bsmbi  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    BsmBI
    Description:

    Catalog Number:
    R0580L
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs bsmbi
    Yeast Golden Gate <t>(yGG)</t> to assemble transcription units (TUs) flanked by VEGAS adapters. ( A ) yGG reactions to build TUs destined for VEGAS pathway assembly in S. cerevisiae include five parts: a left VEGAS adapter (LVA), a promoter (PRO), a coding sequence (CDS), a terminator (TER) and a right VEGAS adapter (RVA). Each part is flanked by inwardly facing recognition sequences for the BsaI restriction enzyme, an ‘offset cutter’ which cuts outside its recognition sequence (at positions 1/5 bp downstream) to expose the indicated four base-pair overhangs. All parts are cloned into vectors encoding kanamycin resistance (KAN R ) and an E. coli replication origin (Ori). ( B ) The yGG acceptor vector for VEGAS is designed such that outwardly facing BsaI sites expose overhangs corresponding to the 5′ LVA and 3′ RVA overhangs to promote assembly of the TU in the vector during a one-pot restriction-digestion reaction. The RFP cassette, built for expression in E. coli , is cut out of the vector when a TU correctly assembles, enabling white–red screening. The yGG acceptor vector encodes resistance to ampicillin (AMP R ) ( C ) The structure of a VA-flanked TU assembled by yGG. An assembled TU plus the flanking VA sequences may be released from the yGG acceptor vector by digestion with <t>BsmBI.</t>

    https://www.bioz.com/result/bsmbi/product/New England Biolabs
    Average 99 stars, based on 23 article reviews
    Price from $9.99 to $1999.99
    bsmbi - by Bioz Stars, 2019-11
    99/100 stars

    Images

    1) Product Images from "Versatile genetic assembly system (VEGAS) to assemble pathways for expression in S. cerevisiae"

    Article Title: Versatile genetic assembly system (VEGAS) to assemble pathways for expression in S. cerevisiae

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv466

    Yeast Golden Gate (yGG) to assemble transcription units (TUs) flanked by VEGAS adapters. ( A ) yGG reactions to build TUs destined for VEGAS pathway assembly in S. cerevisiae include five parts: a left VEGAS adapter (LVA), a promoter (PRO), a coding sequence (CDS), a terminator (TER) and a right VEGAS adapter (RVA). Each part is flanked by inwardly facing recognition sequences for the BsaI restriction enzyme, an ‘offset cutter’ which cuts outside its recognition sequence (at positions 1/5 bp downstream) to expose the indicated four base-pair overhangs. All parts are cloned into vectors encoding kanamycin resistance (KAN R ) and an E. coli replication origin (Ori). ( B ) The yGG acceptor vector for VEGAS is designed such that outwardly facing BsaI sites expose overhangs corresponding to the 5′ LVA and 3′ RVA overhangs to promote assembly of the TU in the vector during a one-pot restriction-digestion reaction. The RFP cassette, built for expression in E. coli , is cut out of the vector when a TU correctly assembles, enabling white–red screening. The yGG acceptor vector encodes resistance to ampicillin (AMP R ) ( C ) The structure of a VA-flanked TU assembled by yGG. An assembled TU plus the flanking VA sequences may be released from the yGG acceptor vector by digestion with BsmBI.
    Figure Legend Snippet: Yeast Golden Gate (yGG) to assemble transcription units (TUs) flanked by VEGAS adapters. ( A ) yGG reactions to build TUs destined for VEGAS pathway assembly in S. cerevisiae include five parts: a left VEGAS adapter (LVA), a promoter (PRO), a coding sequence (CDS), a terminator (TER) and a right VEGAS adapter (RVA). Each part is flanked by inwardly facing recognition sequences for the BsaI restriction enzyme, an ‘offset cutter’ which cuts outside its recognition sequence (at positions 1/5 bp downstream) to expose the indicated four base-pair overhangs. All parts are cloned into vectors encoding kanamycin resistance (KAN R ) and an E. coli replication origin (Ori). ( B ) The yGG acceptor vector for VEGAS is designed such that outwardly facing BsaI sites expose overhangs corresponding to the 5′ LVA and 3′ RVA overhangs to promote assembly of the TU in the vector during a one-pot restriction-digestion reaction. The RFP cassette, built for expression in E. coli , is cut out of the vector when a TU correctly assembles, enabling white–red screening. The yGG acceptor vector encodes resistance to ampicillin (AMP R ) ( C ) The structure of a VA-flanked TU assembled by yGG. An assembled TU plus the flanking VA sequences may be released from the yGG acceptor vector by digestion with BsmBI.

    Techniques Used: Sequencing, Clone Assay, Plasmid Preparation, Expressing

    VEGAS with adapter homology to assemble the carotenoid pathway in S. cerevisiae . ( A ) The four β-carotene pathway genes ( crtE, crtI, crtYB and tHMG1 ), assembled as TUs flanked by the indicated VAs (see Table 2 for PRO and TER parts), were released from the yGG acceptor vector with BsmBI digestion and co-transformed into yeast with the linearized VEGAS assembly vector. ( B ) S. cerevisiae colonies encoding assembled pathways develop a bright yellow color on medium lacking uracil (SC–Ura; left panel) as well as on YPD medium supplemented with G418 (right panel).
    Figure Legend Snippet: VEGAS with adapter homology to assemble the carotenoid pathway in S. cerevisiae . ( A ) The four β-carotene pathway genes ( crtE, crtI, crtYB and tHMG1 ), assembled as TUs flanked by the indicated VAs (see Table 2 for PRO and TER parts), were released from the yGG acceptor vector with BsmBI digestion and co-transformed into yeast with the linearized VEGAS assembly vector. ( B ) S. cerevisiae colonies encoding assembled pathways develop a bright yellow color on medium lacking uracil (SC–Ura; left panel) as well as on YPD medium supplemented with G418 (right panel).

    Techniques Used: Plasmid Preparation, Transformation Assay

    VEGAS with adapter homology to assemble a five-gene pathway. ( A ) The pathway consisting of VA-flanked TUs assembled by yGG may be released in one piece from the yGG acceptor vector by digestion with BsmBI (scissors). ( B ) A genetic pathway may be assembled into the linearized VEGAS assembly vector in S. cerevisiae by homologous recombination between VAs that flank TUs (TU1–5). X's indicate homologous recombination.
    Figure Legend Snippet: VEGAS with adapter homology to assemble a five-gene pathway. ( A ) The pathway consisting of VA-flanked TUs assembled by yGG may be released in one piece from the yGG acceptor vector by digestion with BsmBI (scissors). ( B ) A genetic pathway may be assembled into the linearized VEGAS assembly vector in S. cerevisiae by homologous recombination between VAs that flank TUs (TU1–5). X's indicate homologous recombination.

    Techniques Used: Plasmid Preparation, Homologous Recombination

    Related Articles

    Clone Assay:

    Article Title: Cloning of an Avian Adeno-Associated Virus (AAAV) and Generation of Recombinant AAAV Particles
    Article Snippet: For generation of the vector carrying the β-galactosidase gene flanked by AAAV ITRs, the plasmid pAAAV was digested with Bsm BI (NEB). .. For generation of the vector carrying the β-galactosidase gene flanked by AAAV ITRs, the plasmid pAAAV was digested with Bsm BI (NEB).

    Article Title: The inherent mutational tolerance and antigenic evolvability of influenza hemagglutinin
    Article Snippet: The final products from the codon mutagenesis PCR were gel purified and digested with BsmBI (R0580L; New England Biolabs, Ipswich, Massachusetts). .. A 1:4000 dilution of each transformation was plated in parallel to enable estimation of the number of unique transformants—we obtained at least two-million unique colonies per transformation.

    Article Title: FLASH Assembly of TALENs Enables High-Throughput Genome Editing
    Article Snippet: All DNA fragments assembled by FLASH possess overhangs that enable directional cloning into any of the four TALEN expression vectors that has been digested with BsmBI. .. To prepare a TALEN expression vector for subcloning, we digested 5 μg of plasmid DNA with 50 units of BsmBI restriction enzyme (New England Biolabs) in NEBuffer 3 for 8 hours at 55 degrees C. Digested DNA was purified using 90 μl of Ampure XP beads (Agencourt) according to manufacturer’s instructions and diluted to a final concentration of 5ng/μl in 1 mM TrisHCl.

    Article Title: Combinatorial Analysis of Secretory Immunoglobulin A (sIgA) Expression in Plants
    Article Snippet: Paragraph title: 4.1. Cloning and Assembly of Modular Pieces ... Assembly reactions were performed basically as described by [ ] using BsaI and BsmBI (New England Biolabs, Ipswich, MA, USA) as restriction enzymes in 25-cycle digestion/ligation reactions.

    Article Title: Phosphorylation-Dependent Differential Regulation of Plant Growth, Cell Death, and Innate Immunity by the Regulatory Receptor-Like Kinase BAK1
    Article Snippet: The resulting constructs were cloned into pCR-Blunt-II-TOPO (Invitrogen) and verified by sequencing. .. The inserts were released by digesting with BsmBI and BamHI (NEB) and ligated into epiGreenB(eGFP) digested with EcoRI and BamHI (NEB).

    Article Title: mTORC1-independent autophagy regulates receptor tyrosine kinase phosphorylation in colorectal cancer cells via an mTORC2-mediated mechanism
    Article Snippet: Paragraph title: Cloning of guide RNA sequences to lentiCRISPR vector ... To clone the Ctrl and ATG7 or ATG5 gRNA sequences, 5 μ g of the lentiCRISPR vector was enzymatically digested with BsmBI (NEB) using Buffer 3.1 (NEB) for 2 h at 37 °C.

    Article Title: Importin ?3/Qip1 Is Involved in Multiplication of Mutant Influenza Virus with Alanine Mutation at Amino Acid 9 Independently of Nuclear Transport Function
    Article Snippet: 2 (TOYOBO) and the following primers: BsmBI -R8A vNP fwd, 5′- CGTCTC NGGGAGCAAAAGCAGGTCACTCACAGAGTGACATCGAAATCATGGCGACCAAAGGCACCAAAGCATCTTACGAACAGATG-3′ ; BsmBI -S9A vNP fwd, 5′- CGTCTC NGGGAGCAAAAGCAGGTCACTCACAGAGTGACATCGAAATCATGGCGACCAAAGGCACCAAACGAGCTTACGAACAGATG-3′ ; and BsmBI -vNP rev, and 5′- CGTCTC NTATTAGTAGAAACAAGGTTCTTTAA-3′ . .. After purification, the PCR products were digested with BsmBI (New England Biolabs) and cloned into the BsmBI sites within the pHH21 vector . .. To produce pCAGGS encoding the full-length NP mutants (R8A-NP/pCAGGS and S9A-NP/pCAGGS), PCR amplification was performed using KOD Plus Ver.

    Article Title: Combinatorial CRISPR-Cas9 screens for de novo mapping of genetic interactions
    Article Snippet: The step 1 library plasmids were digested by BsmBI (NEB) as per the following reaction at 55°C for 3 hours: Step 1 library 4 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL After digestion, the linearized plasmids were treated with 2 μL of Calf Intestinal Alkaline Phosphatase (NEB) at 37°C for 30 minutes; cut plasmids were gel-purified via 0.6% agarose gel electrophoresis and QIAquick gel extraction (QIAGEN). .. Concurrently, the step 2 inserts, synthesized commercially (Integrated DNA Technologies) and cloned into a TOPO vector, were digested by BsmBI (NEB) per the following reaction at 55 °C for 3 hours: Purified step 2 insert PCR product 0.8 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL Sequence of the step 2 insert, with left-gRNA scaffold ( underlined ) and mU6 promoters ( bold ): TATGAGGACGAATCTCCCGCTTATACGTCTCTGTTTCAGAGCTATGCTGGAAACTGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT GTACTGAGTCGCCCA GTCTCAGATAGATCCGACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGGAAACTCACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTT GAGAGACGGTACAAGCACACGTTTGTCAAGACC Subsequently, the following ligation reaction was set up, involving overnight incubation at 16°C followed by heat inactivation at 65°C for 10 minutes: 10X T4 DNA Ligase Buffer 2 μL Step 1 library, digested 100 ng Step 2 insert, digested 100 ng T4 DNA Ligase (high concentration) 1 μL H2O Up to 20 μL 4 μL of the reaction was transformed into 100 μL of ElectroMAX Stbl4 Competent Cells (Invitrogen) according to the manufacturer’s protocol using an Eppendorf Electroporator. .. A small fraction (1–10 μL) of cultures were spread on carbenicillin (50 μg/ml) LB plates to calculate the library coverage, and the rest of the cultures were plated on ten 15 cm LB- carbenicillin plates and grown overnight at 37°C for amplification.

    Article Title: The Molecular Engineering of an Anti-Idiotypic Antibody for Pharmacokinetic Analysis of a Fully Human Anti-Infective
    Article Snippet: Plasmid DNA was sequenced with the primers HX01-01F (5’-AGCGGATAACAATTTCACACA-3’) and pCES-1LR (5’-ACAATCCAGCGGCTGCCGTA-3’) for light chain sequence and pCES-1HF (5’-GGCGCGCCAATTCTATTTCAAG-3’) and HX01-01R (5’-TTTGTCGTCTTTCCAGACGTTAGT-3’) for heavy chain. .. Heavy and light chains were cloned via BsmBI/ SfiI and SalI/NotI (New England Biolabs, UK) restriction enzyme sites respectively from the library phagemid vector into the different expression vectors. .. The expression vector contains the framework for expression of antibody into the mouse chimeric IgG2a with human IgG3 human hinge or mouse IgG2a or Fab.

    Article Title: Targeting Somatostatin Receptors By Functionalized Mesoporous Silica Nanoparticles - Are We Striking Home?
    Article Snippet: The verified clones were further processed for mid-scale plasmid preparation with GeneJET Plasmid Midiprep Kit (Thermo Scientific, Cat# K0481). .. The PCR products were gel-purified and ligated into BsmBI-linearized (New England Biolabs, Cat# R0580) and gel-purified AmCyan-P2A-mCherry plasmid with Gibson assembly master mix (New England Biolabs, Cat# E2611) .

    Amplification:

    Article Title: Typing Method for the QUB11a Locus of Mycobacterium tuberculosis: IS6110 Insertions and Tandem Repeat Analysis
    Article Snippet: The QUB11a locus was amplified from genomic DNA from the 29 isolates using primers iwamoto-F (forward) and iwamoto-R (reverse), which were labeled with fluorescent dyes fluorescein (FAM) and NED, respectively. .. The amplified fragments were treated with Bsm BI (New England Biolabs, Ipswich, MA, USA) at 37°C for 1 h. The Bsm BI-treated fragments were then analyzed simultaneously by capillary electrophoresis, as described above. .. This study was carried out in strict accordance with the guidelines of the Ethics Regulations Related to Epidemiological Research at the Fukuoka Institute of Health and Environmental Sciences, which is based on domestic standards (the Ethical Guidelines for Epidemiological Research, 17 June 2002, Ministry of Education, Culture, Sports, Science and Technology and Ministry of Health, Labour, and Welfare, Japan), and approved by the Ethics Committee of Fukuoka Institute of Health and Environmental Sciences under permit number 26-9.

    Article Title: Combinatorial Analysis of Secretory Immunoglobulin A (sIgA) Expression in Plants
    Article Snippet: Amplified parts were TA cloned using the pGEM-T Easy Vector System (Promega, Madison, WI, USA), and 1 μL of the ligation was transformed into DH5α electrocompetent cells. .. Assembly reactions were performed basically as described by [ ] using BsaI and BsmBI (New England Biolabs, Ipswich, MA, USA) as restriction enzymes in 25-cycle digestion/ligation reactions.

    Article Title: Phosphorylation-Dependent Differential Regulation of Plant Growth, Cell Death, and Innate Immunity by the Regulatory Receptor-Like Kinase BAK1
    Article Snippet: The constructs of BAK1p ::BAK1-eGFP orBAK1p::BAK1-5-eGFP , containing own promoter plus coding regions, were PCR amplified using primers given in . .. The inserts were released by digesting with BsmBI and BamHI (NEB) and ligated into epiGreenB(eGFP) digested with EcoRI and BamHI (NEB).

    Article Title: Terminal protein-primed amplification of heterologous DNA with a minimal replication system based on phage ?29
    Article Snippet: In the experiments that involved ligations, plasmid pEYFPBsm was cut with BsmBI and EcoO109I in New England Biolabs Buffer 3 for 8 h at 37 °C, purified by Qiaquick Spin columns (Qiagen), and then ligated in a 1∶4 proportion to the corresponding double-stranded hybridized oligonucleotides (oligonucleotides 68L + Comp68LBsm, 68L + Comp68LEco109; see ). .. In the experiments that involved ligations, plasmid pEYFPBsm was cut with BsmBI and EcoO109I in New England Biolabs Buffer 3 for 8 h at 37 °C, purified by Qiaquick Spin columns (Qiagen), and then ligated in a 1∶4 proportion to the corresponding double-stranded hybridized oligonucleotides (oligonucleotides 68L + Comp68LBsm, 68L + Comp68LEco109; see ).

    Polyacrylamide Gel Electrophoresis:

    Article Title: FLASH Assembly of TALENs Enables High-Throughput Genome Editing
    Article Snippet: All four of the TALEN expression vectors (each possessing a different 0.5 TALE repeat) are already available from Addgene and full sequences of these plasmids are freely available on a web page dedicated to these constructs: http://www.addgene.org/talengineering/expressionvectors/ . .. To prepare a TALEN expression vector for subcloning, we digested 5 μg of plasmid DNA with 50 units of BsmBI restriction enzyme (New England Biolabs) in NEBuffer 3 for 8 hours at 55 degrees C. Digested DNA was purified using 90 μl of Ampure XP beads (Agencourt) according to manufacturer’s instructions and diluted to a final concentration of 5ng/μl in 1 mM TrisHCl.

    DNA Ligation:

    Article Title: mTORC1-independent autophagy regulates receptor tyrosine kinase phosphorylation in colorectal cancer cells via an mTORC2-mediated mechanism
    Article Snippet: To clone the Ctrl and ATG7 or ATG5 gRNA sequences, 5 μ g of the lentiCRISPR vector was enzymatically digested with BsmBI (NEB) using Buffer 3.1 (NEB) for 2 h at 37 °C. .. The annealed gRNA oligos were diluted in a 1/200 concentration using ddH2 O and ligated into 50 ng gel purified vector (QIAquick Gel Extraction Kit; #28704, Qiagen).

    Synthesized:

    Article Title: Ubiquitylation of p62/sequestosome1 activates its autophagy receptor function and controls selective autophagy upon ubiquitin stress
    Article Snippet: A 20-bp guide sequence (5′-CCATTGGCAAGCTACAATAA-3′) targeting DNA within the third exon of UBE2D2 and a 20-bp guide sequence (5′-AGAATACACCGCCTTGATAT-3′) targeting DNA within the third exon of UBE2D3 were selected from a database of predicted high specificity protospacer adjacent motif target sites ( ). .. Two complementary oligos containing the UBE2D2/UBE2D3 sequence and Bsm BI (NEB) ligation adapters were synthesized. .. The annealed oligo was ligated into the Bsm BI-digested lentiCRISPRv2 vector.

    Article Title: Targeted DNA methylation in vivo using an engineered dCas9-MQ1 fusion protein
    Article Snippet: The genetic codon for DNA methyltransferase domain MQ1 was humanized with the minigene synthesized by GENEWIZ (South Plainfield, NJ) and subsequently inserted into the vector pLV-hUbC-dCas9-T2A-GFP (Addgene, 53191) via an NheI (NEB) restriction site. .. The plasmids for mouse zygote injection (pLV-dCas9-MQ1Q147L or pLV-dCas9-dMQ1) were also created using identical strategy. sgRNAs (see also ) were inserted into pLKO5.sgRNA.EFS.tRFP657 (Addgene, 57824) via BsmbI (NEB) site .

    Article Title: Target sequencing and CRISPR/Cas editing reveal simultaneous loss of UTX and UTY in urothelial bladder cancer
    Article Snippet: We then incubated 2 μL of lentivirus plasmid (878 ng/μL), 2 μL of BsmBI (NEB, USA), and 6 μL of enzyme buffer (NEB, USA) at 37°C for 2 hours. .. Finally, the ligated vector was transformed into Endura™ competent cells (Lucigen, USA), and colonies selected using colony PCR.

    Article Title: Combinatorial CRISPR-Cas9 screens for de novo mapping of genetic interactions
    Article Snippet: The step 1 library plasmids were digested by BsmBI (NEB) as per the following reaction at 55°C for 3 hours: Step 1 library 4 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL After digestion, the linearized plasmids were treated with 2 μL of Calf Intestinal Alkaline Phosphatase (NEB) at 37°C for 30 minutes; cut plasmids were gel-purified via 0.6% agarose gel electrophoresis and QIAquick gel extraction (QIAGEN). .. Concurrently, the step 2 inserts, synthesized commercially (Integrated DNA Technologies) and cloned into a TOPO vector, were digested by BsmBI (NEB) per the following reaction at 55 °C for 3 hours: Purified step 2 insert PCR product 0.8 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL Sequence of the step 2 insert, with left-gRNA scaffold ( underlined ) and mU6 promoters ( bold ): TATGAGGACGAATCTCCCGCTTATACGTCTCTGTTTCAGAGCTATGCTGGAAACTGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT GTACTGAGTCGCCCA GTCTCAGATAGATCCGACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGGAAACTCACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTT GAGAGACGGTACAAGCACACGTTTGTCAAGACC Subsequently, the following ligation reaction was set up, involving overnight incubation at 16°C followed by heat inactivation at 65°C for 10 minutes: 10X T4 DNA Ligase Buffer 2 μL Step 1 library, digested 100 ng Step 2 insert, digested 100 ng T4 DNA Ligase (high concentration) 1 μL H2O Up to 20 μL 4 μL of the reaction was transformed into 100 μL of ElectroMAX Stbl4 Competent Cells (Invitrogen) according to the manufacturer’s protocol using an Eppendorf Electroporator. .. A small fraction (1–10 μL) of cultures were spread on carbenicillin (50 μg/ml) LB plates to calculate the library coverage, and the rest of the cultures were plated on ten 15 cm LB- carbenicillin plates and grown overnight at 37°C for amplification.

    Construct:

    Article Title: Ubiquitylation of p62/sequestosome1 activates its autophagy receptor function and controls selective autophagy upon ubiquitin stress
    Article Snippet: UBE2D2−/− and UBE2D3−/− cell lines were constructed as described before . .. Two complementary oligos containing the UBE2D2/UBE2D3 sequence and Bsm BI (NEB) ligation adapters were synthesized.

    Article Title: FLASH Assembly of TALENs Enables High-Throughput Genome Editing
    Article Snippet: All four of the TALEN expression vectors (each possessing a different 0.5 TALE repeat) are already available from Addgene and full sequences of these plasmids are freely available on a web page dedicated to these constructs: http://www.addgene.org/talengineering/expressionvectors/ . .. To prepare a TALEN expression vector for subcloning, we digested 5 μg of plasmid DNA with 50 units of BsmBI restriction enzyme (New England Biolabs) in NEBuffer 3 for 8 hours at 55 degrees C. Digested DNA was purified using 90 μl of Ampure XP beads (Agencourt) according to manufacturer’s instructions and diluted to a final concentration of 5ng/μl in 1 mM TrisHCl.

    Article Title: Phosphorylation-Dependent Differential Regulation of Plant Growth, Cell Death, and Innate Immunity by the Regulatory Receptor-Like Kinase BAK1
    Article Snippet: The resulting constructs were cloned into pCR-Blunt-II-TOPO (Invitrogen) and verified by sequencing. .. The inserts were released by digesting with BsmBI and BamHI (NEB) and ligated into epiGreenB(eGFP) digested with EcoRI and BamHI (NEB).

    Article Title: The Molecular Engineering of an Anti-Idiotypic Antibody for Pharmacokinetic Analysis of a Fully Human Anti-Infective
    Article Snippet: Heavy and light chains were cloned via BsmBI/ SfiI and SalI/NotI (New England Biolabs, UK) restriction enzyme sites respectively from the library phagemid vector into the different expression vectors. .. The expression vector contains the framework for expression of antibody into the mouse chimeric IgG2a with human IgG3 human hinge or mouse IgG2a or Fab.

    Electrophoresis:

    Article Title: Typing Method for the QUB11a Locus of Mycobacterium tuberculosis: IS6110 Insertions and Tandem Repeat Analysis
    Article Snippet: The QUB11a locus was amplified from genomic DNA from the 29 isolates using primers iwamoto-F (forward) and iwamoto-R (reverse), which were labeled with fluorescent dyes fluorescein (FAM) and NED, respectively. .. The amplified fragments were treated with Bsm BI (New England Biolabs, Ipswich, MA, USA) at 37°C for 1 h. The Bsm BI-treated fragments were then analyzed simultaneously by capillary electrophoresis, as described above. .. This study was carried out in strict accordance with the guidelines of the Ethics Regulations Related to Epidemiological Research at the Fukuoka Institute of Health and Environmental Sciences, which is based on domestic standards (the Ethical Guidelines for Epidemiological Research, 17 June 2002, Ministry of Education, Culture, Sports, Science and Technology and Ministry of Health, Labour, and Welfare, Japan), and approved by the Ethics Committee of Fukuoka Institute of Health and Environmental Sciences under permit number 26-9.

    Incubation:

    Article Title: Target sequencing and CRISPR/Cas editing reveal simultaneous loss of UTX and UTY in urothelial bladder cancer
    Article Snippet: After annealing, the oligo duplex was diluted with distilled water (1/200) and ligated to enzymatically digested lentiCRISPRv2 vector (Addgene, USA). .. We then incubated 2 μL of lentivirus plasmid (878 ng/μL), 2 μL of BsmBI (NEB, USA), and 6 μL of enzyme buffer (NEB, USA) at 37°C for 2 hours. .. The reaction product was purified using the QIAquick Gel Extraction Kit (Qiagen, USA) for ligation.

    Article Title: Combinatorial CRISPR-Cas9 screens for de novo mapping of genetic interactions
    Article Snippet: The step 1 library plasmids were digested by BsmBI (NEB) as per the following reaction at 55°C for 3 hours: Step 1 library 4 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL After digestion, the linearized plasmids were treated with 2 μL of Calf Intestinal Alkaline Phosphatase (NEB) at 37°C for 30 minutes; cut plasmids were gel-purified via 0.6% agarose gel electrophoresis and QIAquick gel extraction (QIAGEN). .. Concurrently, the step 2 inserts, synthesized commercially (Integrated DNA Technologies) and cloned into a TOPO vector, were digested by BsmBI (NEB) per the following reaction at 55 °C for 3 hours: Purified step 2 insert PCR product 0.8 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL Sequence of the step 2 insert, with left-gRNA scaffold ( underlined ) and mU6 promoters ( bold ): TATGAGGACGAATCTCCCGCTTATACGTCTCTGTTTCAGAGCTATGCTGGAAACTGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT GTACTGAGTCGCCCA GTCTCAGATAGATCCGACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGGAAACTCACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTT GAGAGACGGTACAAGCACACGTTTGTCAAGACC Subsequently, the following ligation reaction was set up, involving overnight incubation at 16°C followed by heat inactivation at 65°C for 10 minutes: 10X T4 DNA Ligase Buffer 2 μL Step 1 library, digested 100 ng Step 2 insert, digested 100 ng T4 DNA Ligase (high concentration) 1 μL H2O Up to 20 μL 4 μL of the reaction was transformed into 100 μL of ElectroMAX Stbl4 Competent Cells (Invitrogen) according to the manufacturer’s protocol using an Eppendorf Electroporator. .. A small fraction (1–10 μL) of cultures were spread on carbenicillin (50 μg/ml) LB plates to calculate the library coverage, and the rest of the cultures were plated on ten 15 cm LB- carbenicillin plates and grown overnight at 37°C for amplification.

    Article Title: Terminal protein-primed amplification of heterologous DNA with a minimal replication system based on phage ?29
    Article Snippet: In the experiments that involved ligations, plasmid pEYFPBsm was cut with BsmBI and EcoO109I in New England Biolabs Buffer 3 for 8 h at 37 °C, purified by Qiaquick Spin columns (Qiagen), and then ligated in a 1∶4 proportion to the corresponding double-stranded hybridized oligonucleotides (oligonucleotides 68L + Comp68LBsm, 68L + Comp68LEco109; see ). .. In the experiments that involved ligations, plasmid pEYFPBsm was cut with BsmBI and EcoO109I in New England Biolabs Buffer 3 for 8 h at 37 °C, purified by Qiaquick Spin columns (Qiagen), and then ligated in a 1∶4 proportion to the corresponding double-stranded hybridized oligonucleotides (oligonucleotides 68L + Comp68LBsm, 68L + Comp68LEco109; see ).

    Gel Extraction:

    Article Title: mTORC1-independent autophagy regulates receptor tyrosine kinase phosphorylation in colorectal cancer cells via an mTORC2-mediated mechanism
    Article Snippet: To clone the Ctrl and ATG7 or ATG5 gRNA sequences, 5 μ g of the lentiCRISPR vector was enzymatically digested with BsmBI (NEB) using Buffer 3.1 (NEB) for 2 h at 37 °C. .. To clone the Ctrl and ATG7 or ATG5 gRNA sequences, 5 μ g of the lentiCRISPR vector was enzymatically digested with BsmBI (NEB) using Buffer 3.1 (NEB) for 2 h at 37 °C.

    Article Title: Combinatorial CRISPR-Cas9 screens for de novo mapping of genetic interactions
    Article Snippet: The step 1 library plasmids were digested by BsmBI (NEB) as per the following reaction at 55°C for 3 hours: Step 1 library 4 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL After digestion, the linearized plasmids were treated with 2 μL of Calf Intestinal Alkaline Phosphatase (NEB) at 37°C for 30 minutes; cut plasmids were gel-purified via 0.6% agarose gel electrophoresis and QIAquick gel extraction (QIAGEN). .. Concurrently, the step 2 inserts, synthesized commercially (Integrated DNA Technologies) and cloned into a TOPO vector, were digested by BsmBI (NEB) per the following reaction at 55 °C for 3 hours: Purified step 2 insert PCR product 0.8 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL Sequence of the step 2 insert, with left-gRNA scaffold ( underlined ) and mU6 promoters ( bold ): TATGAGGACGAATCTCCCGCTTATACGTCTCTGTTTCAGAGCTATGCTGGAAACTGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT GTACTGAGTCGCCCA GTCTCAGATAGATCCGACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGGAAACTCACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTT GAGAGACGGTACAAGCACACGTTTGTCAAGACC Subsequently, the following ligation reaction was set up, involving overnight incubation at 16°C followed by heat inactivation at 65°C for 10 minutes: 10X T4 DNA Ligase Buffer 2 μL Step 1 library, digested 100 ng Step 2 insert, digested 100 ng T4 DNA Ligase (high concentration) 1 μL H2O Up to 20 μL 4 μL of the reaction was transformed into 100 μL of ElectroMAX Stbl4 Competent Cells (Invitrogen) according to the manufacturer’s protocol using an Eppendorf Electroporator.

    Activity Assay:

    Article Title: Bacillus SEVA siblings: A Golden Gate-based toolbox to create personalized integrative vectors for Bacillus subtilis
    Article Snippet: BsaI, BbsI, BsmBI and BtgZI were purchased from NEB, AarI from Thermo ScientificTM . .. BsaI, BbsI, BsmBI and BtgZI were purchased from NEB, AarI from Thermo ScientificTM .

    In Silico:

    Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication
    Article Snippet: We introduced between 2 and 7 synonymous mutations simultaneously in silico to the identified regions and reassessed structural stability or pseudoknot formation using the same structure prediction programs. .. PCR products were gel extracted and digested with either BsmbI (New England Biolabs, (NEB)) or AarI (Thermo Fisher Scientific) restriction enzymes and DpnI (NEB) to remove residual parent plasmid.

    Expressing:

    Article Title: FLASH Assembly of TALENs Enables High-Throughput Genome Editing
    Article Snippet: All four of the TALEN expression vectors (each possessing a different 0.5 TALE repeat) are already available from Addgene and full sequences of these plasmids are freely available on a web page dedicated to these constructs: http://www.addgene.org/talengineering/expressionvectors/ . .. To prepare a TALEN expression vector for subcloning, we digested 5 μg of plasmid DNA with 50 units of BsmBI restriction enzyme (New England Biolabs) in NEBuffer 3 for 8 hours at 55 degrees C. Digested DNA was purified using 90 μl of Ampure XP beads (Agencourt) according to manufacturer’s instructions and diluted to a final concentration of 5ng/μl in 1 mM TrisHCl. .. FLASH-assembled TALE repeat arrays were ligated into TALEN expression vectors using 400 U of T4 DNA Ligase (New England Biolabs).

    Article Title: Phosphorylation-Dependent Differential Regulation of Plant Growth, Cell Death, and Innate Immunity by the Regulatory Receptor-Like Kinase BAK1
    Article Snippet: Paragraph title: Transient expression in N. benthamiana ... The inserts were released by digesting with BsmBI and BamHI (NEB) and ligated into epiGreenB(eGFP) digested with EcoRI and BamHI (NEB).

    Article Title: Targeted DNA methylation in vivo using an engineered dCas9-MQ1 fusion protein
    Article Snippet: The expression cassette dCas9-MQ1-T2A-GFP was then transferred to the pcDNA3.1 backbone (ThermoFisher) between the XbaI (NEB) and AgeI-HF (NEB) restriction sites, and the new vector was named as pcDNA3.1-dCas9-MQ1. .. The plasmids for mouse zygote injection (pLV-dCas9-MQ1Q147L or pLV-dCas9-dMQ1) were also created using identical strategy. sgRNAs (see also ) were inserted into pLKO5.sgRNA.EFS.tRFP657 (Addgene, 57824) via BsmbI (NEB) site .

    Article Title: Importin ?3/Qip1 Is Involved in Multiplication of Mutant Influenza Virus with Alanine Mutation at Amino Acid 9 Independently of Nuclear Transport Function
    Article Snippet: To generate the plasmids expressing alanine-mutated viral NP genomes (R8A vNP/pHH21 and S9A vNP/pHH21), PCR was performed using NP/pHH21 as the template with KOD Plus Ver. .. After purification, the PCR products were digested with BsmBI (New England Biolabs) and cloned into the BsmBI sites within the pHH21 vector .

    Article Title: The Molecular Engineering of an Anti-Idiotypic Antibody for Pharmacokinetic Analysis of a Fully Human Anti-Infective
    Article Snippet: Plasmid DNA was sequenced with the primers HX01-01F (5’-AGCGGATAACAATTTCACACA-3’) and pCES-1LR (5’-ACAATCCAGCGGCTGCCGTA-3’) for light chain sequence and pCES-1HF (5’-GGCGCGCCAATTCTATTTCAAG-3’) and HX01-01R (5’-TTTGTCGTCTTTCCAGACGTTAGT-3’) for heavy chain. .. Heavy and light chains were cloned via BsmBI/ SfiI and SalI/NotI (New England Biolabs, UK) restriction enzyme sites respectively from the library phagemid vector into the different expression vectors. .. The expression vector contains the framework for expression of antibody into the mouse chimeric IgG2a with human IgG3 human hinge or mouse IgG2a or Fab.

    Article Title: Targeting Somatostatin Receptors By Functionalized Mesoporous Silica Nanoparticles - Are We Striking Home?
    Article Snippet: Paragraph title: Generation of mammalian expression vectors for human somatostatin receptors 2 and 3 ... The PCR products were gel-purified and ligated into BsmBI-linearized (New England Biolabs, Cat# R0580) and gel-purified AmCyan-P2A-mCherry plasmid with Gibson assembly master mix (New England Biolabs, Cat# E2611) .

    Transformation Assay:

    Article Title: The inherent mutational tolerance and antigenic evolvability of influenza hemagglutinin
    Article Snippet: The final products from the codon mutagenesis PCR were gel purified and digested with BsmBI (R0580L; New England Biolabs, Ipswich, Massachusetts). .. The final products from the codon mutagenesis PCR were gel purified and digested with BsmBI (R0580L; New England Biolabs, Ipswich, Massachusetts).

    Article Title: FLASH Assembly of TALENs Enables High-Throughput Genome Editing
    Article Snippet: To prepare a TALEN expression vector for subcloning, we digested 5 μg of plasmid DNA with 50 units of BsmBI restriction enzyme (New England Biolabs) in NEBuffer 3 for 8 hours at 55 degrees C. Digested DNA was purified using 90 μl of Ampure XP beads (Agencourt) according to manufacturer’s instructions and diluted to a final concentration of 5ng/μl in 1 mM TrisHCl. .. FLASH-assembled TALE repeat arrays were ligated into TALEN expression vectors using 400 U of T4 DNA Ligase (New England Biolabs).

    Article Title: Combinatorial Analysis of Secretory Immunoglobulin A (sIgA) Expression in Plants
    Article Snippet: Amplified parts were TA cloned using the pGEM-T Easy Vector System (Promega, Madison, WI, USA), and 1 μL of the ligation was transformed into DH5α electrocompetent cells. .. Assembly reactions were performed basically as described by [ ] using BsaI and BsmBI (New England Biolabs, Ipswich, MA, USA) as restriction enzymes in 25-cycle digestion/ligation reactions.

    Article Title: Phosphorylation-Dependent Differential Regulation of Plant Growth, Cell Death, and Innate Immunity by the Regulatory Receptor-Like Kinase BAK1
    Article Snippet: All resulting constructs were verified by restriction analysis and transformed intoA. tumefaciens strain GV3101. .. The inserts were released by digesting with BsmBI and BamHI (NEB) and ligated into epiGreenB(eGFP) digested with EcoRI and BamHI (NEB).

    Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication
    Article Snippet: PCR products were gel extracted and digested with either BsmbI (New England Biolabs, (NEB)) or AarI (Thermo Fisher Scientific) restriction enzymes and DpnI (NEB) to remove residual parent plasmid. .. PCR products were gel extracted and digested with either BsmbI (New England Biolabs, (NEB)) or AarI (Thermo Fisher Scientific) restriction enzymes and DpnI (NEB) to remove residual parent plasmid.

    Article Title: mTORC1-independent autophagy regulates receptor tyrosine kinase phosphorylation in colorectal cancer cells via an mTORC2-mediated mechanism
    Article Snippet: To clone the Ctrl and ATG7 or ATG5 gRNA sequences, 5 μ g of the lentiCRISPR vector was enzymatically digested with BsmBI (NEB) using Buffer 3.1 (NEB) for 2 h at 37 °C. .. For ligation reaction, the Rapid DNA Ligation kit (#11 635 379 001, Roche) was used at room temperature for 15 min according to the instructions of the manufacturer.

    Article Title: Target sequencing and CRISPR/Cas editing reveal simultaneous loss of UTX and UTY in urothelial bladder cancer
    Article Snippet: We then incubated 2 μL of lentivirus plasmid (878 ng/μL), 2 μL of BsmBI (NEB, USA), and 6 μL of enzyme buffer (NEB, USA) at 37°C for 2 hours. .. The ligation reaction consisted of 1 μL of the diluted annealed oligo duplex, 2 μL of the digested lentivirus vector, 0.5 μL of ligase (Enzymetics, USA), 1 μL of 10X ligase buffer (Enzymetics, USA), and 7 μL of distilled water.

    Article Title: Combinatorial CRISPR-Cas9 screens for de novo mapping of genetic interactions
    Article Snippet: The step 1 library plasmids were digested by BsmBI (NEB) as per the following reaction at 55°C for 3 hours: Step 1 library 4 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL After digestion, the linearized plasmids were treated with 2 μL of Calf Intestinal Alkaline Phosphatase (NEB) at 37°C for 30 minutes; cut plasmids were gel-purified via 0.6% agarose gel electrophoresis and QIAquick gel extraction (QIAGEN). .. Concurrently, the step 2 inserts, synthesized commercially (Integrated DNA Technologies) and cloned into a TOPO vector, were digested by BsmBI (NEB) per the following reaction at 55 °C for 3 hours: Purified step 2 insert PCR product 0.8 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL Sequence of the step 2 insert, with left-gRNA scaffold ( underlined ) and mU6 promoters ( bold ): TATGAGGACGAATCTCCCGCTTATACGTCTCTGTTTCAGAGCTATGCTGGAAACTGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT GTACTGAGTCGCCCA GTCTCAGATAGATCCGACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGGAAACTCACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTT GAGAGACGGTACAAGCACACGTTTGTCAAGACC Subsequently, the following ligation reaction was set up, involving overnight incubation at 16°C followed by heat inactivation at 65°C for 10 minutes: 10X T4 DNA Ligase Buffer 2 μL Step 1 library, digested 100 ng Step 2 insert, digested 100 ng T4 DNA Ligase (high concentration) 1 μL H2O Up to 20 μL 4 μL of the reaction was transformed into 100 μL of ElectroMAX Stbl4 Competent Cells (Invitrogen) according to the manufacturer’s protocol using an Eppendorf Electroporator. .. A small fraction (1–10 μL) of cultures were spread on carbenicillin (50 μg/ml) LB plates to calculate the library coverage, and the rest of the cultures were plated on ten 15 cm LB- carbenicillin plates and grown overnight at 37°C for amplification.

    Article Title: Targeting Somatostatin Receptors By Functionalized Mesoporous Silica Nanoparticles - Are We Striking Home?
    Article Snippet: The ligation products were used for transformation of 10-beta chemically competent E. coli (New England Biolabs, Cat#C3019) and the transformants were plated on LB-agar (1.5% w/v) supplemented with 100 μg/ml of ampicillin. .. The PCR products were gel-purified and ligated into BsmBI-linearized (New England Biolabs, Cat# R0580) and gel-purified AmCyan-P2A-mCherry plasmid with Gibson assembly master mix (New England Biolabs, Cat# E2611) .

    Chloramphenicol Acetyltransferase Assay:

    Article Title: A complex epistatic network limits the mutational reversibility in the influenza hemagglutinin receptor-binding site
    Article Snippet: The products of those two PCRs were then mixed at equal molar ratio and used as a template for the overlapping PCR using primers: 5′-CGT ACG TCT CAC TGC TTG CAT AAG GAG ATC TAA-3′ and 5′-CGT ACG TCT CAC AAT AGA TGC TTA TTC TGC-3′. .. Both the vector and insert were digested by Bsm BI (New England Biolabs) and ligated using T4 DNA ligase (New England Biolabs).

    Article Title: Targeting Somatostatin Receptors By Functionalized Mesoporous Silica Nanoparticles - Are We Striking Home?
    Article Snippet: The ligation products were used for transformation of 10-beta chemically competent E. coli (New England Biolabs, CatC3019) and the transformants were plated on LB-agar (1.5% w/v) supplemented with 100 μg/ml of ampicillin. .. The PCR products were gel-purified and ligated into BsmBI-linearized (New England Biolabs, Cat# R0580) and gel-purified AmCyan-P2A-mCherry plasmid with Gibson assembly master mix (New England Biolabs, Cat# E2611) .

    Derivative Assay:

    Article Title: The inherent mutational tolerance and antigenic evolvability of influenza hemagglutinin
    Article Snippet: The libraries were created in full biological triplicate, meaning that each experimental replicate was derived from an independent plasmid mutant library. .. The final products from the codon mutagenesis PCR were gel purified and digested with BsmBI (R0580L; New England Biolabs, Ipswich, Massachusetts).

    Article Title: Importin ?3/Qip1 Is Involved in Multiplication of Mutant Influenza Virus with Alanine Mutation at Amino Acid 9 Independently of Nuclear Transport Function
    Article Snippet: The viral genome-expressing plasmids PB2/pHH21, PB1/pHH21, PA/pHH21, HA/pHH21, NP/pHH21, NA/pHH21, M/pHH21, NS/pHH21 and empty-pHH21 , ; the expression plasmids PB1/pCAGGS, PB2/pCAGGS, PA/pCAGGS and NP/pCAGGS; and the vNP-luc/pHH21 plasmid derived from the A/WSN/33 (H1N1) virus were kind gifts from Dr. Y Kawaoka, University of Tokyo. .. After purification, the PCR products were digested with BsmBI (New England Biolabs) and cloned into the BsmBI sites within the pHH21 vector .

    Transfection:

    Article Title: Ubiquitylation of p62/sequestosome1 activates its autophagy receptor function and controls selective autophagy upon ubiquitin stress
    Article Snippet: Two complementary oligos containing the UBE2D2/UBE2D3 sequence and Bsm BI (NEB) ligation adapters were synthesized. .. Two complementary oligos containing the UBE2D2/UBE2D3 sequence and Bsm BI (NEB) ligation adapters were synthesized.

    Article Title: The Molecular Engineering of an Anti-Idiotypic Antibody for Pharmacokinetic Analysis of a Fully Human Anti-Infective
    Article Snippet: Heavy and light chains were cloned via BsmBI/ SfiI and SalI/NotI (New England Biolabs, UK) restriction enzyme sites respectively from the library phagemid vector into the different expression vectors. .. The expression vector contains the framework for expression of antibody into the mouse chimeric IgG2a with human IgG3 human hinge or mouse IgG2a or Fab.

    Inverse PCR:

    Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication
    Article Snippet: Mutations were introduced into pHW2000 bidirectional plasmids by inverse PCR with primers (see Supplementary Table ) including selected mutations and unique ligation sites. .. PCR products were gel extracted and digested with either BsmbI (New England Biolabs, (NEB)) or AarI (Thermo Fisher Scientific) restriction enzymes and DpnI (NEB) to remove residual parent plasmid.

    Ligation:

    Article Title: Ubiquitylation of p62/sequestosome1 activates its autophagy receptor function and controls selective autophagy upon ubiquitin stress
    Article Snippet: A 20-bp guide sequence (5′-CCATTGGCAAGCTACAATAA-3′) targeting DNA within the third exon of UBE2D2 and a 20-bp guide sequence (5′-AGAATACACCGCCTTGATAT-3′) targeting DNA within the third exon of UBE2D3 were selected from a database of predicted high specificity protospacer adjacent motif target sites ( ). .. Two complementary oligos containing the UBE2D2/UBE2D3 sequence and Bsm BI (NEB) ligation adapters were synthesized. .. The annealed oligo was ligated into the Bsm BI-digested lentiCRISPRv2 vector.

    Article Title: FLASH Assembly of TALENs Enables High-Throughput Genome Editing
    Article Snippet: To prepare a TALEN expression vector for subcloning, we digested 5 μg of plasmid DNA with 50 units of BsmBI restriction enzyme (New England Biolabs) in NEBuffer 3 for 8 hours at 55 degrees C. Digested DNA was purified using 90 μl of Ampure XP beads (Agencourt) according to manufacturer’s instructions and diluted to a final concentration of 5ng/μl in 1 mM TrisHCl. .. To prepare a TALEN expression vector for subcloning, we digested 5 μg of plasmid DNA with 50 units of BsmBI restriction enzyme (New England Biolabs) in NEBuffer 3 for 8 hours at 55 degrees C. Digested DNA was purified using 90 μl of Ampure XP beads (Agencourt) according to manufacturer’s instructions and diluted to a final concentration of 5ng/μl in 1 mM TrisHCl.

    Article Title: Combinatorial Analysis of Secretory Immunoglobulin A (sIgA) Expression in Plants
    Article Snippet: Amplified parts were TA cloned using the pGEM-T Easy Vector System (Promega, Madison, WI, USA), and 1 μL of the ligation was transformed into DH5α electrocompetent cells. .. Assembly reactions were performed basically as described by [ ] using BsaI and BsmBI (New England Biolabs, Ipswich, MA, USA) as restriction enzymes in 25-cycle digestion/ligation reactions.

    Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication
    Article Snippet: Mutations were introduced into pHW2000 bidirectional plasmids by inverse PCR with primers (see Supplementary Table ) including selected mutations and unique ligation sites. .. PCR products were gel extracted and digested with either BsmbI (New England Biolabs, (NEB)) or AarI (Thermo Fisher Scientific) restriction enzymes and DpnI (NEB) to remove residual parent plasmid.

    Article Title: mTORC1-independent autophagy regulates receptor tyrosine kinase phosphorylation in colorectal cancer cells via an mTORC2-mediated mechanism
    Article Snippet: To clone the Ctrl and ATG7 or ATG5 gRNA sequences, 5 μ g of the lentiCRISPR vector was enzymatically digested with BsmBI (NEB) using Buffer 3.1 (NEB) for 2 h at 37 °C. .. The annealed gRNA oligos were diluted in a 1/200 concentration using ddH2 O and ligated into 50 ng gel purified vector (QIAquick Gel Extraction Kit; #28704, Qiagen).

    Article Title: Target sequencing and CRISPR/Cas editing reveal simultaneous loss of UTX and UTY in urothelial bladder cancer
    Article Snippet: We then incubated 2 μL of lentivirus plasmid (878 ng/μL), 2 μL of BsmBI (NEB, USA), and 6 μL of enzyme buffer (NEB, USA) at 37°C for 2 hours. .. The reaction product was purified using the QIAquick Gel Extraction Kit (Qiagen, USA) for ligation.

    Article Title: Combinatorial CRISPR-Cas9 screens for de novo mapping of genetic interactions
    Article Snippet: The step 1 library plasmids were digested by BsmBI (NEB) as per the following reaction at 55°C for 3 hours: Step 1 library 4 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL After digestion, the linearized plasmids were treated with 2 μL of Calf Intestinal Alkaline Phosphatase (NEB) at 37°C for 30 minutes; cut plasmids were gel-purified via 0.6% agarose gel electrophoresis and QIAquick gel extraction (QIAGEN). .. Concurrently, the step 2 inserts, synthesized commercially (Integrated DNA Technologies) and cloned into a TOPO vector, were digested by BsmBI (NEB) per the following reaction at 55 °C for 3 hours: Purified step 2 insert PCR product 0.8 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL Sequence of the step 2 insert, with left-gRNA scaffold ( underlined ) and mU6 promoters ( bold ): TATGAGGACGAATCTCCCGCTTATACGTCTCTGTTTCAGAGCTATGCTGGAAACTGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT GTACTGAGTCGCCCA GTCTCAGATAGATCCGACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGGAAACTCACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTT GAGAGACGGTACAAGCACACGTTTGTCAAGACC Subsequently, the following ligation reaction was set up, involving overnight incubation at 16°C followed by heat inactivation at 65°C for 10 minutes: 10X T4 DNA Ligase Buffer 2 μL Step 1 library, digested 100 ng Step 2 insert, digested 100 ng T4 DNA Ligase (high concentration) 1 μL H2O Up to 20 μL 4 μL of the reaction was transformed into 100 μL of ElectroMAX Stbl4 Competent Cells (Invitrogen) according to the manufacturer’s protocol using an Eppendorf Electroporator. .. A small fraction (1–10 μL) of cultures were spread on carbenicillin (50 μg/ml) LB plates to calculate the library coverage, and the rest of the cultures were plated on ten 15 cm LB- carbenicillin plates and grown overnight at 37°C for amplification.

    Article Title: Terminal protein-primed amplification of heterologous DNA with a minimal replication system based on phage ?29
    Article Snippet: In the experiments that involved ligations, plasmid pEYFPBsm was cut with BsmBI and EcoO109I in New England Biolabs Buffer 3 for 8 h at 37 °C, purified by Qiaquick Spin columns (Qiagen), and then ligated in a 1∶4 proportion to the corresponding double-stranded hybridized oligonucleotides (oligonucleotides 68L + Comp68LBsm, 68L + Comp68LEco109; see ). .. In the experiments that involved ligations, plasmid pEYFPBsm was cut with BsmBI and EcoO109I in New England Biolabs Buffer 3 for 8 h at 37 °C, purified by Qiaquick Spin columns (Qiagen), and then ligated in a 1∶4 proportion to the corresponding double-stranded hybridized oligonucleotides (oligonucleotides 68L + Comp68LBsm, 68L + Comp68LEco109; see ).

    Article Title: Targeting Somatostatin Receptors By Functionalized Mesoporous Silica Nanoparticles - Are We Striking Home?
    Article Snippet: The ligation products were used for transformation of 10-beta chemically competent E. coli (New England Biolabs, Cat#C3019) and the transformants were plated on LB-agar (1.5% w/v) supplemented with 100 μg/ml of ampicillin. .. The PCR products were gel-purified and ligated into BsmBI-linearized (New England Biolabs, Cat# R0580) and gel-purified AmCyan-P2A-mCherry plasmid with Gibson assembly master mix (New England Biolabs, Cat# E2611) .

    Hemagglutination Assay:

    Article Title: The inherent mutational tolerance and antigenic evolvability of influenza hemagglutinin
    Article Snippet: Paragraph title: Generation of HA codon mutation library ... The final products from the codon mutagenesis PCR were gel purified and digested with BsmBI (R0580L; New England Biolabs, Ipswich, Massachusetts).

    Article Title: Importin ?3/Qip1 Is Involved in Multiplication of Mutant Influenza Virus with Alanine Mutation at Amino Acid 9 Independently of Nuclear Transport Function
    Article Snippet: The viral genome-expressing plasmids PB2/pHH21, PB1/pHH21, PA/pHH21, HA/pHH21, NP/pHH21, NA/pHH21, M/pHH21, NS/pHH21 and empty-pHH21 , ; the expression plasmids PB1/pCAGGS, PB2/pCAGGS, PA/pCAGGS and NP/pCAGGS; and the vNP-luc/pHH21 plasmid derived from the A/WSN/33 (H1N1) virus were kind gifts from Dr. Y Kawaoka, University of Tokyo. .. After purification, the PCR products were digested with BsmBI (New England Biolabs) and cloned into the BsmBI sites within the pHH21 vector .

    Generated:

    Article Title: A complex epistatic network limits the mutational reversibility in the influenza hemagglutinin receptor-binding site
    Article Snippet: The vector for the mutant library was generated by a PCR using pHW2000-Bris07-WT as a template and primers: 5′-CGT ACG TCT CAG CAG AGC TTG TTC CGT TTT GAG TGA-3′ and 5′-CGT ACG TCT CAA TTG GAC AAT AGT AAA ACC GGG AGA-3′. .. Both the vector and insert were digested by Bsm BI (New England Biolabs) and ligated using T4 DNA ligase (New England Biolabs).

    Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication
    Article Snippet: Once predicted destabilizing mutations were identified, mutant viruses were generated. .. PCR products were gel extracted and digested with either BsmbI (New England Biolabs, (NEB)) or AarI (Thermo Fisher Scientific) restriction enzymes and DpnI (NEB) to remove residual parent plasmid.

    Article Title: mTORC1-independent autophagy regulates receptor tyrosine kinase phosphorylation in colorectal cancer cells via an mTORC2-mediated mechanism
    Article Snippet: For control (Ctrl), the gRNA sequence 5'-GTAGCGAACGTGTCCGGCGT-3' was used, generated by Wang et al. .. To clone the Ctrl and ATG7 or ATG5 gRNA sequences, 5 μ g of the lentiCRISPR vector was enzymatically digested with BsmBI (NEB) using Buffer 3.1 (NEB) for 2 h at 37 °C.

    Article Title: Importin ?3/Qip1 Is Involved in Multiplication of Mutant Influenza Virus with Alanine Mutation at Amino Acid 9 Independently of Nuclear Transport Function
    Article Snippet: The GST expression vector pGEX-6P-3, encoding GST-tagged-Rch1, -Qip1 or -NPI-1 (19), and the mammalian expression vector pCAGGS , encoding the monomeric red fluorescent protein (mRFP)-Flag-conjugated N-terminal 110-amino acid region of NP (NP110aa) or a deletion of the unconventional NLS located within the N-terminal 13-amino acids of NP110aa (NP14-110aa) , have been described previously. pCAGGS encoding mRFP-Flag conjugated alanine mutants of the unconventional NLS extending from amino acids 3 to 13 of NP (T3A-, K4A-, G5A-, T6A-, K7A-, R8A-, S9A-, Y10A-, E11A- Q12A and M13A-NP110aa), were generated by PCR using the following forward primers: XhoI -T3A NP fwd, 5′-AAA CTCGAG ATGGCGGCCAAAGGCACCAAACGA-3′ ; XhoI -K4A NP fwd, 5′-AAA CTCGAG ATGGCGACCGCAGGCACCAAACGA-3′ ; XhoI -G5A NP fwd, 5′-AAA CTCGAG ATGGCGACCAAAGCCACCAAACGA-3′ ; XhoI -T6A NP fwd, 5′-AAA CTCGAG ATGGCGACCAAAGGCGCCAAACGATCT-3′ ; XhoI -K7A NP fwd, 5′-AAA CTCGAG ATGGCGACCAAAGGCACCGCACGATCTTAC-3′ ; XhoI -R8A NP fwd, 5′-AAA CTCGAG ATGGCGACCAAAGGCACCAAAGCATCTTACGAA-3′ ; XhoI -S9A NP fwd, 5′-AAA CTCGAG ATGGCGACCAAAGGCACCAAACGAGCTTACGAACAG-3′ ; XhoI -Y10A NP fwd, 5′-AAA CTCGAG ATGGCGACCAAAGGCACCAAACGATCTGCCGAACAGATG-3 ; XhoI -E11A NP fwd, 5′-AAA CTCGAG ATGGCGACCAAAGGCACCAAACGATCTTACGCACAGATGGAG-3′ and XhoI -Q12A NP fwd, 5′-AAA CTCGAG ATGGCGACCAAAGGCACCAAACGATCTTACGAAGCGATGGAGACT-3′ ; XhoI -M13A NP fwd, 5′-AAA CTCGAG ATGGCGACCAAAGGCACCAAACGATCTTACGAACAGGCGGAGACT-3′ ; and the reverse primer: Spe -NP110aa-R, 5′-AAA ACTAGT AAGGATGAGTTCTCTCCTCC-3′ (restriction enzyme sites underlined). .. After purification, the PCR products were digested with BsmBI (New England Biolabs) and cloned into the BsmBI sites within the pHH21 vector .

    DNA Sequencing:

    Article Title: Ubiquitylation of p62/sequestosome1 activates its autophagy receptor function and controls selective autophagy upon ubiquitin stress
    Article Snippet: Two complementary oligos containing the UBE2D2/UBE2D3 sequence and Bsm BI (NEB) ligation adapters were synthesized. .. The annealed oligo was ligated into the Bsm BI-digested lentiCRISPRv2 vector.

    Polymerase Chain Reaction:

    Article Title: Cloning of an Avian Adeno-Associated Virus (AAAV) and Generation of Recombinant AAAV Particles
    Article Snippet: For generation of pA3 VRC, the rep and cap genes of AAAV including the p5 promoter and poly(A) signal (nucleotides 142 to 4516) was produced by PCR using PFU polymerase and blunt end ligated in pPCR-script. .. For generation of the vector carrying the β-galactosidase gene flanked by AAAV ITRs, the plasmid pAAAV was digested with Bsm BI (NEB).

    Article Title: A complex epistatic network limits the mutational reversibility in the influenza hemagglutinin receptor-binding site
    Article Snippet: The vector for the mutant library was generated by a PCR using pHW2000-Bris07-WT as a template and primers: 5′-CGT ACG TCT CAG CAG AGC TTG TTC CGT TTT GAG TGA-3′ and 5′-CGT ACG TCT CAA TTG GAC AAT AGT AAA ACC GGG AGA-3′. .. Both the vector and insert were digested by Bsm BI (New England Biolabs) and ligated using T4 DNA ligase (New England Biolabs).

    Article Title: The inherent mutational tolerance and antigenic evolvability of influenza hemagglutinin
    Article Snippet: The mutagenic primers were ordered from Integrated DNA Technologies, and are listed in . .. The final products from the codon mutagenesis PCR were gel purified and digested with BsmBI (R0580L; New England Biolabs, Ipswich, Massachusetts). .. The BsmBI-digested HA was ligated into a dephosphorylated (Antarctic Phosphatase, M0289L; New England Biolabs) and BsmBI-digested preparation of the bidirectional reverse-genetics plasmid pHW2000 ( ) using T4 DNA ligase (M0202S; New England Biolabs).

    Article Title: FLASH Assembly of TALENs Enables High-Throughput Genome Editing
    Article Snippet: To prepare a TALEN expression vector for subcloning, we digested 5 μg of plasmid DNA with 50 units of BsmBI restriction enzyme (New England Biolabs) in NEBuffer 3 for 8 hours at 55 degrees C. Digested DNA was purified using 90 μl of Ampure XP beads (Agencourt) according to manufacturer’s instructions and diluted to a final concentration of 5ng/μl in 1 mM TrisHCl. .. Typically, six colonies were picked for each ligation and plasmid DNA isolated by an alkaline lysis miniprep procedure.

    Article Title: Phosphorylation-Dependent Differential Regulation of Plant Growth, Cell Death, and Innate Immunity by the Regulatory Receptor-Like Kinase BAK1
    Article Snippet: The resulting constructs were cloned into pCR-Blunt-II-TOPO (Invitrogen) and verified by sequencing. .. The inserts were released by digesting with BsmBI and BamHI (NEB) and ligated into epiGreenB(eGFP) digested with EcoRI and BamHI (NEB).

    Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication
    Article Snippet: Mutations were introduced into pHW2000 bidirectional plasmids by inverse PCR with primers (see Supplementary Table ) including selected mutations and unique ligation sites. .. PCR products were gel extracted and digested with either BsmbI (New England Biolabs, (NEB)) or AarI (Thermo Fisher Scientific) restriction enzymes and DpnI (NEB) to remove residual parent plasmid. .. Digested PCR products were PCR purified and ligated using Instant Sticky End Ligase (NEB).

    Article Title: Importin ?3/Qip1 Is Involved in Multiplication of Mutant Influenza Virus with Alanine Mutation at Amino Acid 9 Independently of Nuclear Transport Function
    Article Snippet: 2 (TOYOBO) and the following primers: BsmBI -R8A vNP fwd, 5′- CGTCTC NGGGAGCAAAAGCAGGTCACTCACAGAGTGACATCGAAATCATGGCGACCAAAGGCACCAAAGCATCTTACGAACAGATG-3′ ; BsmBI -S9A vNP fwd, 5′- CGTCTC NGGGAGCAAAAGCAGGTCACTCACAGAGTGACATCGAAATCATGGCGACCAAAGGCACCAAACGAGCTTACGAACAGATG-3′ ; and BsmBI -vNP rev, and 5′- CGTCTC NTATTAGTAGAAACAAGGTTCTTTAA-3′ . .. After purification, the PCR products were digested with BsmBI (New England Biolabs) and cloned into the BsmBI sites within the pHH21 vector . .. To produce pCAGGS encoding the full-length NP mutants (R8A-NP/pCAGGS and S9A-NP/pCAGGS), PCR amplification was performed using KOD Plus Ver.

    Article Title: Target sequencing and CRISPR/Cas editing reveal simultaneous loss of UTX and UTY in urothelial bladder cancer
    Article Snippet: We then incubated 2 μL of lentivirus plasmid (878 ng/μL), 2 μL of BsmBI (NEB, USA), and 6 μL of enzyme buffer (NEB, USA) at 37°C for 2 hours. .. The ligation reaction consisted of 1 μL of the diluted annealed oligo duplex, 2 μL of the digested lentivirus vector, 0.5 μL of ligase (Enzymetics, USA), 1 μL of 10X ligase buffer (Enzymetics, USA), and 7 μL of distilled water.

    Article Title: Combinatorial CRISPR-Cas9 screens for de novo mapping of genetic interactions
    Article Snippet: The step 1 library plasmids were digested by BsmBI (NEB) as per the following reaction at 55°C for 3 hours: Step 1 library 4 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL After digestion, the linearized plasmids were treated with 2 μL of Calf Intestinal Alkaline Phosphatase (NEB) at 37°C for 30 minutes; cut plasmids were gel-purified via 0.6% agarose gel electrophoresis and QIAquick gel extraction (QIAGEN). .. Concurrently, the step 2 inserts, synthesized commercially (Integrated DNA Technologies) and cloned into a TOPO vector, were digested by BsmBI (NEB) per the following reaction at 55 °C for 3 hours: Purified step 2 insert PCR product 0.8 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL Sequence of the step 2 insert, with left-gRNA scaffold ( underlined ) and mU6 promoters ( bold ): TATGAGGACGAATCTCCCGCTTATACGTCTCTGTTTCAGAGCTATGCTGGAAACTGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT GTACTGAGTCGCCCA GTCTCAGATAGATCCGACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGGAAACTCACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTT GAGAGACGGTACAAGCACACGTTTGTCAAGACC Subsequently, the following ligation reaction was set up, involving overnight incubation at 16°C followed by heat inactivation at 65°C for 10 minutes: 10X T4 DNA Ligase Buffer 2 μL Step 1 library, digested 100 ng Step 2 insert, digested 100 ng T4 DNA Ligase (high concentration) 1 μL H2O Up to 20 μL 4 μL of the reaction was transformed into 100 μL of ElectroMAX Stbl4 Competent Cells (Invitrogen) according to the manufacturer’s protocol using an Eppendorf Electroporator. .. A small fraction (1–10 μL) of cultures were spread on carbenicillin (50 μg/ml) LB plates to calculate the library coverage, and the rest of the cultures were plated on ten 15 cm LB- carbenicillin plates and grown overnight at 37°C for amplification.

    Article Title: FOXP3 Allelic Variants and Haplotype Structures Are Associated with Aggressive Breast Cancer Subtypes
    Article Snippet: The cycling protocol, used to both FOXP3 polymorphisms, was a denaturation at 94°C for 5 min, 35 cycles of 45 sec at 94°C, 45 sec at 59°C to g.10403A > G or 65°C to g.8048A > C, 45 sec at 72°C, and 10 min of final elongation at 72°C. .. PCR products (5 μ L) of g.10403A > G, with 249 bp, were digested overnight at 55°C with 1 unit/reaction of BsmBI restriction endonuclease (New England Biolabs, Beverly, USA), generating two fragments of 132 bp and 117 bp corresponding to allele G. The PCR products (6 μ L) of g.8048A > C, with 155 bp, were digested overnight at 37°C with 2 units/reaction of PstI restriction endonuclease (New England Biolabs, Beverly, USA), generating two fragments of 80 bp and 75 bp that correspond to allele C. All PCR and digested products were analyzed on polyacrylamide gel (10%), stained with silver nitrate. .. FOXP3 haplotypes were determined based on the genotypes of all study participants using PHASE software version 2.1.1 [ , ].

    Article Title: Targeting Somatostatin Receptors By Functionalized Mesoporous Silica Nanoparticles - Are We Striking Home?
    Article Snippet: For this, SSTR2_HA coding sequence was PCR-amplified from pMiniT vector utilizing high-fidelity KOD Xtreme Hot Start DNA polymerase and primers carrying 5-prime overhangs (PID#9+10) to the ultimate expression plasmid. .. The PCR products were gel-purified and ligated into BsmBI-linearized (New England Biolabs, Cat# R0580) and gel-purified AmCyan-P2A-mCherry plasmid with Gibson assembly master mix (New England Biolabs, Cat# E2611) . .. The resulting ligation reaction was purified with YM-100 kDa centrifugal filter unit (Merck Millipore) and transformed into DH10-beta electrocompetent E.coli (New England Biolabs, Cat# C3020) employing Electroporator 2510 (Eppendorf AG, Germany), at 1350 V, 600 Ω and 10 mcF.

    Article Title: Targeted resequencing identifies PTCH1 as a major contributor to ocular developmental anomalies and extends the SOX2 regulatory network
    Article Snippet: The annealed oligos were then ligated to a BsmBI-digested T7cas9sgRNA2 vector overnight at room temperature (NEB). .. For the T7 endonuclease I assay, genomic DNA was prepared from 1-dpf embryos by digestion in 5 µg/mL proteinase K for 90 min at 65°C, followed by 15 min at 95°C.

    Injection:

    Article Title: Targeted DNA methylation in vivo using an engineered dCas9-MQ1 fusion protein
    Article Snippet: Next, the plasmids: pcDNA3.1-dCas9-MQ1C141S , pcDNA3.1-dCas9-MQ1Q147L , pcDNA3.1-dCas9-MQ1S317A and pcDNA3.1-dCas9-dMQ1 were created by using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies as standard instruction). .. The plasmids for mouse zygote injection (pLV-dCas9-MQ1Q147L or pLV-dCas9-dMQ1) were also created using identical strategy. sgRNAs (see also ) were inserted into pLKO5.sgRNA.EFS.tRFP657 (Addgene, 57824) via BsmbI (NEB) site . .. Plasmid dCas9-DNMT3a CD-EGFP was obtained from Addgene (Addgene, 71666).

    Recombinant:

    Article Title: Cloning of an Avian Adeno-Associated Virus (AAAV) and Generation of Recombinant AAAV Particles
    Article Snippet: Paragraph title: Generation of recombinant AAAV particles. ... For generation of the vector carrying the β-galactosidase gene flanked by AAAV ITRs, the plasmid pAAAV was digested with Bsm BI (NEB).

    Cellular Antioxidant Activity Assay:

    Article Title: A complex epistatic network limits the mutational reversibility in the influenza hemagglutinin receptor-binding site
    Article Snippet: The vector for the mutant library was generated by a PCR using pHW2000-Bris07-WT as a template and primers: 5′-CGT ACG TCT CAG CAG AGC TTG TTC CGT TTT GAG TGA-3′ and 5′-CGT ACG TCT CAA TTG GAC AAT AGT AAA ACC GGG AGA-3′. .. Both the vector and insert were digested by Bsm BI (New England Biolabs) and ligated using T4 DNA ligase (New England Biolabs).

    RNA Sequencing Assay:

    Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication
    Article Snippet: We also identified four regions in segment 5, amenable to extensive silent mutagenesis that were either highly bound or represented at the same frequency in PAR-CLIP and RNA-seq data sets. .. PCR products were gel extracted and digested with either BsmbI (New England Biolabs, (NEB)) or AarI (Thermo Fisher Scientific) restriction enzymes and DpnI (NEB) to remove residual parent plasmid.

    Mutagenesis:

    Article Title: A complex epistatic network limits the mutational reversibility in the influenza hemagglutinin receptor-binding site
    Article Snippet: Paragraph title: Construction of Bris07 mutant library ... Both the vector and insert were digested by Bsm BI (New England Biolabs) and ligated using T4 DNA ligase (New England Biolabs).

    Article Title: The inherent mutational tolerance and antigenic evolvability of influenza hemagglutinin
    Article Snippet: The mutagenic primers were ordered from Integrated DNA Technologies, and are listed in . .. The final products from the codon mutagenesis PCR were gel purified and digested with BsmBI (R0580L; New England Biolabs, Ipswich, Massachusetts). .. The BsmBI-digested HA was ligated into a dephosphorylated (Antarctic Phosphatase, M0289L; New England Biolabs) and BsmBI-digested preparation of the bidirectional reverse-genetics plasmid pHW2000 ( ) using T4 DNA ligase (M0202S; New England Biolabs).

    Article Title: Targeted DNA methylation in vivo using an engineered dCas9-MQ1 fusion protein
    Article Snippet: Next, the plasmids: pcDNA3.1-dCas9-MQ1C141S , pcDNA3.1-dCas9-MQ1Q147L , pcDNA3.1-dCas9-MQ1S317A and pcDNA3.1-dCas9-dMQ1 were created by using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies as standard instruction). .. The plasmids for mouse zygote injection (pLV-dCas9-MQ1Q147L or pLV-dCas9-dMQ1) were also created using identical strategy. sgRNAs (see also ) were inserted into pLKO5.sgRNA.EFS.tRFP657 (Addgene, 57824) via BsmbI (NEB) site .

    Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication
    Article Snippet: Once predicted destabilizing mutations were identified, mutant viruses were generated. .. PCR products were gel extracted and digested with either BsmbI (New England Biolabs, (NEB)) or AarI (Thermo Fisher Scientific) restriction enzymes and DpnI (NEB) to remove residual parent plasmid.

    Isolation:

    Article Title: FLASH Assembly of TALENs Enables High-Throughput Genome Editing
    Article Snippet: To prepare a TALEN expression vector for subcloning, we digested 5 μg of plasmid DNA with 50 units of BsmBI restriction enzyme (New England Biolabs) in NEBuffer 3 for 8 hours at 55 degrees C. Digested DNA was purified using 90 μl of Ampure XP beads (Agencourt) according to manufacturer’s instructions and diluted to a final concentration of 5ng/μl in 1 mM TrisHCl. .. Ligation products were transformed into chemically competent XL-1 Blue cells.

    Subcloning:

    Article Title: FLASH Assembly of TALENs Enables High-Throughput Genome Editing
    Article Snippet: All four of the TALEN expression vectors (each possessing a different 0.5 TALE repeat) are already available from Addgene and full sequences of these plasmids are freely available on a web page dedicated to these constructs: http://www.addgene.org/talengineering/expressionvectors/ . .. To prepare a TALEN expression vector for subcloning, we digested 5 μg of plasmid DNA with 50 units of BsmBI restriction enzyme (New England Biolabs) in NEBuffer 3 for 8 hours at 55 degrees C. Digested DNA was purified using 90 μl of Ampure XP beads (Agencourt) according to manufacturer’s instructions and diluted to a final concentration of 5ng/μl in 1 mM TrisHCl. .. FLASH-assembled TALE repeat arrays were ligated into TALEN expression vectors using 400 U of T4 DNA Ligase (New England Biolabs).

    Article Title: Targeting Somatostatin Receptors By Functionalized Mesoporous Silica Nanoparticles - Are We Striking Home?
    Article Snippet: The second step in SSTR2_HA-P2A-mCherry vector generation involved subcloning of SSTR2_HA coding sequence into AmCyan-P2A-mCherry plasmid. .. The PCR products were gel-purified and ligated into BsmBI-linearized (New England Biolabs, Cat# R0580) and gel-purified AmCyan-P2A-mCherry plasmid with Gibson assembly master mix (New England Biolabs, Cat# E2611) .

    Size-exclusion Chromatography:

    Article Title: FOXP3 Allelic Variants and Haplotype Structures Are Associated with Aggressive Breast Cancer Subtypes
    Article Snippet: The cycling protocol, used to both FOXP3 polymorphisms, was a denaturation at 94°C for 5 min, 35 cycles of 45 sec at 94°C, 45 sec at 59°C to g.10403A > G or 65°C to g.8048A > C, 45 sec at 72°C, and 10 min of final elongation at 72°C. .. PCR products (5 μ L) of g.10403A > G, with 249 bp, were digested overnight at 55°C with 1 unit/reaction of BsmBI restriction endonuclease (New England Biolabs, Beverly, USA), generating two fragments of 132 bp and 117 bp corresponding to allele G. The PCR products (6 μ L) of g.8048A > C, with 155 bp, were digested overnight at 37°C with 2 units/reaction of PstI restriction endonuclease (New England Biolabs, Beverly, USA), generating two fragments of 80 bp and 75 bp that correspond to allele C. All PCR and digested products were analyzed on polyacrylamide gel (10%), stained with silver nitrate.

    Labeling:

    Article Title: Typing Method for the QUB11a Locus of Mycobacterium tuberculosis: IS6110 Insertions and Tandem Repeat Analysis
    Article Snippet: The QUB11a locus was amplified from genomic DNA from the 29 isolates using primers iwamoto-F (forward) and iwamoto-R (reverse), which were labeled with fluorescent dyes fluorescein (FAM) and NED, respectively. .. The amplified fragments were treated with Bsm BI (New England Biolabs, Ipswich, MA, USA) at 37°C for 1 h. The Bsm BI-treated fragments were then analyzed simultaneously by capillary electrophoresis, as described above.

    Purification:

    Article Title: A complex epistatic network limits the mutational reversibility in the influenza hemagglutinin receptor-binding site
    Article Snippet: Both the vector and insert were digested by Bsm BI (New England Biolabs) and ligated using T4 DNA ligase (New England Biolabs). .. Both the vector and insert were digested by Bsm BI (New England Biolabs) and ligated using T4 DNA ligase (New England Biolabs).

    Article Title: The inherent mutational tolerance and antigenic evolvability of influenza hemagglutinin
    Article Snippet: The mutagenic primers were ordered from Integrated DNA Technologies, and are listed in . .. The final products from the codon mutagenesis PCR were gel purified and digested with BsmBI (R0580L; New England Biolabs, Ipswich, Massachusetts). .. The BsmBI-digested HA was ligated into a dephosphorylated (Antarctic Phosphatase, M0289L; New England Biolabs) and BsmBI-digested preparation of the bidirectional reverse-genetics plasmid pHW2000 ( ) using T4 DNA ligase (M0202S; New England Biolabs).

    Article Title: FLASH Assembly of TALENs Enables High-Throughput Genome Editing
    Article Snippet: All four of the TALEN expression vectors (each possessing a different 0.5 TALE repeat) are already available from Addgene and full sequences of these plasmids are freely available on a web page dedicated to these constructs: http://www.addgene.org/talengineering/expressionvectors/ . .. To prepare a TALEN expression vector for subcloning, we digested 5 μg of plasmid DNA with 50 units of BsmBI restriction enzyme (New England Biolabs) in NEBuffer 3 for 8 hours at 55 degrees C. Digested DNA was purified using 90 μl of Ampure XP beads (Agencourt) according to manufacturer’s instructions and diluted to a final concentration of 5ng/μl in 1 mM TrisHCl. .. FLASH-assembled TALE repeat arrays were ligated into TALEN expression vectors using 400 U of T4 DNA Ligase (New England Biolabs).

    Article Title: mTORC1-independent autophagy regulates receptor tyrosine kinase phosphorylation in colorectal cancer cells via an mTORC2-mediated mechanism
    Article Snippet: To clone the Ctrl and ATG7 or ATG5 gRNA sequences, 5 μ g of the lentiCRISPR vector was enzymatically digested with BsmBI (NEB) using Buffer 3.1 (NEB) for 2 h at 37 °C. .. To clone the Ctrl and ATG7 or ATG5 gRNA sequences, 5 μ g of the lentiCRISPR vector was enzymatically digested with BsmBI (NEB) using Buffer 3.1 (NEB) for 2 h at 37 °C.

    Article Title: Importin ?3/Qip1 Is Involved in Multiplication of Mutant Influenza Virus with Alanine Mutation at Amino Acid 9 Independently of Nuclear Transport Function
    Article Snippet: 2 (TOYOBO) and the following primers: BsmBI -R8A vNP fwd, 5′- CGTCTC NGGGAGCAAAAGCAGGTCACTCACAGAGTGACATCGAAATCATGGCGACCAAAGGCACCAAAGCATCTTACGAACAGATG-3′ ; BsmBI -S9A vNP fwd, 5′- CGTCTC NGGGAGCAAAAGCAGGTCACTCACAGAGTGACATCGAAATCATGGCGACCAAAGGCACCAAACGAGCTTACGAACAGATG-3′ ; and BsmBI -vNP rev, and 5′- CGTCTC NTATTAGTAGAAACAAGGTTCTTTAA-3′ . .. After purification, the PCR products were digested with BsmBI (New England Biolabs) and cloned into the BsmBI sites within the pHH21 vector . .. To produce pCAGGS encoding the full-length NP mutants (R8A-NP/pCAGGS and S9A-NP/pCAGGS), PCR amplification was performed using KOD Plus Ver.

    Article Title: Combinatorial CRISPR-Cas9 screens for de novo mapping of genetic interactions
    Article Snippet: The step 1 library plasmids were digested by BsmBI (NEB) as per the following reaction at 55°C for 3 hours: Step 1 library 4 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL After digestion, the linearized plasmids were treated with 2 μL of Calf Intestinal Alkaline Phosphatase (NEB) at 37°C for 30 minutes; cut plasmids were gel-purified via 0.6% agarose gel electrophoresis and QIAquick gel extraction (QIAGEN). .. Concurrently, the step 2 inserts, synthesized commercially (Integrated DNA Technologies) and cloned into a TOPO vector, were digested by BsmBI (NEB) per the following reaction at 55 °C for 3 hours: Purified step 2 insert PCR product 0.8 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL Sequence of the step 2 insert, with left-gRNA scaffold ( underlined ) and mU6 promoters ( bold ): TATGAGGACGAATCTCCCGCTTATACGTCTCTGTTTCAGAGCTATGCTGGAAACTGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT GTACTGAGTCGCCCA GTCTCAGATAGATCCGACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGGAAACTCACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTT GAGAGACGGTACAAGCACACGTTTGTCAAGACC Subsequently, the following ligation reaction was set up, involving overnight incubation at 16°C followed by heat inactivation at 65°C for 10 minutes: 10X T4 DNA Ligase Buffer 2 μL Step 1 library, digested 100 ng Step 2 insert, digested 100 ng T4 DNA Ligase (high concentration) 1 μL H2O Up to 20 μL 4 μL of the reaction was transformed into 100 μL of ElectroMAX Stbl4 Competent Cells (Invitrogen) according to the manufacturer’s protocol using an Eppendorf Electroporator. .. A small fraction (1–10 μL) of cultures were spread on carbenicillin (50 μg/ml) LB plates to calculate the library coverage, and the rest of the cultures were plated on ten 15 cm LB- carbenicillin plates and grown overnight at 37°C for amplification.

    Article Title: Terminal protein-primed amplification of heterologous DNA with a minimal replication system based on phage ?29
    Article Snippet: In all cases, the restriction cuts were confirmed by agarose gel electrophoresis. .. In the experiments that involved ligations, plasmid pEYFPBsm was cut with BsmBI and EcoO109I in New England Biolabs Buffer 3 for 8 h at 37 °C, purified by Qiaquick Spin columns (Qiagen), and then ligated in a 1∶4 proportion to the corresponding double-stranded hybridized oligonucleotides (oligonucleotides 68L + Comp68LBsm, 68L + Comp68LEco109; see ). .. After inactivation of the ligase, the samples were treated with New England Biolabs T4 Polynucleotide Kinase, without changing buffer, for 30 min at 37 °C.

    Article Title: The Molecular Engineering of an Anti-Idiotypic Antibody for Pharmacokinetic Analysis of a Fully Human Anti-Infective
    Article Snippet: Heavy and light chains were cloned via BsmBI/ SfiI and SalI/NotI (New England Biolabs, UK) restriction enzyme sites respectively from the library phagemid vector into the different expression vectors. .. The constructs encoding the heavy and light chains were transfected into mammalian HEK293 cells (ATCC) via branched polyethylenimine (PEI) (Sigma- Aldrich, USA).

    Sequencing:

    Article Title: Ubiquitylation of p62/sequestosome1 activates its autophagy receptor function and controls selective autophagy upon ubiquitin stress
    Article Snippet: A 20-bp guide sequence (5′-CCATTGGCAAGCTACAATAA-3′) targeting DNA within the third exon of UBE2D2 and a 20-bp guide sequence (5′-AGAATACACCGCCTTGATAT-3′) targeting DNA within the third exon of UBE2D3 were selected from a database of predicted high specificity protospacer adjacent motif target sites ( ). .. Two complementary oligos containing the UBE2D2/UBE2D3 sequence and Bsm BI (NEB) ligation adapters were synthesized. .. The annealed oligo was ligated into the Bsm BI-digested lentiCRISPRv2 vector.

    Article Title: Cloning of an Avian Adeno-Associated Virus (AAAV) and Generation of Recombinant AAAV Particles
    Article Snippet: For generation of the vector carrying the β-galactosidase gene flanked by AAAV ITRs, the plasmid pAAAV was digested with Bsm BI (NEB). .. For generation of the vector carrying the β-galactosidase gene flanked by AAAV ITRs, the plasmid pAAAV was digested with Bsm BI (NEB).

    Article Title: Combinatorial Analysis of Secretory Immunoglobulin A (sIgA) Expression in Plants
    Article Snippet: Positive clones were selected in ampicillin-containing plates and confirmed by plasmid restriction analysis (EcoRI, NotI from Thermo Fisher Scientific, Waltham, MA, USA) and by sequencing. .. Assembly reactions were performed basically as described by [ ] using BsaI and BsmBI (New England Biolabs, Ipswich, MA, USA) as restriction enzymes in 25-cycle digestion/ligation reactions.

    Article Title: Phosphorylation-Dependent Differential Regulation of Plant Growth, Cell Death, and Innate Immunity by the Regulatory Receptor-Like Kinase BAK1
    Article Snippet: The resulting constructs were cloned into pCR-Blunt-II-TOPO (Invitrogen) and verified by sequencing. .. The inserts were released by digesting with BsmBI and BamHI (NEB) and ligated into epiGreenB(eGFP) digested with EcoRI and BamHI (NEB).

    Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication
    Article Snippet: PCR products were gel extracted and digested with either BsmbI (New England Biolabs, (NEB)) or AarI (Thermo Fisher Scientific) restriction enzymes and DpnI (NEB) to remove residual parent plasmid. .. PCR products were gel extracted and digested with either BsmbI (New England Biolabs, (NEB)) or AarI (Thermo Fisher Scientific) restriction enzymes and DpnI (NEB) to remove residual parent plasmid.

    Article Title: mTORC1-independent autophagy regulates receptor tyrosine kinase phosphorylation in colorectal cancer cells via an mTORC2-mediated mechanism
    Article Snippet: For control (Ctrl), the gRNA sequence 5'-GTAGCGAACGTGTCCGGCGT-3' was used, generated by Wang et al. .. To clone the Ctrl and ATG7 or ATG5 gRNA sequences, 5 μ g of the lentiCRISPR vector was enzymatically digested with BsmBI (NEB) using Buffer 3.1 (NEB) for 2 h at 37 °C.

    Article Title: Target sequencing and CRISPR/Cas editing reveal simultaneous loss of UTX and UTY in urothelial bladder cancer
    Article Snippet: We then incubated 2 μL of lentivirus plasmid (878 ng/μL), 2 μL of BsmBI (NEB, USA), and 6 μL of enzyme buffer (NEB, USA) at 37°C for 2 hours. .. Finally, the ligated vector was transformed into Endura™ competent cells (Lucigen, USA), and colonies selected using colony PCR.

    Article Title: Combinatorial CRISPR-Cas9 screens for de novo mapping of genetic interactions
    Article Snippet: The step 1 library plasmids were digested by BsmBI (NEB) as per the following reaction at 55°C for 3 hours: Step 1 library 4 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL After digestion, the linearized plasmids were treated with 2 μL of Calf Intestinal Alkaline Phosphatase (NEB) at 37°C for 30 minutes; cut plasmids were gel-purified via 0.6% agarose gel electrophoresis and QIAquick gel extraction (QIAGEN). .. Concurrently, the step 2 inserts, synthesized commercially (Integrated DNA Technologies) and cloned into a TOPO vector, were digested by BsmBI (NEB) per the following reaction at 55 °C for 3 hours: Purified step 2 insert PCR product 0.8 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL Sequence of the step 2 insert, with left-gRNA scaffold ( underlined ) and mU6 promoters ( bold ): TATGAGGACGAATCTCCCGCTTATACGTCTCTGTTTCAGAGCTATGCTGGAAACTGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT GTACTGAGTCGCCCA GTCTCAGATAGATCCGACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGGAAACTCACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTT GAGAGACGGTACAAGCACACGTTTGTCAAGACC Subsequently, the following ligation reaction was set up, involving overnight incubation at 16°C followed by heat inactivation at 65°C for 10 minutes: 10X T4 DNA Ligase Buffer 2 μL Step 1 library, digested 100 ng Step 2 insert, digested 100 ng T4 DNA Ligase (high concentration) 1 μL H2O Up to 20 μL 4 μL of the reaction was transformed into 100 μL of ElectroMAX Stbl4 Competent Cells (Invitrogen) according to the manufacturer’s protocol using an Eppendorf Electroporator. .. A small fraction (1–10 μL) of cultures were spread on carbenicillin (50 μg/ml) LB plates to calculate the library coverage, and the rest of the cultures were plated on ten 15 cm LB- carbenicillin plates and grown overnight at 37°C for amplification.

    Article Title: Targeting Somatostatin Receptors By Functionalized Mesoporous Silica Nanoparticles - Are We Striking Home?
    Article Snippet: For this, SSTR2_HA coding sequence was PCR-amplified from pMiniT vector utilizing high-fidelity KOD Xtreme Hot Start DNA polymerase and primers carrying 5-prime overhangs (PID#9+10) to the ultimate expression plasmid. .. The PCR products were gel-purified and ligated into BsmBI-linearized (New England Biolabs, Cat# R0580) and gel-purified AmCyan-P2A-mCherry plasmid with Gibson assembly master mix (New England Biolabs, Cat# E2611) .

    De-Phosphorylation Assay:

    Article Title: Terminal protein-primed amplification of heterologous DNA with a minimal replication system based on phage ?29
    Article Snippet: In the experiments that involved ligations, plasmid pEYFPBsm was cut with BsmBI and EcoO109I in New England Biolabs Buffer 3 for 8 h at 37 °C, purified by Qiaquick Spin columns (Qiagen), and then ligated in a 1∶4 proportion to the corresponding double-stranded hybridized oligonucleotides (oligonucleotides 68L + Comp68LBsm, 68L + Comp68LEco109; see ). .. In the experiments that involved ligations, plasmid pEYFPBsm was cut with BsmBI and EcoO109I in New England Biolabs Buffer 3 for 8 h at 37 °C, purified by Qiaquick Spin columns (Qiagen), and then ligated in a 1∶4 proportion to the corresponding double-stranded hybridized oligonucleotides (oligonucleotides 68L + Comp68LBsm, 68L + Comp68LEco109; see ).

    CRISPR:

    Article Title: mTORC1-independent autophagy regulates receptor tyrosine kinase phosphorylation in colorectal cancer cells via an mTORC2-mediated mechanism
    Article Snippet: In addition, the CRISPR design tool software was used for the identification of suitable target sites for guide RNA sequence design against ATG7 or ATG5 . .. To clone the Ctrl and ATG7 or ATG5 gRNA sequences, 5 μ g of the lentiCRISPR vector was enzymatically digested with BsmBI (NEB) using Buffer 3.1 (NEB) for 2 h at 37 °C.

    Article Title: Target sequencing and CRISPR/Cas editing reveal simultaneous loss of UTX and UTY in urothelial bladder cancer
    Article Snippet: Oligo pairs (IDT, USA) for UTX and UTY were designed using the GeCKO lentiviral CRISPR toolbox protocol. .. We then incubated 2 μL of lentivirus plasmid (878 ng/μL), 2 μL of BsmBI (NEB, USA), and 6 μL of enzyme buffer (NEB, USA) at 37°C for 2 hours.

    Article Title: Targeted resequencing identifies PTCH1 as a major contributor to ocular developmental anomalies and extends the SOX2 regulatory network
    Article Snippet: Paragraph title: Generation of CRISPR/Cas9 ptch1 mutants ... The annealed oligos were then ligated to a BsmBI-digested T7cas9sgRNA2 vector overnight at room temperature (NEB).

    T7EI Assay:

    Article Title: Targeted resequencing identifies PTCH1 as a major contributor to ocular developmental anomalies and extends the SOX2 regulatory network
    Article Snippet: The annealed oligos were then ligated to a BsmBI-digested T7cas9sgRNA2 vector overnight at room temperature (NEB). .. The annealed oligos were then ligated to a BsmBI-digested T7cas9sgRNA2 vector overnight at room temperature (NEB).

    Plasmid Preparation:

    Article Title: Cloning of an Avian Adeno-Associated Virus (AAAV) and Generation of Recombinant AAAV Particles
    Article Snippet: Orientation of inserts was verified by restriction digestion analysis, and final clones were confirmed by sequencing. .. For generation of the vector carrying the β-galactosidase gene flanked by AAAV ITRs, the plasmid pAAAV was digested with Bsm BI (NEB). .. Bsm BI does not cut in the plasmid backbone but cuts at positions 838, 1111, 2590, 4419, and 4530 of the AAAV genome.

    Article Title: A complex epistatic network limits the mutational reversibility in the influenza hemagglutinin receptor-binding site
    Article Snippet: The vector for the mutant library was generated by a PCR using pHW2000-Bris07-WT as a template and primers: 5′-CGT ACG TCT CAG CAG AGC TTG TTC CGT TTT GAG TGA-3′ and 5′-CGT ACG TCT CAA TTG GAC AAT AGT AAA ACC GGG AGA-3′. .. Both the vector and insert were digested by Bsm BI (New England Biolabs) and ligated using T4 DNA ligase (New England Biolabs). .. The ligated product was transformed into MegaX DH10B T1R cells (Life Technologies).

    Article Title: The inherent mutational tolerance and antigenic evolvability of influenza hemagglutinin
    Article Snippet: The libraries were created in full biological triplicate, meaning that each experimental replicate was derived from an independent plasmid mutant library. .. The final products from the codon mutagenesis PCR were gel purified and digested with BsmBI (R0580L; New England Biolabs, Ipswich, Massachusetts).

    Article Title: FLASH Assembly of TALENs Enables High-Throughput Genome Editing
    Article Snippet: All four of the TALEN expression vectors (each possessing a different 0.5 TALE repeat) are already available from Addgene and full sequences of these plasmids are freely available on a web page dedicated to these constructs: http://www.addgene.org/talengineering/expressionvectors/ . .. To prepare a TALEN expression vector for subcloning, we digested 5 μg of plasmid DNA with 50 units of BsmBI restriction enzyme (New England Biolabs) in NEBuffer 3 for 8 hours at 55 degrees C. Digested DNA was purified using 90 μl of Ampure XP beads (Agencourt) according to manufacturer’s instructions and diluted to a final concentration of 5ng/μl in 1 mM TrisHCl. .. FLASH-assembled TALE repeat arrays were ligated into TALEN expression vectors using 400 U of T4 DNA Ligase (New England Biolabs).

    Article Title: Combinatorial Analysis of Secretory Immunoglobulin A (sIgA) Expression in Plants
    Article Snippet: Positive clones were selected in ampicillin-containing plates and confirmed by plasmid restriction analysis (EcoRI, NotI from Thermo Fisher Scientific, Waltham, MA, USA) and by sequencing. .. Assembly reactions were performed basically as described by [ ] using BsaI and BsmBI (New England Biolabs, Ipswich, MA, USA) as restriction enzymes in 25-cycle digestion/ligation reactions.

    Article Title: Phosphorylation-Dependent Differential Regulation of Plant Growth, Cell Death, and Innate Immunity by the Regulatory Receptor-Like Kinase BAK1
    Article Snippet: The EFRp::EFR-3xHA construct, containing own promoter plus coding region, was described previously with the exception of using epiGreenB5 as binary vector . .. The inserts were released by digesting with BsmBI and BamHI (NEB) and ligated into epiGreenB(eGFP) digested with EcoRI and BamHI (NEB).

    Article Title: Targeted DNA methylation in vivo using an engineered dCas9-MQ1 fusion protein
    Article Snippet: Paragraph title: Plasmid construction ... The plasmids for mouse zygote injection (pLV-dCas9-MQ1Q147L or pLV-dCas9-dMQ1) were also created using identical strategy. sgRNAs (see also ) were inserted into pLKO5.sgRNA.EFS.tRFP657 (Addgene, 57824) via BsmbI (NEB) site .

    Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication
    Article Snippet: Mutations were introduced into pHW2000 bidirectional plasmids by inverse PCR with primers (see Supplementary Table ) including selected mutations and unique ligation sites. .. PCR products were gel extracted and digested with either BsmbI (New England Biolabs, (NEB)) or AarI (Thermo Fisher Scientific) restriction enzymes and DpnI (NEB) to remove residual parent plasmid. .. Digested PCR products were PCR purified and ligated using Instant Sticky End Ligase (NEB).

    Article Title: mTORC1-independent autophagy regulates receptor tyrosine kinase phosphorylation in colorectal cancer cells via an mTORC2-mediated mechanism
    Article Snippet: The abovementioned oligo sequences integrated with specific overhangs for cloning were used. .. To clone the Ctrl and ATG7 or ATG5 gRNA sequences, 5 μ g of the lentiCRISPR vector was enzymatically digested with BsmBI (NEB) using Buffer 3.1 (NEB) for 2 h at 37 °C. .. 10 μ M of each single-stranded forward and reverse -gRNA oligo was phosphorylated using T4 polynucleotide Kinase (Cambio) at 37 °C for 30 min (based on the instructions of the manufacturer) and then annealed by heating at 95 °C for 5 min and cooling down to 25 °C at 5 °C/min.

    Article Title: Importin ?3/Qip1 Is Involved in Multiplication of Mutant Influenza Virus with Alanine Mutation at Amino Acid 9 Independently of Nuclear Transport Function
    Article Snippet: 2 (TOYOBO) and the following primers: BsmBI -R8A vNP fwd, 5′- CGTCTC NGGGAGCAAAAGCAGGTCACTCACAGAGTGACATCGAAATCATGGCGACCAAAGGCACCAAAGCATCTTACGAACAGATG-3′ ; BsmBI -S9A vNP fwd, 5′- CGTCTC NGGGAGCAAAAGCAGGTCACTCACAGAGTGACATCGAAATCATGGCGACCAAAGGCACCAAACGAGCTTACGAACAGATG-3′ ; and BsmBI -vNP rev, and 5′- CGTCTC NTATTAGTAGAAACAAGGTTCTTTAA-3′ . .. After purification, the PCR products were digested with BsmBI (New England Biolabs) and cloned into the BsmBI sites within the pHH21 vector . .. To produce pCAGGS encoding the full-length NP mutants (R8A-NP/pCAGGS and S9A-NP/pCAGGS), PCR amplification was performed using KOD Plus Ver.

    Article Title: Target sequencing and CRISPR/Cas editing reveal simultaneous loss of UTX and UTY in urothelial bladder cancer
    Article Snippet: After annealing, the oligo duplex was diluted with distilled water (1/200) and ligated to enzymatically digested lentiCRISPRv2 vector (Addgene, USA). .. We then incubated 2 μL of lentivirus plasmid (878 ng/μL), 2 μL of BsmBI (NEB, USA), and 6 μL of enzyme buffer (NEB, USA) at 37°C for 2 hours. .. The reaction product was purified using the QIAquick Gel Extraction Kit (Qiagen, USA) for ligation.

    Article Title: Combinatorial CRISPR-Cas9 screens for de novo mapping of genetic interactions
    Article Snippet: The step 1 library plasmids were digested by BsmBI (NEB) as per the following reaction at 55°C for 3 hours: Step 1 library 4 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL After digestion, the linearized plasmids were treated with 2 μL of Calf Intestinal Alkaline Phosphatase (NEB) at 37°C for 30 minutes; cut plasmids were gel-purified via 0.6% agarose gel electrophoresis and QIAquick gel extraction (QIAGEN). .. Concurrently, the step 2 inserts, synthesized commercially (Integrated DNA Technologies) and cloned into a TOPO vector, were digested by BsmBI (NEB) per the following reaction at 55 °C for 3 hours: Purified step 2 insert PCR product 0.8 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL Sequence of the step 2 insert, with left-gRNA scaffold ( underlined ) and mU6 promoters ( bold ): TATGAGGACGAATCTCCCGCTTATACGTCTCTGTTTCAGAGCTATGCTGGAAACTGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT GTACTGAGTCGCCCA GTCTCAGATAGATCCGACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGGAAACTCACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTT GAGAGACGGTACAAGCACACGTTTGTCAAGACC Subsequently, the following ligation reaction was set up, involving overnight incubation at 16°C followed by heat inactivation at 65°C for 10 minutes: 10X T4 DNA Ligase Buffer 2 μL Step 1 library, digested 100 ng Step 2 insert, digested 100 ng T4 DNA Ligase (high concentration) 1 μL H2O Up to 20 μL 4 μL of the reaction was transformed into 100 μL of ElectroMAX Stbl4 Competent Cells (Invitrogen) according to the manufacturer’s protocol using an Eppendorf Electroporator. .. A small fraction (1–10 μL) of cultures were spread on carbenicillin (50 μg/ml) LB plates to calculate the library coverage, and the rest of the cultures were plated on ten 15 cm LB- carbenicillin plates and grown overnight at 37°C for amplification.

    Article Title: Terminal protein-primed amplification of heterologous DNA with a minimal replication system based on phage ?29
    Article Snippet: In all cases, the restriction cuts were confirmed by agarose gel electrophoresis. .. In the experiments that involved ligations, plasmid pEYFPBsm was cut with BsmBI and EcoO109I in New England Biolabs Buffer 3 for 8 h at 37 °C, purified by Qiaquick Spin columns (Qiagen), and then ligated in a 1∶4 proportion to the corresponding double-stranded hybridized oligonucleotides (oligonucleotides 68L + Comp68LBsm, 68L + Comp68LEco109; see ). .. After inactivation of the ligase, the samples were treated with New England Biolabs T4 Polynucleotide Kinase, without changing buffer, for 30 min at 37 °C.

    Article Title: The Molecular Engineering of an Anti-Idiotypic Antibody for Pharmacokinetic Analysis of a Fully Human Anti-Infective
    Article Snippet: Plasmid DNA was sequenced with the primers HX01-01F (5’-AGCGGATAACAATTTCACACA-3’) and pCES-1LR (5’-ACAATCCAGCGGCTGCCGTA-3’) for light chain sequence and pCES-1HF (5’-GGCGCGCCAATTCTATTTCAAG-3’) and HX01-01R (5’-TTTGTCGTCTTTCCAGACGTTAGT-3’) for heavy chain. .. Heavy and light chains were cloned via BsmBI/ SfiI and SalI/NotI (New England Biolabs, UK) restriction enzyme sites respectively from the library phagemid vector into the different expression vectors. .. The expression vector contains the framework for expression of antibody into the mouse chimeric IgG2a with human IgG3 human hinge or mouse IgG2a or Fab.

    Article Title: Targeting Somatostatin Receptors By Functionalized Mesoporous Silica Nanoparticles - Are We Striking Home?
    Article Snippet: For this, SSTR2_HA coding sequence was PCR-amplified from pMiniT vector utilizing high-fidelity KOD Xtreme Hot Start DNA polymerase and primers carrying 5-prime overhangs (PID#9+10) to the ultimate expression plasmid. .. The PCR products were gel-purified and ligated into BsmBI-linearized (New England Biolabs, Cat# R0580) and gel-purified AmCyan-P2A-mCherry plasmid with Gibson assembly master mix (New England Biolabs, Cat# E2611) . .. The resulting ligation reaction was purified with YM-100 kDa centrifugal filter unit (Merck Millipore) and transformed into DH10-beta electrocompetent E.coli (New England Biolabs, Cat# C3020) employing Electroporator 2510 (Eppendorf AG, Germany), at 1350 V, 600 Ω and 10 mcF.

    Article Title: Targeted resequencing identifies PTCH1 as a major contributor to ocular developmental anomalies and extends the SOX2 regulatory network
    Article Snippet: ptch1 gRNA targeting the antisense strand of ptch1 exon 6 was produced by synthesizing and annealing two oligonucleotides, gRNA3 F: TAGGGAAGCCCATCGGATCGAAGT and gRNA3 R: AAACACTTCGATCCGATGGGCTTC. .. The annealed oligos were then ligated to a BsmBI-digested T7cas9sgRNA2 vector overnight at room temperature (NEB). .. Prior to transcription, the gRNA vector was linearized with BamHI. gRNA was transcribed using the MEGAshortscript T7 kit (AM1354, Life Technologies) and purified using alcohol precipitation.

    Software:

    Article Title: mTORC1-independent autophagy regulates receptor tyrosine kinase phosphorylation in colorectal cancer cells via an mTORC2-mediated mechanism
    Article Snippet: In addition, the CRISPR design tool software was used for the identification of suitable target sites for guide RNA sequence design against ATG7 or ATG5 . .. To clone the Ctrl and ATG7 or ATG5 gRNA sequences, 5 μ g of the lentiCRISPR vector was enzymatically digested with BsmBI (NEB) using Buffer 3.1 (NEB) for 2 h at 37 °C.

    Spectrophotometry:

    Article Title: Combinatorial Analysis of Secretory Immunoglobulin A (sIgA) Expression in Plants
    Article Snippet: Plasmid DNA concentration was measured using a Nano Drop Spectrophotometer 2000 (Thermo Scientific, Rockford, IL, USA). .. Assembly reactions were performed basically as described by [ ] using BsaI and BsmBI (New England Biolabs, Ipswich, MA, USA) as restriction enzymes in 25-cycle digestion/ligation reactions.

    Agarose Gel Electrophoresis:

    Article Title: Combinatorial CRISPR-Cas9 screens for de novo mapping of genetic interactions
    Article Snippet: The step 1 library plasmids were digested by BsmBI (NEB) as per the following reaction at 55°C for 3 hours: Step 1 library 4 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL After digestion, the linearized plasmids were treated with 2 μL of Calf Intestinal Alkaline Phosphatase (NEB) at 37°C for 30 minutes; cut plasmids were gel-purified via 0.6% agarose gel electrophoresis and QIAquick gel extraction (QIAGEN). .. Concurrently, the step 2 inserts, synthesized commercially (Integrated DNA Technologies) and cloned into a TOPO vector, were digested by BsmBI (NEB) per the following reaction at 55 °C for 3 hours: Purified step 2 insert PCR product 0.8 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL Sequence of the step 2 insert, with left-gRNA scaffold ( underlined ) and mU6 promoters ( bold ): TATGAGGACGAATCTCCCGCTTATACGTCTCTGTTTCAGAGCTATGCTGGAAACTGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT GTACTGAGTCGCCCA GTCTCAGATAGATCCGACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGGAAACTCACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTT GAGAGACGGTACAAGCACACGTTTGTCAAGACC Subsequently, the following ligation reaction was set up, involving overnight incubation at 16°C followed by heat inactivation at 65°C for 10 minutes: 10X T4 DNA Ligase Buffer 2 μL Step 1 library, digested 100 ng Step 2 insert, digested 100 ng T4 DNA Ligase (high concentration) 1 μL H2O Up to 20 μL 4 μL of the reaction was transformed into 100 μL of ElectroMAX Stbl4 Competent Cells (Invitrogen) according to the manufacturer’s protocol using an Eppendorf Electroporator.

    Article Title: Terminal protein-primed amplification of heterologous DNA with a minimal replication system based on phage ?29
    Article Snippet: In the experiments that involved ligations, plasmid pEYFPBsm was cut with BsmBI and EcoO109I in New England Biolabs Buffer 3 for 8 h at 37 °C, purified by Qiaquick Spin columns (Qiagen), and then ligated in a 1∶4 proportion to the corresponding double-stranded hybridized oligonucleotides (oligonucleotides 68L + Comp68LBsm, 68L + Comp68LEco109; see ). .. In the experiments that involved ligations, plasmid pEYFPBsm was cut with BsmBI and EcoO109I in New England Biolabs Buffer 3 for 8 h at 37 °C, purified by Qiaquick Spin columns (Qiagen), and then ligated in a 1∶4 proportion to the corresponding double-stranded hybridized oligonucleotides (oligonucleotides 68L + Comp68LBsm, 68L + Comp68LEco109; see ).

    Knock-Out:

    Article Title: Target sequencing and CRISPR/Cas editing reveal simultaneous loss of UTX and UTY in urothelial bladder cancer
    Article Snippet: To generate Cas9 knock-outs, we used the GeCKO gene knock-out protocol [ ] and selected sgRNA sequences for UTX and UTY ( ). .. We then incubated 2 μL of lentivirus plasmid (878 ng/μL), 2 μL of BsmBI (NEB, USA), and 6 μL of enzyme buffer (NEB, USA) at 37°C for 2 hours.

    Produced:

    Article Title: Cloning of an Avian Adeno-Associated Virus (AAAV) and Generation of Recombinant AAAV Particles
    Article Snippet: For generation of pA3 VRC, the rep and cap genes of AAAV including the p5 promoter and poly(A) signal (nucleotides 142 to 4516) was produced by PCR using PFU polymerase and blunt end ligated in pPCR-script. .. For generation of the vector carrying the β-galactosidase gene flanked by AAAV ITRs, the plasmid pAAAV was digested with Bsm BI (NEB).

    Article Title: Targeted resequencing identifies PTCH1 as a major contributor to ocular developmental anomalies and extends the SOX2 regulatory network
    Article Snippet: ptch1 gRNA targeting the antisense strand of ptch1 exon 6 was produced by synthesizing and annealing two oligonucleotides, gRNA3 F: TAGGGAAGCCCATCGGATCGAAGT and gRNA3 R: AAACACTTCGATCCGATGGGCTTC. .. The annealed oligos were then ligated to a BsmBI-digested T7cas9sgRNA2 vector overnight at room temperature (NEB).

    Concentration Assay:

    Article Title: FLASH Assembly of TALENs Enables High-Throughput Genome Editing
    Article Snippet: All four of the TALEN expression vectors (each possessing a different 0.5 TALE repeat) are already available from Addgene and full sequences of these plasmids are freely available on a web page dedicated to these constructs: http://www.addgene.org/talengineering/expressionvectors/ . .. To prepare a TALEN expression vector for subcloning, we digested 5 μg of plasmid DNA with 50 units of BsmBI restriction enzyme (New England Biolabs) in NEBuffer 3 for 8 hours at 55 degrees C. Digested DNA was purified using 90 μl of Ampure XP beads (Agencourt) according to manufacturer’s instructions and diluted to a final concentration of 5ng/μl in 1 mM TrisHCl. .. FLASH-assembled TALE repeat arrays were ligated into TALEN expression vectors using 400 U of T4 DNA Ligase (New England Biolabs).

    Article Title: Combinatorial Analysis of Secretory Immunoglobulin A (sIgA) Expression in Plants
    Article Snippet: Plasmid DNA concentration was measured using a Nano Drop Spectrophotometer 2000 (Thermo Scientific, Rockford, IL, USA). .. Assembly reactions were performed basically as described by [ ] using BsaI and BsmBI (New England Biolabs, Ipswich, MA, USA) as restriction enzymes in 25-cycle digestion/ligation reactions.

    Article Title: mTORC1-independent autophagy regulates receptor tyrosine kinase phosphorylation in colorectal cancer cells via an mTORC2-mediated mechanism
    Article Snippet: To clone the Ctrl and ATG7 or ATG5 gRNA sequences, 5 μ g of the lentiCRISPR vector was enzymatically digested with BsmBI (NEB) using Buffer 3.1 (NEB) for 2 h at 37 °C. .. To clone the Ctrl and ATG7 or ATG5 gRNA sequences, 5 μ g of the lentiCRISPR vector was enzymatically digested with BsmBI (NEB) using Buffer 3.1 (NEB) for 2 h at 37 °C.

    Article Title: Combinatorial CRISPR-Cas9 screens for de novo mapping of genetic interactions
    Article Snippet: The step 1 library plasmids were digested by BsmBI (NEB) as per the following reaction at 55°C for 3 hours: Step 1 library 4 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL After digestion, the linearized plasmids were treated with 2 μL of Calf Intestinal Alkaline Phosphatase (NEB) at 37°C for 30 minutes; cut plasmids were gel-purified via 0.6% agarose gel electrophoresis and QIAquick gel extraction (QIAGEN). .. Concurrently, the step 2 inserts, synthesized commercially (Integrated DNA Technologies) and cloned into a TOPO vector, were digested by BsmBI (NEB) per the following reaction at 55 °C for 3 hours: Purified step 2 insert PCR product 0.8 μg Buffer 3.1 5 μL 10× BSA 5 μL BsmBI 3 μL H2O Up to 50 μL Sequence of the step 2 insert, with left-gRNA scaffold ( underlined ) and mU6 promoters ( bold ): TATGAGGACGAATCTCCCGCTTATACGTCTCTGTTTCAGAGCTATGCTGGAAACTGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT GTACTGAGTCGCCCA GTCTCAGATAGATCCGACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGGAAACTCACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTT GAGAGACGGTACAAGCACACGTTTGTCAAGACC Subsequently, the following ligation reaction was set up, involving overnight incubation at 16°C followed by heat inactivation at 65°C for 10 minutes: 10X T4 DNA Ligase Buffer 2 μL Step 1 library, digested 100 ng Step 2 insert, digested 100 ng T4 DNA Ligase (high concentration) 1 μL H2O Up to 20 μL 4 μL of the reaction was transformed into 100 μL of ElectroMAX Stbl4 Competent Cells (Invitrogen) according to the manufacturer’s protocol using an Eppendorf Electroporator. .. A small fraction (1–10 μL) of cultures were spread on carbenicillin (50 μg/ml) LB plates to calculate the library coverage, and the rest of the cultures were plated on ten 15 cm LB- carbenicillin plates and grown overnight at 37°C for amplification.

    Alkaline Lysis:

    Article Title: FLASH Assembly of TALENs Enables High-Throughput Genome Editing
    Article Snippet: To prepare a TALEN expression vector for subcloning, we digested 5 μg of plasmid DNA with 50 units of BsmBI restriction enzyme (New England Biolabs) in NEBuffer 3 for 8 hours at 55 degrees C. Digested DNA was purified using 90 μl of Ampure XP beads (Agencourt) according to manufacturer’s instructions and diluted to a final concentration of 5ng/μl in 1 mM TrisHCl. .. Ligation products were transformed into chemically competent XL-1 Blue cells.

    FLAG-tag:

    Article Title: FLASH Assembly of TALENs Enables High-Throughput Genome Editing
    Article Snippet: Each of these vectors includes a CMV promoter, a translational start codon optimized for mammalian cell expression, a triple FLAG epitope tag, a nuclear localization signal, amino acids 153 to 288 from the TALE 13 protein (as numbered by Miller et al. ), two unique and closely positioned Type IIS BsmB I restriction sites, a 0.5 TALE repeat domain encoding one of four possible RVDs (NI, HD, NN, or NG for recognition of an A, C, G, or T nucleotide, respectively), amino acids 715 to 777 from the TALE 13 protein, and the wild-type FokI cleavage domain. .. To prepare a TALEN expression vector for subcloning, we digested 5 μg of plasmid DNA with 50 units of BsmBI restriction enzyme (New England Biolabs) in NEBuffer 3 for 8 hours at 55 degrees C. Digested DNA was purified using 90 μl of Ampure XP beads (Agencourt) according to manufacturer’s instructions and diluted to a final concentration of 5ng/μl in 1 mM TrisHCl.

    Staining:

    Article Title: FOXP3 Allelic Variants and Haplotype Structures Are Associated with Aggressive Breast Cancer Subtypes
    Article Snippet: The cycling protocol, used to both FOXP3 polymorphisms, was a denaturation at 94°C for 5 min, 35 cycles of 45 sec at 94°C, 45 sec at 59°C to g.10403A > G or 65°C to g.8048A > C, 45 sec at 72°C, and 10 min of final elongation at 72°C. .. PCR products (5 μ L) of g.10403A > G, with 249 bp, were digested overnight at 55°C with 1 unit/reaction of BsmBI restriction endonuclease (New England Biolabs, Beverly, USA), generating two fragments of 132 bp and 117 bp corresponding to allele G. The PCR products (6 μ L) of g.8048A > C, with 155 bp, were digested overnight at 37°C with 2 units/reaction of PstI restriction endonuclease (New England Biolabs, Beverly, USA), generating two fragments of 80 bp and 75 bp that correspond to allele C. All PCR and digested products were analyzed on polyacrylamide gel (10%), stained with silver nitrate. .. FOXP3 haplotypes were determined based on the genotypes of all study participants using PHASE software version 2.1.1 [ , ].

    Variant Assay:

    Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication
    Article Snippet: We selected variant codon combinations that would disrupt or maintain the predicted vRNA structure but not change the encoded amino acid, alter codon usage, or disrupt alternative reading frames or splicing events. .. PCR products were gel extracted and digested with either BsmbI (New England Biolabs, (NEB)) or AarI (Thermo Fisher Scientific) restriction enzymes and DpnI (NEB) to remove residual parent plasmid.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs bsmbi
    Yeast Golden Gate <t>(yGG)</t> to assemble transcription units (TUs) flanked by VEGAS adapters. ( A ) yGG reactions to build TUs destined for VEGAS pathway assembly in S. cerevisiae include five parts: a left VEGAS adapter (LVA), a promoter (PRO), a coding sequence (CDS), a terminator (TER) and a right VEGAS adapter (RVA). Each part is flanked by inwardly facing recognition sequences for the BsaI restriction enzyme, an ‘offset cutter’ which cuts outside its recognition sequence (at positions 1/5 bp downstream) to expose the indicated four base-pair overhangs. All parts are cloned into vectors encoding kanamycin resistance (KAN R ) and an E. coli replication origin (Ori). ( B ) The yGG acceptor vector for VEGAS is designed such that outwardly facing BsaI sites expose overhangs corresponding to the 5′ LVA and 3′ RVA overhangs to promote assembly of the TU in the vector during a one-pot restriction-digestion reaction. The RFP cassette, built for expression in E. coli , is cut out of the vector when a TU correctly assembles, enabling white–red screening. The yGG acceptor vector encodes resistance to ampicillin (AMP R ) ( C ) The structure of a VA-flanked TU assembled by yGG. An assembled TU plus the flanking VA sequences may be released from the yGG acceptor vector by digestion with <t>BsmBI.</t>
    Bsmbi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 24 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsmbi/product/New England Biolabs
    Average 99 stars, based on 24 article reviews
    Price from $9.99 to $1999.99
    bsmbi - by Bioz Stars, 2019-11
    99/100 stars
      Buy from Supplier

    Image Search Results


    Yeast Golden Gate (yGG) to assemble transcription units (TUs) flanked by VEGAS adapters. ( A ) yGG reactions to build TUs destined for VEGAS pathway assembly in S. cerevisiae include five parts: a left VEGAS adapter (LVA), a promoter (PRO), a coding sequence (CDS), a terminator (TER) and a right VEGAS adapter (RVA). Each part is flanked by inwardly facing recognition sequences for the BsaI restriction enzyme, an ‘offset cutter’ which cuts outside its recognition sequence (at positions 1/5 bp downstream) to expose the indicated four base-pair overhangs. All parts are cloned into vectors encoding kanamycin resistance (KAN R ) and an E. coli replication origin (Ori). ( B ) The yGG acceptor vector for VEGAS is designed such that outwardly facing BsaI sites expose overhangs corresponding to the 5′ LVA and 3′ RVA overhangs to promote assembly of the TU in the vector during a one-pot restriction-digestion reaction. The RFP cassette, built for expression in E. coli , is cut out of the vector when a TU correctly assembles, enabling white–red screening. The yGG acceptor vector encodes resistance to ampicillin (AMP R ) ( C ) The structure of a VA-flanked TU assembled by yGG. An assembled TU plus the flanking VA sequences may be released from the yGG acceptor vector by digestion with BsmBI.

    Journal: Nucleic Acids Research

    Article Title: Versatile genetic assembly system (VEGAS) to assemble pathways for expression in S. cerevisiae

    doi: 10.1093/nar/gkv466

    Figure Lengend Snippet: Yeast Golden Gate (yGG) to assemble transcription units (TUs) flanked by VEGAS adapters. ( A ) yGG reactions to build TUs destined for VEGAS pathway assembly in S. cerevisiae include five parts: a left VEGAS adapter (LVA), a promoter (PRO), a coding sequence (CDS), a terminator (TER) and a right VEGAS adapter (RVA). Each part is flanked by inwardly facing recognition sequences for the BsaI restriction enzyme, an ‘offset cutter’ which cuts outside its recognition sequence (at positions 1/5 bp downstream) to expose the indicated four base-pair overhangs. All parts are cloned into vectors encoding kanamycin resistance (KAN R ) and an E. coli replication origin (Ori). ( B ) The yGG acceptor vector for VEGAS is designed such that outwardly facing BsaI sites expose overhangs corresponding to the 5′ LVA and 3′ RVA overhangs to promote assembly of the TU in the vector during a one-pot restriction-digestion reaction. The RFP cassette, built for expression in E. coli , is cut out of the vector when a TU correctly assembles, enabling white–red screening. The yGG acceptor vector encodes resistance to ampicillin (AMP R ) ( C ) The structure of a VA-flanked TU assembled by yGG. An assembled TU plus the flanking VA sequences may be released from the yGG acceptor vector by digestion with BsmBI.

    Article Snippet: ∼1 μg of yGG-assembled, VA-flanked TU constructs were digested with BsmBI (New England Biolabs, R0580) in a final volume of 20 μl.

    Techniques: Sequencing, Clone Assay, Plasmid Preparation, Expressing

    VEGAS with adapter homology to assemble the carotenoid pathway in S. cerevisiae . ( A ) The four β-carotene pathway genes ( crtE, crtI, crtYB and tHMG1 ), assembled as TUs flanked by the indicated VAs (see Table 2 for PRO and TER parts), were released from the yGG acceptor vector with BsmBI digestion and co-transformed into yeast with the linearized VEGAS assembly vector. ( B ) S. cerevisiae colonies encoding assembled pathways develop a bright yellow color on medium lacking uracil (SC–Ura; left panel) as well as on YPD medium supplemented with G418 (right panel).

    Journal: Nucleic Acids Research

    Article Title: Versatile genetic assembly system (VEGAS) to assemble pathways for expression in S. cerevisiae

    doi: 10.1093/nar/gkv466

    Figure Lengend Snippet: VEGAS with adapter homology to assemble the carotenoid pathway in S. cerevisiae . ( A ) The four β-carotene pathway genes ( crtE, crtI, crtYB and tHMG1 ), assembled as TUs flanked by the indicated VAs (see Table 2 for PRO and TER parts), were released from the yGG acceptor vector with BsmBI digestion and co-transformed into yeast with the linearized VEGAS assembly vector. ( B ) S. cerevisiae colonies encoding assembled pathways develop a bright yellow color on medium lacking uracil (SC–Ura; left panel) as well as on YPD medium supplemented with G418 (right panel).

    Article Snippet: ∼1 μg of yGG-assembled, VA-flanked TU constructs were digested with BsmBI (New England Biolabs, R0580) in a final volume of 20 μl.

    Techniques: Plasmid Preparation, Transformation Assay

    VEGAS with adapter homology to assemble a five-gene pathway. ( A ) The pathway consisting of VA-flanked TUs assembled by yGG may be released in one piece from the yGG acceptor vector by digestion with BsmBI (scissors). ( B ) A genetic pathway may be assembled into the linearized VEGAS assembly vector in S. cerevisiae by homologous recombination between VAs that flank TUs (TU1–5). X's indicate homologous recombination.

    Journal: Nucleic Acids Research

    Article Title: Versatile genetic assembly system (VEGAS) to assemble pathways for expression in S. cerevisiae

    doi: 10.1093/nar/gkv466

    Figure Lengend Snippet: VEGAS with adapter homology to assemble a five-gene pathway. ( A ) The pathway consisting of VA-flanked TUs assembled by yGG may be released in one piece from the yGG acceptor vector by digestion with BsmBI (scissors). ( B ) A genetic pathway may be assembled into the linearized VEGAS assembly vector in S. cerevisiae by homologous recombination between VAs that flank TUs (TU1–5). X's indicate homologous recombination.

    Article Snippet: ∼1 μg of yGG-assembled, VA-flanked TU constructs were digested with BsmBI (New England Biolabs, R0580) in a final volume of 20 μl.

    Techniques: Plasmid Preparation, Homologous Recombination