restriction endonuclease mspa1i  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    MspA1I
    Description:
    MspA1I 2 500 units
    Catalog Number:
    r0577l
    Price:
    290
    Size:
    2 500 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs restriction endonuclease mspa1i
    MspA1I
    MspA1I 2 500 units
    https://www.bioz.com/result/restriction endonuclease mspa1i/product/New England Biolabs
    Average 90 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    restriction endonuclease mspa1i - by Bioz Stars, 2020-03
    90/100 stars

    Images

    1) Product Images from "The T309G MDM2 Gene Polymorphism Is a Novel Risk Factor for Proliferative Vitreoretinopathy"

    Article Title: The T309G MDM2 Gene Polymorphism Is a Novel Risk Factor for Proliferative Vitreoretinopathy

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0082283

    PCR-RFLP to determine MDM 2 SNP309 polymorphism. MDM 2 SNP309 T allele is not cleaved by MspA1I endonuclease and generates a single fragment of 155 bp. The MDM 2 SNP309 G allele is cleaved by MspA1I and generates two small fragments of 101 and 54 bp. The MDM 2 SNP309 heterozygote displays three fragments of 155, 101 and 54 bp.
    Figure Legend Snippet: PCR-RFLP to determine MDM 2 SNP309 polymorphism. MDM 2 SNP309 T allele is not cleaved by MspA1I endonuclease and generates a single fragment of 155 bp. The MDM 2 SNP309 G allele is cleaved by MspA1I and generates two small fragments of 101 and 54 bp. The MDM 2 SNP309 heterozygote displays three fragments of 155, 101 and 54 bp.

    Techniques Used: Polymerase Chain Reaction

    Related Articles

    Diagnostic Assay:

    Article Title: Hypomorphic sialidase expression decreases serum cholesterol by downregulation of VLDL production in mice
    Article Snippet: .. PCR (40 cycles) was performed with denaturing temperature at 94°C for 2 min, annealing temperature at 60°C for 30 s, and elongation temperature at 72°C for 30 s. PCR products were digested with MspA1I (New England BioLab), which serves as a genetic diagnostic as it only cleaves the PCR product carrying the B6.SM mutation. .. Mice were housed in microisolator cages in a room with a 12 h light and dark cycle and given unlimited access to food and water.

    Amplification:

    Article Title: The T309G MDM2 Gene Polymorphism Is a Novel Risk Factor for Proliferative Vitreoretinopathy
    Article Snippet: .. MDM2 intron 1 was amplified within a 155 pb DNA fragment that was digested with the restriction endonuclease MspA1I (New England Biolabs, Inc.). .. PCR reactions were performed in a 50-µl reaction mixture containing 100–200 ng of target DNA, 20 pmol of each primer, 2.5 mM MgCl2 , 50 µM of each dNTP and 1.25 U of HotMaster Taq DNA polymerase (5 Prime GmbH, Hamburg, Germany).

    Article Title: Association of β2-adrenergic receptor and insulin receptor substrate-1 polymorphisms with obesity in a Northern Indian population
    Article Snippet: [ ] Each amplification was performed using 200ng of genomic DNA in a volume of 50 µl using 25 pmol of each primer, 200 µM each dNTPs, 15 mM MgCl2 , 100 mM Tris and 1.5 units of Taq polymerase (Bangalore Genei, Bangalore). .. T to C variation at promoter sites -47 and -20 create a restriction site for MspA1I and HphI (NEB) restriction enzymes respectively.

    Article Title: MDM2 Expression and Regulation in Prostate Cancer Racial Disparity
    Article Snippet: The MDM2 promoter region was amplified by PCR using the primer pair F (5′-CGGGAGTTCAGGGTAAAGGT-3′) and R (5′-AGCAAGTCGGTGCTTACCTG-3′) to amplify a 352 base pair (bp) product. .. After an enzyme activation step at 94°C for 10 min, PCR was conducted for 45 cycles at 94°C for 1 min, 56°C for 1 min, 72°C for 2 min, and was concluded with a final extension step of 72°C for 10 min. For RFLP analysis, 7 uL of the 352 bp PCR product was digested in a 20 uL reaction with 2 U of MspA1I (New England Biolabs, Ipswich, MA), 1× BSA, and 1× NEBuffer 4 (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1 mM DTT, pH 7.9) for 1 h at 37°C.

    Article Title: TP53 and MDM2 polymorphisms and the risk of endometrial cancer in postmenopausal women
    Article Snippet: .. The 237-bp amplified product was digested overnight with 1 U of MspA 1I at 37 °C. .. The digested products were resolved on a 2 % agarose gel and stained with 0.5 μg/ml ethidium bromide.

    Article Title: Transforming growth factor ? 869C/T and interleukin 6 -174G/C polymorphisms relate to the severity and progression of bone-erosive damage detected by ultrasound in rheumatoid arthritis
    Article Snippet: The forward and reverse primers were 5'-TTCCCTCGAGGCCCTCCTA-3' and 5'-GCCGCAGCTTGGACAGGATC-3', and the PCR amplification protocol was composed of 35 cycles comprising three steps each: 75 seconds at 96°C, 75 seconds at 62°C and 75 seconds at 73°C. .. PCR products were digested with Msp A1I (New England BioLabs, Ipswich, MA, US) and run on a 3% ethidium bromide-stained agarose gel.

    Article Title: Highly variable response to cytotoxic chemotherapy in carcinoma-associated fibroblasts (CAFs) from lung and breast
    Article Snippet: The following Primers were used for cDNA amplification (sense: cgtccagggagcaggtag; antisense: ccacaacaaaacaccagtgc) and sequencing (primer 1: cacatgacggaggttgtgag; primer 2: ccacaacaaaacaccagtgc). .. The PCR product was digested with 5 units of MspA1I (New England Biolabs, Frankfurt a.M., Germany) at 37°C for 16 h and electrophoresed on a 2% agarose gel stained with ethidium bromide (a representative example is shown in additional file ).

    Article Title: Association between MDM2-SNP309 and p53R72P polymorphisms and the risk of bladder cancer in the Mongolian population
    Article Snippet: .. The thermal cycling conditions were 1 min at 94°C; 40 cycles of denaturing at 94°C, annealing at 58°C, and elongation at 72°C for 30 sec each, followed by one cycle at 72°C for 10 min. For restriction fragment length polymorphism analysis, 10–20 µl of the amplified 352-bp fragment was digested with 1 U of MspA1I restriction enzyme (New England Biolabs, Inc., Ipswich, MA, USA) at 37°C in a water bath for 30 min to 1 h. The T/T, T/G and G/G genotypes were distinguished by bands with lengths of 233 and 88; 233, 187 and 88 bp; and 187 and 88 bp, respectively, following electrophoresis. ..

    Synthesized:

    Article Title: Hypomorphic sialidase expression decreases serum cholesterol by downregulation of VLDL production in mice
    Article Snippet: The following primers were used for the PCR: 5′ ATC CCT GTC CAG GAA CTG GT 3′ and 5′ CTT AAG GGC ATT GGG GTC AT 3′, synthesized by Mobix facility at McMaster University. .. PCR (40 cycles) was performed with denaturing temperature at 94°C for 2 min, annealing temperature at 60°C for 30 s, and elongation temperature at 72°C for 30 s. PCR products were digested with MspA1I (New England BioLab), which serves as a genetic diagnostic as it only cleaves the PCR product carrying the B6.SM mutation.

    Electrophoresis:

    Article Title: Association between MDM2-SNP309 and p53R72P polymorphisms and the risk of bladder cancer in the Mongolian population
    Article Snippet: .. The thermal cycling conditions were 1 min at 94°C; 40 cycles of denaturing at 94°C, annealing at 58°C, and elongation at 72°C for 30 sec each, followed by one cycle at 72°C for 10 min. For restriction fragment length polymorphism analysis, 10–20 µl of the amplified 352-bp fragment was digested with 1 U of MspA1I restriction enzyme (New England Biolabs, Inc., Ipswich, MA, USA) at 37°C in a water bath for 30 min to 1 h. The T/T, T/G and G/G genotypes were distinguished by bands with lengths of 233 and 88; 233, 187 and 88 bp; and 187 and 88 bp, respectively, following electrophoresis. ..

    RFLP Assay:

    Article Title: Effects of MDM2 promoter polymorphisms and p53 codon 72 polymorphism on risk and age at onset of squamous cell carcinoma of the head and neck
    Article Snippet: MDM2 SNP309 was genotyped by the PCR- RFLP assay. .. The 352-bp PCR product was digested with MspA1 I (New England Biolabs, Beverly, MA) at 37°C overnight, The wild-type allele (TT) produced three bands of 233, 88, and 31bp; wild-type/variant allele (TG) produced 233, 187, 88, 46 and 31bp and the variant allele (GG) produced 187, 88, 46 and 31bp.

    Generated:

    Article Title: A functional polymorphism T309G in MDM2 gene promoter, intensified by Helicobacter pylori lipopolysaccharide, is associated with both an increased susceptibility and poor prognosis of gastric carcinoma in Chinese patients
    Article Snippet: In brief, the primer sequences were 5P-CGCGGGAGTTCAGGGTAAAG-3P (forward) and 5P-AGCTGGAGACAAGTCAGGACTTAAC-3P (reverse), which generated the 237-bp fragment. .. The PCR product was then digested by MSPA1I (New England Biolabs, Bevely, MA, USA).

    DNA Sequencing:

    Article Title: MDM2 Expression and Regulation in Prostate Cancer Racial Disparity
    Article Snippet: The MDM2 SNP309 genotype was determined by PCR amplification followed by restriction fragment length polymorphism (RFLP) and confirmed by DNA sequencing. .. After an enzyme activation step at 94°C for 10 min, PCR was conducted for 45 cycles at 94°C for 1 min, 56°C for 1 min, 72°C for 2 min, and was concluded with a final extension step of 72°C for 10 min. For RFLP analysis, 7 uL of the 352 bp PCR product was digested in a 20 uL reaction with 2 U of MspA1I (New England Biolabs, Ipswich, MA), 1× BSA, and 1× NEBuffer 4 (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1 mM DTT, pH 7.9) for 1 h at 37°C.

    Polymerase Chain Reaction:

    Article Title: The T309G MDM2 Gene Polymorphism Is a Novel Risk Factor for Proliferative Vitreoretinopathy
    Article Snippet: Genotyping Genotyping of the MDM2 T309G polymorphism was performed at the Molecular Medicine Unit at the University of Salamanca, (Salamanca, Spain) blinded to the clinical status of patients, using the PCR-RFLP (Polymerase Chain Reaction-Restriction Fragment Length Polymorphism) technique , . .. MDM2 intron 1 was amplified within a 155 pb DNA fragment that was digested with the restriction endonuclease MspA1I (New England Biolabs, Inc.).

    Article Title: A functional polymorphism T309G in MDM2 gene promoter, intensified by Helicobacter pylori lipopolysaccharide, is associated with both an increased susceptibility and poor prognosis of gastric carcinoma in Chinese patients
    Article Snippet: .. The PCR product was then digested by MSPA1I (New England Biolabs, Bevely, MA, USA). .. The wild-type (SNP309T) allele produces a single 237-bp fragment and the variant (SNP309G) allele produced two fragments of 189- and 48 bp.

    Article Title: Effects of MDM2 promoter polymorphisms and p53 codon 72 polymorphism on risk and age at onset of squamous cell carcinoma of the head and neck
    Article Snippet: .. The 352-bp PCR product was digested with MspA1 I (New England Biolabs, Beverly, MA) at 37°C overnight, The wild-type allele (TT) produced three bands of 233, 88, and 31bp; wild-type/variant allele (TG) produced 233, 187, 88, 46 and 31bp and the variant allele (GG) produced 187, 88, 46 and 31bp. .. PCR-RFLP was conducted and the results were evaluated without knowledge of the subjects’s case-control status.

    Article Title: Association of β2-adrenergic receptor and insulin receptor substrate-1 polymorphisms with obesity in a Northern Indian population
    Article Snippet: Genotyping for β2-AR (-20 and -47 C/T) Polymorphism A fragment of 353 bp in promoter of the β2 -AR gene was amplified by polymerase chain reaction (PCR) using primers forward 5’- GAA TGA GGC TTC CAG GCG TC-3’ and reverse 5’- GGC CCA TGA CCA GAT CAG CA-3’. .. T to C variation at promoter sites -47 and -20 create a restriction site for MspA1I and HphI (NEB) restriction enzymes respectively.

    Article Title: MDM2 Expression and Regulation in Prostate Cancer Racial Disparity
    Article Snippet: .. After an enzyme activation step at 94°C for 10 min, PCR was conducted for 45 cycles at 94°C for 1 min, 56°C for 1 min, 72°C for 2 min, and was concluded with a final extension step of 72°C for 10 min. For RFLP analysis, 7 uL of the 352 bp PCR product was digested in a 20 uL reaction with 2 U of MspA1I (New England Biolabs, Ipswich, MA), 1× BSA, and 1× NEBuffer 4 (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1 mM DTT, pH 7.9) for 1 h at 37°C. .. Digestion products were resolved on 2% agarose gels and stained with ethidium bromide.

    Article Title: Hypomorphic sialidase expression decreases serum cholesterol by downregulation of VLDL production in mice
    Article Snippet: .. PCR (40 cycles) was performed with denaturing temperature at 94°C for 2 min, annealing temperature at 60°C for 30 s, and elongation temperature at 72°C for 30 s. PCR products were digested with MspA1I (New England BioLab), which serves as a genetic diagnostic as it only cleaves the PCR product carrying the B6.SM mutation. .. Mice were housed in microisolator cages in a room with a 12 h light and dark cycle and given unlimited access to food and water.

    Article Title: Highly variable response to cytotoxic chemotherapy in carcinoma-associated fibroblasts (CAFs) from lung and breast
    Article Snippet: .. Representative PCR/RFLP patterns for the different Mdm2 genotypes: T/T homozygous uncleaved by MspA1I (lanes 1, 4, 5); heterozygous cleaved by MspA1I yielding two bands (lanes 3, 6, 7); G/G homozygous completely cleaved by MspA1I (lanes 2, 8, 9). .. Click here for file Additional file 3 Effect of neoadjuvant chemotherapy on stromal and tumor compartment in vivo .

    Article Title: Transforming growth factor ? 869C/T and interleukin 6 -174G/C polymorphisms relate to the severity and progression of bone-erosive damage detected by ultrasound in rheumatoid arthritis
    Article Snippet: .. PCR products were digested with Msp A1I (New England BioLabs, Ipswich, MA, US) and run on a 3% ethidium bromide-stained agarose gel. .. The -174G/C IL-6 promoter SNP was analyzed by PCR amplification and digestion with a site-specific restriction enzyme using previously reported methods [ ].

    Article Title: Evidence for an Epistatic Effect between TP53 R72P and MDM2 T309G SNPs in HIV Infection: A Cross-Sectional Study in Women from South Brazil
    Article Snippet: Both SNPs were genotyped by PCR-RFLP using GoTaq qPCR Master Mix (Promega, USA) (in 12 µl reactions) with primers, restriction enzymes and PCR conditionsdescribed previously – . .. For the T309G SNP, the 157 bpamplicon was cleaved by Msp A1I (New England Biolabs, MA) and loaded on 2.5% agarose gel stained with GelRed™.

    Article Title: Highly variable response to cytotoxic chemotherapy in carcinoma-associated fibroblasts (CAFs) from lung and breast
    Article Snippet: .. The PCR product was digested with 5 units of MspA1I (New England Biolabs, Frankfurt a.M., Germany) at 37°C for 16 h and electrophoresed on a 2% agarose gel stained with ethidium bromide (a representative example is shown in additional file ). .. Pathologic examination and immunohistochemistry Both, tumor and stromal cell response to neoadjuvant treatment was analyzed by comparing H & E stained tissue sections from corresponding samples before and after chemotherapy.

    Article Title: Novel CACNA1S mutation causes autosomal dominant hypokalemic periodic paralysis in a Chinese family
    Article Snippet: .. The 364-bp PCR product was digested with 1 U of Msp A1 I (New England Biolabs) at 37°C overnight. ..

    Article Title: Association between MDM2-SNP309 and p53R72P polymorphisms and the risk of bladder cancer in the Mongolian population
    Article Snippet: The PCR reactions consisted of 100 ng of genomic DNA, 0.2 µM primer, 200 µM dNTP, 1.5 mM MgCl2 , 20 mM Tris-HCl (pH 8.4), 50 mM KCl and 1 U of Platinum Taq DNA polymerase (Invitrogen; Thermo Fisher Scientific, Waltham, MA, USA). .. The thermal cycling conditions were 1 min at 94°C; 40 cycles of denaturing at 94°C, annealing at 58°C, and elongation at 72°C for 30 sec each, followed by one cycle at 72°C for 10 min. For restriction fragment length polymorphism analysis, 10–20 µl of the amplified 352-bp fragment was digested with 1 U of MspA1I restriction enzyme (New England Biolabs, Inc., Ipswich, MA, USA) at 37°C in a water bath for 30 min to 1 h. The T/T, T/G and G/G genotypes were distinguished by bands with lengths of 233 and 88; 233, 187 and 88 bp; and 187 and 88 bp, respectively, following electrophoresis.

    DNA Extraction:

    Article Title: Association between MDM2-SNP309 and p53R72P polymorphisms and the risk of bladder cancer in the Mongolian population
    Article Snippet: In brief, DNA was extracted from 200 µl of blood using the Qiagen mini blood DNA extraction kit (Qiagen, Inc., Valencia, CA, USA) and MDM2 SNP309 was amplified by polymerase chain reaction (PCR) using the following primers: Forward, 5′-CGGGAGTTCAGGGTAAAGGT-3′; and reverse, 5′-AGCAAGTCGGTGCTTACCTG-3′. .. The thermal cycling conditions were 1 min at 94°C; 40 cycles of denaturing at 94°C, annealing at 58°C, and elongation at 72°C for 30 sec each, followed by one cycle at 72°C for 10 min. For restriction fragment length polymorphism analysis, 10–20 µl of the amplified 352-bp fragment was digested with 1 U of MspA1I restriction enzyme (New England Biolabs, Inc., Ipswich, MA, USA) at 37°C in a water bath for 30 min to 1 h. The T/T, T/G and G/G genotypes were distinguished by bands with lengths of 233 and 88; 233, 187 and 88 bp; and 187 and 88 bp, respectively, following electrophoresis.

    Mutagenesis:

    Article Title: Hypomorphic sialidase expression decreases serum cholesterol by downregulation of VLDL production in mice
    Article Snippet: .. PCR (40 cycles) was performed with denaturing temperature at 94°C for 2 min, annealing temperature at 60°C for 30 s, and elongation temperature at 72°C for 30 s. PCR products were digested with MspA1I (New England BioLab), which serves as a genetic diagnostic as it only cleaves the PCR product carrying the B6.SM mutation. .. Mice were housed in microisolator cages in a room with a 12 h light and dark cycle and given unlimited access to food and water.

    Article Title: Novel CACNA1S mutation causes autosomal dominant hypokalemic periodic paralysis in a Chinese family
    Article Snippet: We PCR-amplified exon 11 containing the Arg528Gly mutation from all members of the family as well as 200 unrelated healthy Chinese individuals of Han nationality. .. The 364-bp PCR product was digested with 1 U of Msp A1 I (New England Biolabs) at 37°C overnight.

    Isolation:

    Article Title: Highly variable response to cytotoxic chemotherapy in carcinoma-associated fibroblasts (CAFs) from lung and breast
    Article Snippet: Paragraph title: Isolation, cultivation, and characterization of carcinoma-associated fibroblasts (CAFs) ... The PCR product was digested with 5 units of MspA1I (New England Biolabs, Frankfurt a.M., Germany) at 37°C for 16 h and electrophoresed on a 2% agarose gel stained with ethidium bromide (a representative example is shown in additional file ).

    Size-exclusion Chromatography:

    Article Title: Association of β2-adrenergic receptor and insulin receptor substrate-1 polymorphisms with obesity in a Northern Indian population
    Article Snippet: DNA templates were initially denatured at 95°C for three minutes, followed by 30 cycles with denaturation at 95°C for 30 sec, annealing at 60°C for 30 sec and, extension at 72°C for 45 sec and finally, an extension at 72°C for five minutes. .. T to C variation at promoter sites -47 and -20 create a restriction site for MspA1I and HphI (NEB) restriction enzymes respectively.

    Article Title: Association between MDM2-SNP309 and p53R72P polymorphisms and the risk of bladder cancer in the Mongolian population
    Article Snippet: .. The thermal cycling conditions were 1 min at 94°C; 40 cycles of denaturing at 94°C, annealing at 58°C, and elongation at 72°C for 30 sec each, followed by one cycle at 72°C for 10 min. For restriction fragment length polymorphism analysis, 10–20 µl of the amplified 352-bp fragment was digested with 1 U of MspA1I restriction enzyme (New England Biolabs, Inc., Ipswich, MA, USA) at 37°C in a water bath for 30 min to 1 h. The T/T, T/G and G/G genotypes were distinguished by bands with lengths of 233 and 88; 233, 187 and 88 bp; and 187 and 88 bp, respectively, following electrophoresis. ..

    Mouse Assay:

    Article Title: Hypomorphic sialidase expression decreases serum cholesterol by downregulation of VLDL production in mice
    Article Snippet: Paragraph title: Mice ... PCR (40 cycles) was performed with denaturing temperature at 94°C for 2 min, annealing temperature at 60°C for 30 s, and elongation temperature at 72°C for 30 s. PCR products were digested with MspA1I (New England BioLab), which serves as a genetic diagnostic as it only cleaves the PCR product carrying the B6.SM mutation.

    Sequencing:

    Article Title: Highly variable response to cytotoxic chemotherapy in carcinoma-associated fibroblasts (CAFs) from lung and breast
    Article Snippet: The following Primers were used for cDNA amplification (sense: cgtccagggagcaggtag; antisense: ccacaacaaaacaccagtgc) and sequencing (primer 1: cacatgacggaggttgtgag; primer 2: ccacaacaaaacaccagtgc). .. The PCR product was digested with 5 units of MspA1I (New England Biolabs, Frankfurt a.M., Germany) at 37°C for 16 h and electrophoresed on a 2% agarose gel stained with ethidium bromide (a representative example is shown in additional file ).

    Plasmid Preparation:

    Article Title: Evidence for an Epistatic Effect between TP53 R72P and MDM2 T309G SNPs in HIV Infection: A Cross-Sectional Study in Women from South Brazil
    Article Snippet: Chromatograms were assembled and analyzed using the ContigExpress module of the Vector NTI 10.0 suite (Invitrogen, USA). .. For the T309G SNP, the 157 bpamplicon was cleaved by Msp A1I (New England Biolabs, MA) and loaded on 2.5% agarose gel stained with GelRed™.

    Real-time Polymerase Chain Reaction:

    Article Title: Evidence for an Epistatic Effect between TP53 R72P and MDM2 T309G SNPs in HIV Infection: A Cross-Sectional Study in Women from South Brazil
    Article Snippet: Both SNPs were genotyped by PCR-RFLP using GoTaq qPCR Master Mix (Promega, USA) (in 12 µl reactions) with primers, restriction enzymes and PCR conditionsdescribed previously – . .. For the T309G SNP, the 157 bpamplicon was cleaved by Msp A1I (New England Biolabs, MA) and loaded on 2.5% agarose gel stained with GelRed™.

    Agarose Gel Electrophoresis:

    Article Title: The T309G MDM2 Gene Polymorphism Is a Novel Risk Factor for Proliferative Vitreoretinopathy
    Article Snippet: MDM2 intron 1 was amplified within a 155 pb DNA fragment that was digested with the restriction endonuclease MspA1I (New England Biolabs, Inc.). .. The resulting fragments were separated on 3.5% agarose gel ( ) and the ethidium bromide–stained fragments were analyzed under a UV source, using the Kodak Digital Science ID image analysis system.

    Article Title: Transforming growth factor ? 869C/T and interleukin 6 -174G/C polymorphisms relate to the severity and progression of bone-erosive damage detected by ultrasound in rheumatoid arthritis
    Article Snippet: .. PCR products were digested with Msp A1I (New England BioLabs, Ipswich, MA, US) and run on a 3% ethidium bromide-stained agarose gel. .. The -174G/C IL-6 promoter SNP was analyzed by PCR amplification and digestion with a site-specific restriction enzyme using previously reported methods [ ].

    Article Title: Highly variable response to cytotoxic chemotherapy in carcinoma-associated fibroblasts (CAFs) from lung and breast
    Article Snippet: .. The PCR product was digested with 5 units of MspA1I (New England Biolabs, Frankfurt a.M., Germany) at 37°C for 16 h and electrophoresed on a 2% agarose gel stained with ethidium bromide (a representative example is shown in additional file ). .. Pathologic examination and immunohistochemistry Both, tumor and stromal cell response to neoadjuvant treatment was analyzed by comparing H & E stained tissue sections from corresponding samples before and after chemotherapy.

    Ethanol Precipitation:

    Article Title: A functional polymorphism T309G in MDM2 gene promoter, intensified by Helicobacter pylori lipopolysaccharide, is associated with both an increased susceptibility and poor prognosis of gastric carcinoma in Chinese patients
    Article Snippet: Genotype analysis Genomic DNA was extracted by proteinase K digestion and followed by phenol–chloroform extraction and ethanol precipitation from a leukocyte pellet. .. The PCR product was then digested by MSPA1I (New England Biolabs, Bevely, MA, USA).

    Produced:

    Article Title: A functional polymorphism T309G in MDM2 gene promoter, intensified by Helicobacter pylori lipopolysaccharide, is associated with both an increased susceptibility and poor prognosis of gastric carcinoma in Chinese patients
    Article Snippet: The PCR product was then digested by MSPA1I (New England Biolabs, Bevely, MA, USA). .. The wild-type (SNP309T) allele produces a single 237-bp fragment and the variant (SNP309G) allele produced two fragments of 189- and 48 bp.

    Article Title: Effects of MDM2 promoter polymorphisms and p53 codon 72 polymorphism on risk and age at onset of squamous cell carcinoma of the head and neck
    Article Snippet: .. The 352-bp PCR product was digested with MspA1 I (New England Biolabs, Beverly, MA) at 37°C overnight, The wild-type allele (TT) produced three bands of 233, 88, and 31bp; wild-type/variant allele (TG) produced 233, 187, 88, 46 and 31bp and the variant allele (GG) produced 187, 88, 46 and 31bp. .. PCR-RFLP was conducted and the results were evaluated without knowledge of the subjects’s case-control status.

    Activation Assay:

    Article Title: MDM2 Expression and Regulation in Prostate Cancer Racial Disparity
    Article Snippet: .. After an enzyme activation step at 94°C for 10 min, PCR was conducted for 45 cycles at 94°C for 1 min, 56°C for 1 min, 72°C for 2 min, and was concluded with a final extension step of 72°C for 10 min. For RFLP analysis, 7 uL of the 352 bp PCR product was digested in a 20 uL reaction with 2 U of MspA1I (New England Biolabs, Ipswich, MA), 1× BSA, and 1× NEBuffer 4 (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1 mM DTT, pH 7.9) for 1 h at 37°C. .. Digestion products were resolved on 2% agarose gels and stained with ethidium bromide.

    DNA Purification:

    Article Title: Transforming growth factor ? 869C/T and interleukin 6 -174G/C polymorphisms relate to the severity and progression of bone-erosive damage detected by ultrasound in rheumatoid arthritis
    Article Snippet: Genotyping DNA was extracted from ethylenediaminetetraacetic acid-treated peripheral blood using an automated methodology (Maxwell 16; Promega, Madison, WI, USA) and dedicated kits (Maxwell 16 Blood DNA Purification Kit; Promega). .. PCR products were digested with Msp A1I (New England BioLabs, Ipswich, MA, US) and run on a 3% ethidium bromide-stained agarose gel.

    CTG Assay:

    Article Title: Hypomorphic sialidase expression decreases serum cholesterol by downregulation of VLDL production in mice
    Article Snippet: The following primers were used for the PCR: 5′ ATC CCT GTC CAG GAA CTG GT 3′ and 5′ CTT AAG GGC ATT GGG GTC AT 3′, synthesized by Mobix facility at McMaster University. .. PCR (40 cycles) was performed with denaturing temperature at 94°C for 2 min, annealing temperature at 60°C for 30 s, and elongation temperature at 72°C for 30 s. PCR products were digested with MspA1I (New England BioLab), which serves as a genetic diagnostic as it only cleaves the PCR product carrying the B6.SM mutation.

    Staining:

    Article Title: MDM2 Expression and Regulation in Prostate Cancer Racial Disparity
    Article Snippet: After an enzyme activation step at 94°C for 10 min, PCR was conducted for 45 cycles at 94°C for 1 min, 56°C for 1 min, 72°C for 2 min, and was concluded with a final extension step of 72°C for 10 min. For RFLP analysis, 7 uL of the 352 bp PCR product was digested in a 20 uL reaction with 2 U of MspA1I (New England Biolabs, Ipswich, MA), 1× BSA, and 1× NEBuffer 4 (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1 mM DTT, pH 7.9) for 1 h at 37°C. .. Digestion products were resolved on 2% agarose gels and stained with ethidium bromide.

    Article Title: Evidence for an Epistatic Effect between TP53 R72P and MDM2 T309G SNPs in HIV Infection: A Cross-Sectional Study in Women from South Brazil
    Article Snippet: .. For the T309G SNP, the 157 bpamplicon was cleaved by Msp A1I (New England Biolabs, MA) and loaded on 2.5% agarose gel stained with GelRed™. ..

    Article Title: Highly variable response to cytotoxic chemotherapy in carcinoma-associated fibroblasts (CAFs) from lung and breast
    Article Snippet: .. The PCR product was digested with 5 units of MspA1I (New England Biolabs, Frankfurt a.M., Germany) at 37°C for 16 h and electrophoresed on a 2% agarose gel stained with ethidium bromide (a representative example is shown in additional file ). .. Pathologic examination and immunohistochemistry Both, tumor and stromal cell response to neoadjuvant treatment was analyzed by comparing H & E stained tissue sections from corresponding samples before and after chemotherapy.

    Variant Assay:

    Article Title: A functional polymorphism T309G in MDM2 gene promoter, intensified by Helicobacter pylori lipopolysaccharide, is associated with both an increased susceptibility and poor prognosis of gastric carcinoma in Chinese patients
    Article Snippet: The PCR product was then digested by MSPA1I (New England Biolabs, Bevely, MA, USA). .. The wild-type (SNP309T) allele produces a single 237-bp fragment and the variant (SNP309G) allele produced two fragments of 189- and 48 bp.

    Article Title: Effects of MDM2 promoter polymorphisms and p53 codon 72 polymorphism on risk and age at onset of squamous cell carcinoma of the head and neck
    Article Snippet: .. The 352-bp PCR product was digested with MspA1 I (New England Biolabs, Beverly, MA) at 37°C overnight, The wild-type allele (TT) produced three bands of 233, 88, and 31bp; wild-type/variant allele (TG) produced 233, 187, 88, 46 and 31bp and the variant allele (GG) produced 187, 88, 46 and 31bp. .. PCR-RFLP was conducted and the results were evaluated without knowledge of the subjects’s case-control status.

    Article Title: Association between MDM2-SNP309 and p53R72P polymorphisms and the risk of bladder cancer in the Mongolian population
    Article Snippet: The thermal cycling conditions were 1 min at 94°C; 40 cycles of denaturing at 94°C, annealing at 58°C, and elongation at 72°C for 30 sec each, followed by one cycle at 72°C for 10 min. For restriction fragment length polymorphism analysis, 10–20 µl of the amplified 352-bp fragment was digested with 1 U of MspA1I restriction enzyme (New England Biolabs, Inc., Ipswich, MA, USA) at 37°C in a water bath for 30 min to 1 h. The T/T, T/G and G/G genotypes were distinguished by bands with lengths of 233 and 88; 233, 187 and 88 bp; and 187 and 88 bp, respectively, following electrophoresis. .. The length of the PCR product was 166 bp, then it was digested with BstU1 at 60°C for 1 h. The digestion of the P/P variant yielded a 166-bp band, the R/R variant yielded 135- and 31-bp bands and the P/R heterozygous variant yielded 166, 135 and 31 bp bands.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs restriction endonuclease mspa1i
    PCR-RFLP to determine MDM 2 SNP309 polymorphism. MDM 2 SNP309 T allele is not cleaved by <t>MspA1I</t> endonuclease and generates a single fragment of 155 bp. The MDM 2 SNP309 G allele is cleaved by MspA1I and generates two small fragments of 101 and 54 bp. The MDM 2 SNP309 heterozygote displays three fragments of 155, 101 and 54 bp.
    Restriction Endonuclease Mspa1i, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction endonuclease mspa1i/product/New England Biolabs
    Average 90 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    restriction endonuclease mspa1i - by Bioz Stars, 2020-03
    90/100 stars
      Buy from Supplier

    Image Search Results


    PCR-RFLP to determine MDM 2 SNP309 polymorphism. MDM 2 SNP309 T allele is not cleaved by MspA1I endonuclease and generates a single fragment of 155 bp. The MDM 2 SNP309 G allele is cleaved by MspA1I and generates two small fragments of 101 and 54 bp. The MDM 2 SNP309 heterozygote displays three fragments of 155, 101 and 54 bp.

    Journal: PLoS ONE

    Article Title: The T309G MDM2 Gene Polymorphism Is a Novel Risk Factor for Proliferative Vitreoretinopathy

    doi: 10.1371/journal.pone.0082283

    Figure Lengend Snippet: PCR-RFLP to determine MDM 2 SNP309 polymorphism. MDM 2 SNP309 T allele is not cleaved by MspA1I endonuclease and generates a single fragment of 155 bp. The MDM 2 SNP309 G allele is cleaved by MspA1I and generates two small fragments of 101 and 54 bp. The MDM 2 SNP309 heterozygote displays three fragments of 155, 101 and 54 bp.

    Article Snippet: MDM2 intron 1 was amplified within a 155 pb DNA fragment that was digested with the restriction endonuclease MspA1I (New England Biolabs, Inc.).

    Techniques: Polymerase Chain Reaction