B1 T521C genotypes were detected using the amplification refractory mutation system with four primers: forward primer: 5′-AAGTAGTTAAATTTGTAATAGAAATGC-3′, reverse primer: 5′-GTAGACAAAGGGAAAGTGATCATA-3′; forward primer for wild-type genotype: 5′-GGGTCATACATGTGGATATAAGT-3′, reverse primer for mutant variants: 5′-AA GCATATTACCCATGAACG-3′.

    Article Title: Identification and characterization of two CD4 alleles in Microminipigs
    Article Snippet: .. PCR amplification was performed on genomic DNA to amplify CD4 exon 3, and the PCR products were digested with an enzyme, Bse RI (New England Biolabs Inc., Ipswich, MA). .. The allele-specific bands were analyzed by 2 % agarose gel electrophoresis.

    Article Title: Rapid modification of the pET-28 expression vector for ligation independent cloning using homologous recombination in Saccharomyces cerevisiae
    Article Snippet: Amplification of the desired gene is followed by agarose gel purification, and eluted into 50 μl of water. .. Two micrograms of the pGAY-28 vector are restricted with BseRI (NEB), agarose gel purified, and eluted into 50 μl of water.

    Article Title: A Variation in the ABCC8 Gene Is Associated with Type 2 Diabetes Mellitus and Repaglinide Efficacy in Chinese Type 2 Diabetes Mellitus Patients
    Article Snippet: For amplification of ABCC8 rs1801261 site PCR primer sequence: forward primer: 5'-AGCACCCTGGAGGGAGTTGA-3'; reverse primer: 5'-TCCCTCTTAACTGGGTCCTCC-3'. .. The resultant DNA products were digested by BseRI (NEB).

    Article Title: Probiotic Escherichia coli inhibits biofilm formation of pathogenic E. coli via extracellular activity of DegP
    Article Snippet: The degP gene was amplified by PCR with degPfd and degPrv primers (Supplementary Table ) using Pfu polymerase at 98 °C for 30 s, with 35 cycles of 98 °C for 30 s, 54 °C for 30 s, and 72 °C for 1 min, as well as a final extension of 72 °C for 5 min followed by DNA purification using a CyclePure kit (Omega Bio-Tek, Norcross, GA). .. The pCA24N plasmid and degP PCR products were digested with restriction enzymes BseRI and HindIII (New England Biolabs, Ipswich, MA, USA) and purified.

    Article Title: Probiotic Escherichia coli inhibits biofilm formation of pathogenic E. coli via extracellular activity of DegP
    Article Snippet: The degP gene was amplified by PCR with degPfd and degPrv primers (Supplementary Table ) using Pfu polymerase at 98 °C for 30 s, with 35 cycles of 98 °C for 30 s, 54 °C for 30 s, and 72 °C for 1 min, as well as a final extension of 72 °C for 5 min followed by DNA purification using a CyclePure kit (Omega Bio-Tek, Norcross, GA). .. The pCA24N plasmid and degP PCR products were digested with restriction enzymes BseRI and HindIII (New England Biolabs, Ipswich, MA, USA) and purified.

    Article Title: Topoisomerase II? Binding Protein 1 c.*229C > T (rs115160714) Gene Polymorphism and Endometrial Cancer Risk
    Article Snippet: The DNA samples were amplified in the presence of 200 μmol dNTPs, 10 % dimethylsulfoxide, 1 x Taq polymerase buffer, 1.5 mM MgCl2 and 0.5U AmpliTaq Gold (PE Applied Biosystems, Foster, CA). .. Subsequently, RFLP analysis was performed on 20 microliters each of the respective PCR products by subjecting them to the following restriction enzymes: at a 5U concentration: BseR I (at 37 °C for 3 h) for rs115160714 and Ras I (at 37 °C for 16 h) for rs112843513 (both from New England Biolabs, UK).

    Cytometry:

    Article Title: Identification and characterization of two CD4 alleles in Microminipigs
    Article Snippet: PCR amplification was performed on genomic DNA to amplify CD4 exon 3, and the PCR products were digested with an enzyme, Bse RI (New England Biolabs Inc., Ipswich, MA). .. In addition, CD4 genotypes and phenotypes were assigned in 143 Microminipigs by the PCR-RFLP methods and flow cytometry as described above.

    Construct:

    Article Title: Probiotic Escherichia coli inhibits biofilm formation of pathogenic E. coli via extracellular activity of DegP
    Article Snippet: The pCA24N plasmid and degP PCR products were digested with restriction enzymes BseRI and HindIII (New England Biolabs, Ipswich, MA, USA) and purified. .. The constructed plasmid pCA24N- degP was confirmed by sequencing with primers seqfd and seqrv (Supplementary Table ).

    Article Title: Probiotic Escherichia coli inhibits biofilm formation of pathogenic E. coli via extracellular activity of DegP
    Article Snippet: The pCA24N plasmid and degP PCR products were digested with restriction enzymes BseRI and HindIII (New England Biolabs, Ipswich, MA, USA) and purified. .. The constructed plasmid pCA24N-degP was confirmed by sequencing with primers seqfd and seqrv (Supplementary Table ).

    Electrophoresis:

    Article Title: Topoisomerase II? Binding Protein 1 c.*229C > T (rs115160714) Gene Polymorphism and Endometrial Cancer Risk
    Article Snippet: Subsequently, RFLP analysis was performed on 20 microliters each of the respective PCR products by subjecting them to the following restriction enzymes: at a 5U concentration: BseR I (at 37 °C for 3 h) for rs115160714 and Ras I (at 37 °C for 16 h) for rs112843513 (both from New England Biolabs, UK). .. The products were analyzed by electrophoresis on 3 % agarose gels and ethidium bromide-stained.

    Incubation:

    Article Title: Confronting two biomolecular techniques to detect NRF2 gene polymorphism biomarkers
    Article Snippet: .. Enzymatic digestion of NRF2 -617 A/G amplicon was performed with 15 Units per sample of BseRI restriction enzyme (New England Biolabs, Euroclone), incubated for 90 min at 37°C followed by 20 min at 80°C for enzyme inactivation. ..

    Article Title: Engineering filamentous phage carriers to improve focusing of antibody responses against peptides
    Article Snippet: The extension reaction was incubated on ice for 5 minutes, at 25°C for 5 minutes, then at 37°C for one hour. .. To select for the desired RF, 10 µg of total RF DNA was digested with Bme1580I and BseRI (New England Biolabs, Ipswich, MA), whose restriction sites are present in gene3 of WT phage but not in the Δ3 variant).

    Article Title: Rapid modification of the pET-28 expression vector for ligation independent cloning using homologous recombination in Saccharomyces cerevisiae
    Article Snippet: Two micrograms of the pGAY-28 vector are restricted with BseRI (NEB), agarose gel purified, and eluted into 50 μl of water. .. Independently, both the linearized pGAY-28 and the target amplicon are incubated with nucleoside triphosphates in the following manner: 2 μl of 100 mM dATP is added to 50 μl of the purified vector, and 2 μl of 100 mM dTTP is added to 50 μl of the purified insert.

    Article Title: PCR and Restriction Endonuclease Analysis for Rapid Identification of Human Adenovirus Subgenera
    Article Snippet: The 140-bp PCR products generated from clinical isolates were digested with the REs Taq I, Avi II, and Aat II (all from Roche Diagnostics Ltd., Lewes, United Kingdom) and Bse RI and Mnl I (both from New England BioLabs Incorporated, Hitchin, United Kingdom). .. In a total volume of 20 μl, all reaction mixtures were prepared as recommended by the manufacturers, and those with REs Taq I, Avi II, and Aat II were incubated for 3 h at the appropriate temperature and those with REs Mnl I and Bse RI were incubated overnight at the appropriate temperature.

    Transformation Assay:

    Article Title: Engineering filamentous phage carriers to improve focusing of antibody responses against peptides
    Article Snippet: After induction of the tetracycline ( tet ) resistance gene in NZY/tet (0.2 µg/ml) for 1 hour at 37°C, E. coli MC1061 cells transformed with the mutagenesis reaction were grown in a 400-ml overnight ( O/N ) NZY/tet (10 µg/ml) culture at 37°C, and replicative form ( RF ) DNA was purified from bacterial pellets using a Qiagen® plasmid midi kit using the manufacturer’s protocol for low copy-number plasmids. .. To select for the desired RF, 10 µg of total RF DNA was digested with Bme1580I and BseRI (New England Biolabs, Ipswich, MA), whose restriction sites are present in gene3 of WT phage but not in the Δ3 variant).

    Article Title: Probiotic Escherichia coli inhibits biofilm formation of pathogenic E. coli via extracellular activity of DegP
    Article Snippet: The pCA24N plasmid and degP PCR products were digested with restriction enzymes BseRI and HindIII (New England Biolabs, Ipswich, MA, USA) and purified. .. EcN cells were transformed with the ligated plasmid by electroporation (Bio-Rad, Hercules, CA, USA).

    Article Title: Probiotic Escherichia coli inhibits biofilm formation of pathogenic E. coli via extracellular activity of DegP
    Article Snippet: The pCA24N plasmid and degP PCR products were digested with restriction enzymes BseRI and HindIII (New England Biolabs, Ipswich, MA, USA) and purified. .. EcN cells were transformed with the ligated plasmid by electroporation (Bio-Rad, Hercules, CA, USA).

    Over Expression:

    Article Title: Rapid modification of the pET-28 expression vector for ligation independent cloning using homologous recombination in Saccharomyces cerevisiae
    Article Snippet: Paragraph title: 2.4. Standard protocol for subcloning into pGAY-28 for overexpression in E. coli ... Two micrograms of the pGAY-28 vector are restricted with BseRI (NEB), agarose gel purified, and eluted into 50 μl of water.

    Gel Purification:

    Article Title: Recursive Directional Ligation by Plasmid Reconstruction allows Rapid and Seamless Cloning of Oligomeric Genes
    Article Snippet: The ‘B’ fragment was obtained by digestion of 4 μg of ELP1 -30 with 8 U BseRI and 40 U BglI for 3 hours at 37°C in NEB Buffer 2. .. The 2341 bp band was excised from the gel and purified with Qiagen’s gel purification kit.

    Electroporation:

    Article Title: Probiotic Escherichia coli inhibits biofilm formation of pathogenic E. coli via extracellular activity of DegP
    Article Snippet: The pCA24N plasmid and degP PCR products were digested with restriction enzymes BseRI and HindIII (New England Biolabs, Ipswich, MA, USA) and purified. .. EcN cells were transformed with the ligated plasmid by electroporation (Bio-Rad, Hercules, CA, USA).

    Article Title: Probiotic Escherichia coli inhibits biofilm formation of pathogenic E. coli via extracellular activity of DegP
    Article Snippet: The pCA24N plasmid and degP PCR products were digested with restriction enzymes BseRI and HindIII (New England Biolabs, Ipswich, MA, USA) and purified. .. EcN cells were transformed with the ligated plasmid by electroporation (Bio-Rad, Hercules, CA, USA).

    Flow Cytometry:

    Article Title: Identification and characterization of two CD4 alleles in Microminipigs
    Article Snippet: PCR amplification was performed on genomic DNA to amplify CD4 exon 3, and the PCR products were digested with an enzyme, Bse RI (New England Biolabs Inc., Ipswich, MA). .. In addition, CD4 genotypes and phenotypes were assigned in 143 Microminipigs by the PCR-RFLP methods and flow cytometry as described above.

    Sequencing:

    Article Title: Developmental Profile of the Aberrant Dopamine D2 Receptor Response in Striatal Cholinergic Interneurons in DYT1 Dystonia
    Article Snippet: The human torsinA coding sequence was identified via 1.5% agarose gel electrophoresis. .. The mouse genotype was confirmed by restriction digestion with BseRI (New England BioLabs, USA).

    Article Title: Rapid modification of the pET-28 expression vector for ligation independent cloning using homologous recombination in Saccharomyces cerevisiae
    Article Snippet: The optional C-terminal tag can be avoided by incorporating a stop codon 5′ of the (Z) sequence during primer design (e.g., 5′- GTGGTGGTGGTGGTGGTGATG TTA (Z) -3′, stop codon underlined). .. Two micrograms of the pGAY-28 vector are restricted with BseRI (NEB), agarose gel purified, and eluted into 50 μl of water.

    Article Title: A Variation in the ABCC8 Gene Is Associated with Type 2 Diabetes Mellitus and Repaglinide Efficacy in Chinese Type 2 Diabetes Mellitus Patients
    Article Snippet: For amplification of ABCC8 rs1801261 site PCR primer sequence: forward primer: 5'-AGCACCCTGGAGGGAGTTGA-3'; reverse primer: 5'-TCCCTCTTAACTGGGTCCTCC-3'. .. The resultant DNA products were digested by BseRI (NEB).

    Article Title: Probiotic Escherichia coli inhibits biofilm formation of pathogenic E. coli via extracellular activity of DegP
    Article Snippet: The pCA24N plasmid and degP PCR products were digested with restriction enzymes BseRI and HindIII (New England Biolabs, Ipswich, MA, USA) and purified. .. The constructed plasmid pCA24N- degP was confirmed by sequencing with primers seqfd and seqrv (Supplementary Table ).

    Article Title: Probiotic Escherichia coli inhibits biofilm formation of pathogenic E. coli via extracellular activity of DegP
    Article Snippet: The pCA24N plasmid and degP PCR products were digested with restriction enzymes BseRI and HindIII (New England Biolabs, Ipswich, MA, USA) and purified. .. The constructed plasmid pCA24N-degP was confirmed by sequencing with primers seqfd and seqrv (Supplementary Table ).

    Ligation:

    Article Title: Controlling biofilm formation, prophage excision and cell death by rewiring global regulator H-NS of Escherichia coli
    Article Snippet: The epPCR product was cloned into pCA24N‐hha hns using BseRI and HindIII after treating the plasmid with Antarctic phosphatase (New England Biolabs, Beverly, MA, USA). .. The ligation mixture was electroporated into BW25113 hha hns as described previously ( ).

    Article Title: Engineering global regulator Hha of Escherichia coli to control biofilm dispersal
    Article Snippet: The epPCR product was cloned into pCA24N‐hha using BseRI and HindIII after treating the plasmid with Antarctic phosphatase (New England Biolabs, Beverly, MA, USA). .. The ligation mixture was electroporated into BW25113 hha tnaA competent cells using the Gene Pulser/Pulse Controller (Bio‐Rad, Hercules, CA, USA) at 1.25 kV cm−1 , 25 µF and 200 Ω.

    Article Title: Engineering a Novel c-di-GMP-Binding Protein for Biofilm Dispersal
    Article Snippet: The epPCR product was cloned into pCA24N_ bdcA using restriction enzymes BseRI and HindIII after treating the plasmid with Antarctic phosphatase (New England Biolabs). .. The ligation mixture was electroporated into BW25113 bdcA .

    Low Copy Number:

    Article Title: Engineering filamentous phage carriers to improve focusing of antibody responses against peptides
    Article Snippet: After induction of the tetracycline ( tet ) resistance gene in NZY/tet (0.2 µg/ml) for 1 hour at 37°C, E. coli MC1061 cells transformed with the mutagenesis reaction were grown in a 400-ml overnight ( O/N ) NZY/tet (10 µg/ml) culture at 37°C, and replicative form ( RF ) DNA was purified from bacterial pellets using a Qiagen® plasmid midi kit using the manufacturer’s protocol for low copy-number plasmids. .. To select for the desired RF, 10 µg of total RF DNA was digested with Bme1580I and BseRI (New England Biolabs, Ipswich, MA), whose restriction sites are present in gene3 of WT phage but not in the Δ3 variant).

    Generated:

    Article Title: Developmental Profile of the Aberrant Dopamine D2 Receptor Response in Striatal Cholinergic Interneurons in DYT1 Dystonia
    Article Snippet: Transgenic mice were generated as previously described and bred at our animal house. .. The mouse genotype was confirmed by restriction digestion with BseRI (New England BioLabs, USA).

    Article Title: PCR and Restriction Endonuclease Analysis for Rapid Identification of Human Adenovirus Subgenera
    Article Snippet: .. The 140-bp PCR products generated from clinical isolates were digested with the REs Taq I, Avi II, and Aat II (all from Roche Diagnostics Ltd., Lewes, United Kingdom) and Bse RI and Mnl I (both from New England BioLabs Incorporated, Hitchin, United Kingdom). .. In a total volume of 20 μl, all reaction mixtures were prepared as recommended by the manufacturers, and those with REs Taq I, Avi II, and Aat II were incubated for 3 h at the appropriate temperature and those with REs Mnl I and Bse RI were incubated overnight at the appropriate temperature.

    Polymerase Chain Reaction:

    Article Title: Developmental Profile of the Aberrant Dopamine D2 Receptor Response in Striatal Cholinergic Interneurons in DYT1 Dystonia
    Article Snippet: DNA extracted from mouse tail using the Extract-N-Amp Tissue PCR Kit (Catalog Numbers XNAT2, Sigma-Aldrich, Italy) was used for genotyping as described previously . .. The mouse genotype was confirmed by restriction digestion with BseRI (New England BioLabs, USA).

    Article Title: A variation in KCNQ1 gene is associated with repaglinide efficacy on insulin resistance in Chinese Type 2 Diabetes Mellitus Patients
    Article Snippet: The CYP2C8 *3 Arg139Lys genotype was also detected with the PCR-RFLP assay, and the primers used were 5′-AGGCAATTCCCCAAT ATCTC-3′ (sense) and 5′-ACTCCTCCACAAGGCAGTGA-3′ (antisense). .. Amplified DNA was digested with BseRI (NEB, Beijing, China).

    Article Title: Identification and characterization of two CD4 alleles in Microminipigs
    Article Snippet: .. PCR amplification was performed on genomic DNA to amplify CD4 exon 3, and the PCR products were digested with an enzyme, Bse RI (New England Biolabs Inc., Ipswich, MA). .. The allele-specific bands were analyzed by 2 % agarose gel electrophoresis.

    Article Title: A Variation in the ABCC8 Gene Is Associated with Type 2 Diabetes Mellitus and Repaglinide Efficacy in Chinese Type 2 Diabetes Mellitus Patients
    Article Snippet: The polymorphism of CYP2C8*3 Arg139Lys was also genotyped by a PCR-RFLP assay, where the following primers were used: 50-AGGCAATTCCCCAATATCTC-30 (sense) and 50-ACTCCTCCACAAGGCAGTGA-30 (antisense). .. The resultant DNA products were digested by BseRI (NEB).

    Article Title: Probiotic Escherichia coli inhibits biofilm formation of pathogenic E. coli via extracellular activity of DegP
    Article Snippet: .. The pCA24N plasmid and degP PCR products were digested with restriction enzymes BseRI and HindIII (New England Biolabs, Ipswich, MA, USA) and purified. .. The insert and vector were ligated by incubating with T4 DNA ligase (New England Biolabs, Ipswich, MA, USA) at 16 °C overnight.

    Article Title: Probiotic Escherichia coli inhibits biofilm formation of pathogenic E. coli via extracellular activity of DegP
    Article Snippet: .. The pCA24N plasmid and degP PCR products were digested with restriction enzymes BseRI and HindIII (New England Biolabs, Ipswich, MA, USA) and purified. .. The insert and vector were ligated by incubating with T4 DNA ligase (New England Biolabs, Ipswich, MA, USA) at 16 °C overnight.

    Article Title: Engineering a Novel c-di-GMP-Binding Protein for Biofilm Dispersal
    Article Snippet: The PCR program was set as 94°C for 5 min, followed by 30 cycles at 94°C for 1 min, 55°C for 1 min, and 72°C for 2 min, with a final extension step of 72°C for 7 min. .. The epPCR product was cloned into pCA24N_ bdcA using restriction enzymes BseRI and HindIII after treating the plasmid with Antarctic phosphatase (New England Biolabs).

    Article Title: PCR and Restriction Endonuclease Analysis for Rapid Identification of Human Adenovirus Subgenera
    Article Snippet: .. The 140-bp PCR products generated from clinical isolates were digested with the REs Taq I, Avi II, and Aat II (all from Roche Diagnostics Ltd., Lewes, United Kingdom) and Bse RI and Mnl I (both from New England BioLabs Incorporated, Hitchin, United Kingdom). .. In a total volume of 20 μl, all reaction mixtures were prepared as recommended by the manufacturers, and those with REs Taq I, Avi II, and Aat II were incubated for 3 h at the appropriate temperature and those with REs Mnl I and Bse RI were incubated overnight at the appropriate temperature.

    Article Title: Topoisomerase II? Binding Protein 1 c.*229C > T (rs115160714) Gene Polymorphism and Endometrial Cancer Risk
    Article Snippet: .. Subsequently, RFLP analysis was performed on 20 microliters each of the respective PCR products by subjecting them to the following restriction enzymes: at a 5U concentration: BseR I (at 37 °C for 3 h) for rs115160714 and Ras I (at 37 °C for 16 h) for rs112843513 (both from New England Biolabs, UK). .. In the case of rs115160714 the lengths of fragments obtained by digestion of each 211-bp fragment by BseR I were 84 bp and 127 bp for wild type, and 211 bp for mutant type.

    Nucleic Acid Electrophoresis:

    Article Title: Developmental Profile of the Aberrant Dopamine D2 Receptor Response in Striatal Cholinergic Interneurons in DYT1 Dystonia
    Article Snippet: The mouse genotype was confirmed by restriction digestion with BseRI (New England BioLabs, USA). .. Then, fragment profiles were identified by gel electrophoresis, using 2% SYBR Safe agarose (Invitrogen, Italy).

    Mutagenesis:

    Article Title: Developmental Profile of the Aberrant Dopamine D2 Receptor Response in Striatal Cholinergic Interneurons in DYT1 Dystonia
    Article Snippet: The mouse genotype was confirmed by restriction digestion with BseRI (New England BioLabs, USA). .. The human torsinA and human mutant torsinA PCR products were digested with BseRI into different fragments (279 bp, 238 bp, 24 bp, 22 bp and 279 bp, 259 bp, and 22 bp, respectively).

    Article Title: A variation in KCNQ1 gene is associated with repaglinide efficacy on insulin resistance in Chinese Type 2 Diabetes Mellitus Patients
    Article Snippet: Amplified DNA was digested with BseRI (NEB, Beijing, China). .. OATP1B1 T521C genotypes were detected using the amplification refractory mutation system with four primers: forward primer: 5′-AAGTAGTTAAATTTGTAATAGAAATGC-3′, reverse primer: 5′-GTAGACAAAGGGAAAGTGATCATA-3′; forward primer for wild-type genotype: 5′-GGGTCATACATGTGGATATAAGT-3′, reverse primer for mutant variants: 5′-AA GCATATTACCCATGAACG-3′.

    Article Title: Controlling biofilm formation, prophage excision and cell death by rewiring global regulator H-NS of Escherichia coli
    Article Snippet: Paragraph title: epPCR for random mutagenesis ... The epPCR product was cloned into pCA24N‐hha hns using BseRI and HindIII after treating the plasmid with Antarctic phosphatase (New England Biolabs, Beverly, MA, USA).

    Article Title: Engineering filamentous phage carriers to improve focusing of antibody responses against peptides
    Article Snippet: After induction of the tetracycline ( tet ) resistance gene in NZY/tet (0.2 µg/ml) for 1 hour at 37°C, E. coli MC1061 cells transformed with the mutagenesis reaction were grown in a 400-ml overnight ( O/N ) NZY/tet (10 µg/ml) culture at 37°C, and replicative form ( RF ) DNA was purified from bacterial pellets using a Qiagen® plasmid midi kit using the manufacturer’s protocol for low copy-number plasmids. .. To select for the desired RF, 10 µg of total RF DNA was digested with Bme1580I and BseRI (New England Biolabs, Ipswich, MA), whose restriction sites are present in gene3 of WT phage but not in the Δ3 variant).

    Article Title: A Variation in the ABCC8 Gene Is Associated with Type 2 Diabetes Mellitus and Repaglinide Efficacy in Chinese Type 2 Diabetes Mellitus Patients
    Article Snippet: The resultant DNA products were digested by BseRI (NEB). .. The OATP1B1 T521C genotypes were detected by the amplification refractory mutation system (ARMS) using the following four primer pairs: forward primer: 50-AAGTAGTTAAATTTGTAATAGAAATGC-30, reverse primer: 50-GTAGACAAAGGGAAAGTGATCATA-30; forward primer for wild-type genotype: 50GGGTCATACATGTGGATATAAGT-30, reverse primer for mutant variants: 50-AAGCATATTACCCATGAACG-30.

    Article Title: Engineering global regulator Hha of Escherichia coli to control biofilm dispersal
    Article Snippet: Paragraph title: epPCR for random mutagenesis ... The epPCR product was cloned into pCA24N‐hha using BseRI and HindIII after treating the plasmid with Antarctic phosphatase (New England Biolabs, Beverly, MA, USA).

    Article Title: Engineering a Novel c-di-GMP-Binding Protein for Biofilm Dispersal
    Article Snippet: Paragraph title: Random mutagenesis and saturation mutagenesis ... The epPCR product was cloned into pCA24N_ bdcA using restriction enzymes BseRI and HindIII after treating the plasmid with Antarctic phosphatase (New England Biolabs).

    Article Title: Topoisomerase II? Binding Protein 1 c.*229C > T (rs115160714) Gene Polymorphism and Endometrial Cancer Risk
    Article Snippet: Subsequently, RFLP analysis was performed on 20 microliters each of the respective PCR products by subjecting them to the following restriction enzymes: at a 5U concentration: BseR I (at 37 °C for 3 h) for rs115160714 and Ras I (at 37 °C for 16 h) for rs112843513 (both from New England Biolabs, UK). .. In the case of rs115160714 the lengths of fragments obtained by digestion of each 211-bp fragment by BseR I were 84 bp and 127 bp for wild type, and 211 bp for mutant type.

    Isolation:

    Article Title: A variation in KCNQ1 gene is associated with repaglinide efficacy on insulin resistance in Chinese Type 2 Diabetes Mellitus Patients
    Article Snippet: Genotyping Genomic DNA was isolated from peripheral blood leucocytes using a SiMax Genome DNA Kit (Sbsbio, Shanghai, China) and then stored at 4 °C until use. .. Amplified DNA was digested with BseRI (NEB, Beijing, China).

    Subcloning:

    Article Title: Rapid modification of the pET-28 expression vector for ligation independent cloning using homologous recombination in Saccharomyces cerevisiae
    Article Snippet: Paragraph title: 2.4. Standard protocol for subcloning into pGAY-28 for overexpression in E. coli ... Two micrograms of the pGAY-28 vector are restricted with BseRI (NEB), agarose gel purified, and eluted into 50 μl of water.

    Purification:

    Article Title: Engineering filamentous phage carriers to improve focusing of antibody responses against peptides
    Article Snippet: After induction of the tetracycline ( tet ) resistance gene in NZY/tet (0.2 µg/ml) for 1 hour at 37°C, E. coli MC1061 cells transformed with the mutagenesis reaction were grown in a 400-ml overnight ( O/N ) NZY/tet (10 µg/ml) culture at 37°C, and replicative form ( RF ) DNA was purified from bacterial pellets using a Qiagen® plasmid midi kit using the manufacturer’s protocol for low copy-number plasmids. .. To select for the desired RF, 10 µg of total RF DNA was digested with Bme1580I and BseRI (New England Biolabs, Ipswich, MA), whose restriction sites are present in gene3 of WT phage but not in the Δ3 variant).

    Article Title: Rapid modification of the pET-28 expression vector for ligation independent cloning using homologous recombination in Saccharomyces cerevisiae
    Article Snippet: .. Two micrograms of the pGAY-28 vector are restricted with BseRI (NEB), agarose gel purified, and eluted into 50 μl of water. .. The A260 for both the insert and vector are recorded.

    Article Title: Probiotic Escherichia coli inhibits biofilm formation of pathogenic E. coli via extracellular activity of DegP
    Article Snippet: .. The pCA24N plasmid and degP PCR products were digested with restriction enzymes BseRI and HindIII (New England Biolabs, Ipswich, MA, USA) and purified. .. The insert and vector were ligated by incubating with T4 DNA ligase (New England Biolabs, Ipswich, MA, USA) at 16 °C overnight.

    Article Title: Probiotic Escherichia coli inhibits biofilm formation of pathogenic E. coli via extracellular activity of DegP
    Article Snippet: .. The pCA24N plasmid and degP PCR products were digested with restriction enzymes BseRI and HindIII (New England Biolabs, Ipswich, MA, USA) and purified. .. The insert and vector were ligated by incubating with T4 DNA ligase (New England Biolabs, Ipswich, MA, USA) at 16 °C overnight.

    Article Title: Recursive Directional Ligation by Plasmid Reconstruction allows Rapid and Seamless Cloning of Oligomeric Genes
    Article Snippet: The ‘B’ fragment was obtained by digestion of 4 μg of ELP1 -30 with 8 U BseRI and 40 U BglI for 3 hours at 37°C in NEB Buffer 2. .. The 2341 bp band was excised from the gel and purified with Qiagen’s gel purification kit.

    Transgenic Assay:

    Article Title: Developmental Profile of the Aberrant Dopamine D2 Receptor Response in Striatal Cholinergic Interneurons in DYT1 Dystonia
    Article Snippet: Paragraph title: Transgenic animals and tissue preparation ... The mouse genotype was confirmed by restriction digestion with BseRI (New England BioLabs, USA).

    Selection:

    Article Title: Engineering filamentous phage carriers to improve focusing of antibody responses against peptides
    Article Snippet: To select for the desired RF, 10 µg of total RF DNA was digested with Bme1580I and BseRI (New England Biolabs, Ipswich, MA), whose restriction sites are present in gene3 of WT phage but not in the Δ3 variant). .. The transformed cells were propagated as above and RF DNA was prepared for a second round of negative selection.

    Mouse Assay:

    Article Title: Developmental Profile of the Aberrant Dopamine D2 Receptor Response in Striatal Cholinergic Interneurons in DYT1 Dystonia
    Article Snippet: Transgenic mice were generated as previously described and bred at our animal house. .. The mouse genotype was confirmed by restriction digestion with BseRI (New England BioLabs, USA).

    Plasmid Preparation:

    Article Title: Controlling biofilm formation, prophage excision and cell death by rewiring global regulator H-NS of Escherichia coli
    Article Snippet: .. The epPCR product was cloned into pCA24N‐hha hns using BseRI and HindIII after treating the plasmid with Antarctic phosphatase (New England Biolabs, Beverly, MA, USA). .. The ligation mixture was electroporated into BW25113 hha hns as described previously ( ).

    Article Title: Engineering filamentous phage carriers to improve focusing of antibody responses against peptides
    Article Snippet: After induction of the tetracycline ( tet ) resistance gene in NZY/tet (0.2 µg/ml) for 1 hour at 37°C, E. coli MC1061 cells transformed with the mutagenesis reaction were grown in a 400-ml overnight ( O/N ) NZY/tet (10 µg/ml) culture at 37°C, and replicative form ( RF ) DNA was purified from bacterial pellets using a Qiagen® plasmid midi kit using the manufacturer’s protocol for low copy-number plasmids. .. To select for the desired RF, 10 µg of total RF DNA was digested with Bme1580I and BseRI (New England Biolabs, Ipswich, MA), whose restriction sites are present in gene3 of WT phage but not in the Δ3 variant).

    Article Title: Rapid modification of the pET-28 expression vector for ligation independent cloning using homologous recombination in Saccharomyces cerevisiae
    Article Snippet: .. Two micrograms of the pGAY-28 vector are restricted with BseRI (NEB), agarose gel purified, and eluted into 50 μl of water. .. The A260 for both the insert and vector are recorded.

    Article Title: Probiotic Escherichia coli inhibits biofilm formation of pathogenic E. coli via extracellular activity of DegP
    Article Snippet: .. The pCA24N plasmid and degP PCR products were digested with restriction enzymes BseRI and HindIII (New England Biolabs, Ipswich, MA, USA) and purified. .. The insert and vector were ligated by incubating with T4 DNA ligase (New England Biolabs, Ipswich, MA, USA) at 16 °C overnight.

    Article Title: Engineering global regulator Hha of Escherichia coli to control biofilm dispersal
    Article Snippet: .. The epPCR product was cloned into pCA24N‐hha using BseRI and HindIII after treating the plasmid with Antarctic phosphatase (New England Biolabs, Beverly, MA, USA). .. The ligation mixture was electroporated into BW25113 hha tnaA competent cells using the Gene Pulser/Pulse Controller (Bio‐Rad, Hercules, CA, USA) at 1.25 kV cm−1 , 25 µF and 200 Ω.

    Article Title: Probiotic Escherichia coli inhibits biofilm formation of pathogenic E. coli via extracellular activity of DegP
    Article Snippet: .. The pCA24N plasmid and degP PCR products were digested with restriction enzymes BseRI and HindIII (New England Biolabs, Ipswich, MA, USA) and purified. .. The insert and vector were ligated by incubating with T4 DNA ligase (New England Biolabs, Ipswich, MA, USA) at 16 °C overnight.

    Article Title: Engineering a Novel c-di-GMP-Binding Protein for Biofilm Dispersal
    Article Snippet: .. The epPCR product was cloned into pCA24N_ bdcA using restriction enzymes BseRI and HindIII after treating the plasmid with Antarctic phosphatase (New England Biolabs). .. The ligation mixture was electroporated into BW25113 bdcA .

    Affinity Chromatography:

    Article Title: Rapid modification of the pET-28 expression vector for ligation independent cloning using homologous recombination in Saccharomyces cerevisiae
    Article Snippet: The LIC cassette of pGAY-28 contains dual histidine tags for purification of proteins by immobilized metal affinity chromatography, with a mandatory N-terminal hexahistidine tag and an optional C-terminal heptahistidine tag. .. Two micrograms of the pGAY-28 vector are restricted with BseRI (NEB), agarose gel purified, and eluted into 50 μl of water.

    Agarose Gel Electrophoresis:

    Article Title: Developmental Profile of the Aberrant Dopamine D2 Receptor Response in Striatal Cholinergic Interneurons in DYT1 Dystonia
    Article Snippet: The human torsinA coding sequence was identified via 1.5% agarose gel electrophoresis. .. The mouse genotype was confirmed by restriction digestion with BseRI (New England BioLabs, USA).

    Article Title: Identification and characterization of two CD4 alleles in Microminipigs
    Article Snippet: PCR amplification was performed on genomic DNA to amplify CD4 exon 3, and the PCR products were digested with an enzyme, Bse RI (New England Biolabs Inc., Ipswich, MA). .. The allele-specific bands were analyzed by 2 % agarose gel electrophoresis.

    Article Title: Rapid modification of the pET-28 expression vector for ligation independent cloning using homologous recombination in Saccharomyces cerevisiae
    Article Snippet: .. Two micrograms of the pGAY-28 vector are restricted with BseRI (NEB), agarose gel purified, and eluted into 50 μl of water. .. The A260 for both the insert and vector are recorded.

    Article Title: A Variation in the ABCC8 Gene Is Associated with Type 2 Diabetes Mellitus and Repaglinide Efficacy in Chinese Type 2 Diabetes Mellitus Patients
    Article Snippet: The resultant DNA products were digested by BseRI (NEB). .. All obtained DNA fragments were separated by 2% agarose gel electrophoresis followed by ethidium bromide staining and visualization with UV transillumination.

    Article Title: Recursive Directional Ligation by Plasmid Reconstruction allows Rapid and Seamless Cloning of Oligomeric Genes
    Article Snippet: The ‘B’ fragment was obtained by digestion of 4 μg of ELP1 -30 with 8 U BseRI and 40 U BglI for 3 hours at 37°C in NEB Buffer 2. .. Both DNA digests were run on a low melting point agarose gel.

    Ethanol Precipitation:

    Article Title: Engineering filamentous phage carriers to improve focusing of antibody responses against peptides
    Article Snippet: To select for the desired RF, 10 µg of total RF DNA was digested with Bme1580I and BseRI (New England Biolabs, Ipswich, MA), whose restriction sites are present in gene3 of WT phage but not in the Δ3 variant). .. The digested RF DNA was purified by phenol-chloroform extraction followed by ethanol precipitation, and 1.6 µg was used to transform electrocompetent E. coli MC1061 cells.

    Concentration Assay:

    Article Title: Topoisomerase II? Binding Protein 1 c.*229C > T (rs115160714) Gene Polymorphism and Endometrial Cancer Risk
    Article Snippet: .. Subsequently, RFLP analysis was performed on 20 microliters each of the respective PCR products by subjecting them to the following restriction enzymes: at a 5U concentration: BseR I (at 37 °C for 3 h) for rs115160714 and Ras I (at 37 °C for 16 h) for rs112843513 (both from New England Biolabs, UK). .. In the case of rs115160714 the lengths of fragments obtained by digestion of each 211-bp fragment by BseR I were 84 bp and 127 bp for wild type, and 211 bp for mutant type.

    DNA Purification:

    Article Title: Probiotic Escherichia coli inhibits biofilm formation of pathogenic E. coli via extracellular activity of DegP
    Article Snippet: The degP gene was amplified by PCR with degPfd and degPrv primers (Supplementary Table ) using Pfu polymerase at 98 °C for 30 s, with 35 cycles of 98 °C for 30 s, 54 °C for 30 s, and 72 °C for 1 min, as well as a final extension of 72 °C for 5 min followed by DNA purification using a CyclePure kit (Omega Bio-Tek, Norcross, GA). .. The pCA24N plasmid and degP PCR products were digested with restriction enzymes BseRI and HindIII (New England Biolabs, Ipswich, MA, USA) and purified.

    Article Title: Probiotic Escherichia coli inhibits biofilm formation of pathogenic E. coli via extracellular activity of DegP
    Article Snippet: The degP gene was amplified by PCR with degPfd and degPrv primers (Supplementary Table ) using Pfu polymerase at 98 °C for 30 s, with 35 cycles of 98 °C for 30 s, 54 °C for 30 s, and 72 °C for 1 min, as well as a final extension of 72 °C for 5 min followed by DNA purification using a CyclePure kit (Omega Bio-Tek, Norcross, GA). .. The pCA24N plasmid and degP PCR products were digested with restriction enzymes BseRI and HindIII (New England Biolabs, Ipswich, MA, USA) and purified.

    Staining:

    Article Title: A Variation in the ABCC8 Gene Is Associated with Type 2 Diabetes Mellitus and Repaglinide Efficacy in Chinese Type 2 Diabetes Mellitus Patients
    Article Snippet: The resultant DNA products were digested by BseRI (NEB). .. All obtained DNA fragments were separated by 2% agarose gel electrophoresis followed by ethidium bromide staining and visualization with UV transillumination.

    Variant Assay:

    Article Title: Engineering filamentous phage carriers to improve focusing of antibody responses against peptides
    Article Snippet: .. To select for the desired RF, 10 µg of total RF DNA was digested with Bme1580I and BseRI (New England Biolabs, Ipswich, MA), whose restriction sites are present in gene3 of WT phage but not in the Δ3 variant). .. The digested RF DNA was purified by phenol-chloroform extraction followed by ethanol precipitation, and 1.6 µg was used to transform electrocompetent E. coli MC1061 cells.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs bseri restriction enzyme
    Comparison between CTPPCR and RFLP results for <t>NRF2</t> -653A/G. Confronting two-pair primers–polymerase chain reaction of NRF2 rs35652124 (-653 A/G) single nucleotide polymorphism performed at two different T a (59°- 66°C) using 1 unit/sample of Kapa Hot Start Taq polymerase (A–C) . Restriction fragment length polymorphism analysis after amplicon digestion with <t>BseRI</t> (D–F) . Sample ID and genotype are indicated by numbers and letters at the top and bottom of figures. N: Negative control indicates DNA template omission in the polymerase chain reaction; MW: Molecular weights (100 bp up to 1000 bp). The black lanes are irrelevant samples for which the corresponding confronting two-pair primers–polymerase chain reaction was not reported.
    Bseri Restriction Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bseri restriction enzyme/product/New England Biolabs
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bseri restriction enzyme - by Bioz Stars, 2020-03
    90/100 stars
      Buy from Supplier

    Image Search Results


    Comparison between CTPPCR and RFLP results for NRF2 -653A/G. Confronting two-pair primers–polymerase chain reaction of NRF2 rs35652124 (-653 A/G) single nucleotide polymorphism performed at two different T a (59°- 66°C) using 1 unit/sample of Kapa Hot Start Taq polymerase (A–C) . Restriction fragment length polymorphism analysis after amplicon digestion with BseRI (D–F) . Sample ID and genotype are indicated by numbers and letters at the top and bottom of figures. N: Negative control indicates DNA template omission in the polymerase chain reaction; MW: Molecular weights (100 bp up to 1000 bp). The black lanes are irrelevant samples for which the corresponding confronting two-pair primers–polymerase chain reaction was not reported.

    Journal: Future Science OA

    Article Title: Confronting two biomolecular techniques to detect NRF2 gene polymorphism biomarkers

    doi: 10.4155/fsoa-2018-0075

    Figure Lengend Snippet: Comparison between CTPPCR and RFLP results for NRF2 -653A/G. Confronting two-pair primers–polymerase chain reaction of NRF2 rs35652124 (-653 A/G) single nucleotide polymorphism performed at two different T a (59°- 66°C) using 1 unit/sample of Kapa Hot Start Taq polymerase (A–C) . Restriction fragment length polymorphism analysis after amplicon digestion with BseRI (D–F) . Sample ID and genotype are indicated by numbers and letters at the top and bottom of figures. N: Negative control indicates DNA template omission in the polymerase chain reaction; MW: Molecular weights (100 bp up to 1000 bp). The black lanes are irrelevant samples for which the corresponding confronting two-pair primers–polymerase chain reaction was not reported.

    Article Snippet: Enzymatic digestion of NRF2 -617 A/G amplicon was performed with 15 Units per sample of BseRI restriction enzyme (New England Biolabs, Euroclone), incubated for 90 min at 37°C followed by 20 min at 80°C for enzyme inactivation.

    Techniques: Polymerase Chain Reaction, Amplification, Negative Control