bsrgi  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    BsrGI
    Description:
    BsrGI 5 000 units
    Catalog Number:
    R0575L
    Price:
    277
    Size:
    5 000 units
    Category:
    Restriction Enzymes
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs bsrgi
    BsrGI
    BsrGI 5 000 units
    https://www.bioz.com/result/bsrgi/product/New England Biolabs
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    bsrgi - by Bioz Stars, 2019-12
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: High-Throughput System for the Presentation of Secreted and Surface-Exposed Proteins from Gram-Positive Bacteria in Functional Metagenomics Studies
    Article Snippet: The amplification products were cloned in pDONR223 (Invitrogen) by site-specific recombination between the att B1.1 and att B2.1 sites and the att P1 and att P2 sites, respectively, present on the plasmid, in vitro, using BP clonase II (Invitrogen) according to the recommendations of the supplier, followed by transformation of OneShotR TOP10 chemically competent E. coli (Invitrogen) with selection for spectinomycin (this E. coli strain allowing the counter selection of pDONR223 without insert). .. The presence of inserts in pDONR223 and pDG148-GW was verified by digestion with Bsr GI and Eco RI (New England Biolabs), respectively, and PCR amplifications using the pDONR223-specific primers 5′-CCCAGTCACGACGTTGTAAAACG and 5′-GTAACATCAGAGATTTTGAGACAC .

    Article Title: Dimerization is required for GARS-mediated neurotoxicity in dominant CMT disease
    Article Snippet: The T209K GRS1 /pDONR221 entry clone was recombined into a Gateway-compatible LEU2 -bearing pRS315 destination vector. .. Resulting clones were purified and digested with Bsr GI (New England Biolabs, Ipswich, MA, USA) to confirm recombination. .. The Δ grs1 haploid yeast strain [harboring a pRS316 maintenance vector to express wild-type GRS1 and URA3 ( ) was transformed with wild-type or mutant GRS1 in a LEU2 -bearing pRS315 vector and selected on medium lacking uracil and leucine (Teknova, Hollister, CA, USA).

    Article Title: Directional cDNA library construction assisted by the in vitro recombination reaction
    Article Snippet: The resultant plasmid, attB-pBluescript, was used as a template for preparation of a DNA fragment containing multiple cloning sites (MCS). .. MCS, Tet and βGal thus obtained were digested with Bsr GI (New England BioLabs), which cleaves at the TGTACA sequence within the common 15 bp core region of each att sequence, leaving four-base 5′ overhangs.

    Article Title: Haplotype-specific modulation of a SOX10/CREB response element at the Charcot–Marie–Tooth disease type 4C locus SH3TC2
    Article Snippet: Subsequent to PCR amplification and purification, each genomic segment was cloned into the pDONR221 vector using BP Clonase (Invitrogen). .. Resulting constructs were genotyped by digestion with Bsr GI (New England Biolabs) and subjected to DNA sequence analysis to ensure sequence specificity.

    Article Title: Vika/vox, a novel efficient and specific Cre/loxP-like site-specific recombination system
    Article Snippet: Analysis of the simulation and the image rendering was done using Tachyon software in visual molecular dynamics ( ). .. The Vika coding sequence was synthesized (GeneArt, Life Technologies Corporation) and cloned via BsrGI and XbaI New England Biolabs (NEB) into pEVO vectors as described previously ( ). .. Two of the recombination sites, loxP , rox , VloxP or vox , were inserted into the pEVO vector, producing pEVO-loxP , pEVO-rox , pEVO-VloxP and pEVO-vox .

    Article Title: Discovery of Nigri/nox and Panto/pox site-specific recombinase systems facilitates advanced genome engineering
    Article Snippet: Single clones containing pEVO plasmid with the recombinase and recombination target sites were cultured overnight in 3 ml LB medium with 25 μg/ml Cm and 100 μg/ml L-(+)-arabinose at 37 °C and 200 rpm. .. Plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany) and recombination efficiency was evaluated by agarose gel electrophoresis after digestion with BsrGI (NEB, Ipswich, MA, USA).

    Article Title: Role for the αV Integrin Subunit in Varicella-Zoster Virus-Mediated Fusion and Infection
    Article Snippet: The PCR fragments were separated on a 1% agarose gel, purified by gel extraction (Qiagen), and digested with restriction enzyme, BsrGI (New England BioLabs). .. TOP10 (Invitrogen) electrocompetent cells were transformed with the ligated products and plated on LB agar plates supplemented with ampicillin (100 μg/ml; Sigma) and Zeocin (25 μg/ml; Invitrogen) antibiotics.

    Article Title: Increased Na+/Ca2+ Exchanger Activity Promotes Resistance to Excitotoxicity in Cortical Neurons of the Ground Squirrel (a Hibernator)
    Article Snippet: Paragraph title: NCX cloning, plasmid preparation, cell transfection and determination of cell viability ... PrimeSTAR Max DNA Polymerase (Takara Biotechnology (Dalian) Co., Ltd., Dalian, China) was used to amplify the cDNA template according to the following PCR protocol: 35 cycles of 98°C for 10 s, 55–60°C for 15 s and 72°C for 20 s. Nucleotide sequence encoding for 2A peptide from porcine teschovirus-1 (P2A; GCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ) were synthesized by Ruibio Tech (Beijing, China), and annealed before they were inserted into a modified version of pFUGW ( ; courtesy of Prof. Zhang from Peking University) at the BsrGI/BamHI (restriction endonucleases from NEB, Beverly, MA, USA) sites; this construct was termed pFUGW-P2A when mentioned.

    Article Title: Design and Screening of a Glial Cell-Specific, Cell Penetrating Peptide for Therapeutic Applications in Multiple Sclerosis
    Article Snippet: To construct the pET-EGFP-TD2.2 protein expression vector (for , and ), DNA inserts of EGFP and TD2.2 were amplified by PCR with complimentary NcoI (N-terminal), BsrGI (middle) and XhoI (C-terminal) restriction endonuclease digest sites (NEB Biolabs, Australia; ). .. DNA inserts were ligated to pGEM-T cloning vectors before DNA sequencing.

    Amplification:

    Article Title: High-Throughput System for the Presentation of Secreted and Surface-Exposed Proteins from Gram-Positive Bacteria in Functional Metagenomics Studies
    Article Snippet: The amplification products were cloned in pDONR223 (Invitrogen) by site-specific recombination between the att B1.1 and att B2.1 sites and the att P1 and att P2 sites, respectively, present on the plasmid, in vitro, using BP clonase II (Invitrogen) according to the recommendations of the supplier, followed by transformation of OneShotR TOP10 chemically competent E. coli (Invitrogen) with selection for spectinomycin (this E. coli strain allowing the counter selection of pDONR223 without insert). .. The presence of inserts in pDONR223 and pDG148-GW was verified by digestion with Bsr GI and Eco RI (New England Biolabs), respectively, and PCR amplifications using the pDONR223-specific primers 5′-CCCAGTCACGACGTTGTAAAACG and 5′-GTAACATCAGAGATTTTGAGACAC .

    Article Title: Directional cDNA library construction assisted by the in vitro recombination reaction
    Article Snippet: DNA fragments containing the tetracycline-resistance gene (Tet) and beta-galactosidase gene (βGal) were amplified from control plasmids included in the field test kit provided by Life Technologies using the same set of PCR primers. .. MCS, Tet and βGal thus obtained were digested with Bsr GI (New England BioLabs), which cleaves at the TGTACA sequence within the common 15 bp core region of each att sequence, leaving four-base 5′ overhangs.

    Article Title: Haplotype-specific modulation of a SOX10/CREB response element at the Charcot–Marie–Tooth disease type 4C locus SH3TC2
    Article Snippet: Subsequent to PCR amplification and purification, each genomic segment was cloned into the pDONR221 vector using BP Clonase (Invitrogen). .. Resulting constructs were genotyped by digestion with Bsr GI (New England Biolabs) and subjected to DNA sequence analysis to ensure sequence specificity.

    Article Title: Role of interleukin-21 and interleukin-21 receptor polymorphisms in the treatment of HBeAg-positive chronic hepatitis B patients with peginterferon
    Article Snippet: A 236-bp PCR fragment including the IL-21 rs2221903 polymorphism was amplified using the primers: 5’-GGTACCTGGACACTGACGCCCA-3’ (upstream) and 5’-AAGGCAGTTTAGTGGCGACAGCC-3’ (downstream), a 222-bp PCR fragment including the IL-21 rs907715 polymorphism was amplified using the primers: 5’-CAATGGCTTGGTGTTTGGTAT-3’ (upstream), and 5’-CCTCTTTTCACTTGGA GCATTC-3’ (downstream), a 229-bp PCR fragment including the IL-21R rs2285452 polymorphism was amplified using the primers: 5’-CTGGGCTGTGATGTGA AGAC-3’ (upstream) and 5’-TGGCAGGTGATAAGGAACAA-3’ (downstream), and a 183-bp PCR fragment including the IL-21R rs3093301 polymorphism was amplified using the primers: 5’-CCCTCCCTCTTTCTTTGTTAG-3’ (upstream) and 5’-TCCTCCTACCTCGGCCTCTCAAAGTG-3’ (downstream). .. The products were digested with restriction enzyme HpyCH4 V, MobII, MluI, BsrGI (New England Biolabs) at 37°C for 2 hours, and analyzed on a 8% polyacrylamide gel electrophoresis.

    Article Title: Cystathionine ?-lyase: clinical, metabolic, genetic, and structural studies
    Article Snippet: For the c.589C > T (p.Arg197Cys) mutation in exon 6, control samples were PCR amplified and digested using HaeII (New England Biolabs, Pickering, ON, Canada) in NEB buffer 4. .. For the c.932C > T (p.Thr311Ile) mutation in exon 9, control samples were digested with BsrGI (New England Biolabs, Pickering, ON, Canada) in NEB buffer 2, and for the c.200C > T (Thr67Ile) mutation in exon 2 samples were PCR amplified and digested using BfaI (New England Biolabs, Pickering, ON, Canada) in NEB buffer 4. .. Mutations in exons 2 and 6 were analyzed by electrophoresis on 2.5% agarose, while exon 9 was analyzed on 8% polyacrylamide.

    Article Title: Pharmacogenetic characterization of naturally occurring germline NT5C1A variants to chemotherapeutic nucleoside analogs
    Article Snippet: WT and variant myc-NT5C1A cDNAs were amplified by PCR with primers containing attB sites on the 5’ and 3’ ends and transferred using Invitrogen's Gateway® system and BP/LR II recombinase enzymes into pDONR221 vectors and ultimately into the pLenti6.3 destination vector. .. Vector recombination was confirmed based on BsrgI (New England Biolabs, Ipswich, Massachusetts, USA) restriction digest and by Sanger sequencing.

    Article Title: Role for the αV Integrin Subunit in Varicella-Zoster Virus-Mediated Fusion and Infection
    Article Snippet: Briefly, the DSP1 and DSP2 genes were amplified by PCR (AccuPrime Taq; Invitrogen) from pH-RL-CMV-R8(1-8) and pH-RL-CMV-R8(9-11) using primers [P]R8(1-8)-pGIPZ, BsrG1(1-8)-pGIPZ, [P]R8(9-11)-pGIPZ, and BsrG1(9-11)-pGIPZ ( ). .. The PCR fragments were separated on a 1% agarose gel, purified by gel extraction (Qiagen), and digested with restriction enzyme, BsrGI (New England BioLabs).

    Article Title: Stepwise Assembly of Fibrinogen Is Assisted by the Endoplasmic Reticulum Lectin-Chaperone System in HepG2 Cells
    Article Snippet: cDNA of ERp57 was obtained from reverse-transcribed mRNA isolated from HepG2 cells using the primer 5′-GGTTTTCCATCTCTGATGGA-3′ and amplified by PCR using the primers 5′-GCCCGCCTCGTGTACACCTCCGACGTGC-3′ and 5′-GTGTTTGGCTTGTACATTAGAGATCCTCCTGTG-3′ . .. The obtained cDNA was digested with BsrGI (New England BioLabs Inc) and subcloned into a pECFP-ER vector (Clontech).

    Article Title: Design and Screening of a Glial Cell-Specific, Cell Penetrating Peptide for Therapeutic Applications in Multiple Sclerosis
    Article Snippet: Histidine-tagged TD1, TD2, TD1.1, TD2.1 and TD2.2 recombinant proteins were induced and purified as outlined below. .. To construct the pET-EGFP-TD2.2 protein expression vector (for , and ), DNA inserts of EGFP and TD2.2 were amplified by PCR with complimentary NcoI (N-terminal), BsrGI (middle) and XhoI (C-terminal) restriction endonuclease digest sites (NEB Biolabs, Australia; ). .. DNA inserts were ligated to pGEM-T cloning vectors before DNA sequencing.

    Reporter Assay:

    Article Title: Discovery of Nigri/nox and Panto/pox site-specific recombinase systems facilitates advanced genome engineering
    Article Snippet: Plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany) and recombination efficiency was evaluated by agarose gel electrophoresis after digestion with BsrGI (NEB, Ipswich, MA, USA). .. To generate point mutations in the Cre coding sequence, site-directed mutagenesis was performed using the Q5 Site-Directed Mutagenesis Kit (NEB, Ipswich, MA, USA) following the manufacture’s instructions. pEVO plasmids carrying loxP , or rox sites and the respective recombinase mutants were grown without (assay on loxP ), or in the presence of 1 mg/ml L-arabinose (assay on rox ), respectively.

    Resection Assay:

    Article Title: MCL-1 Depletion Impairs DNA Double-Strand Break Repair and Reinitiation of Stalled DNA Replication Forks
    Article Snippet: Paragraph title: Quantitative resection assay using ER-AsiSI system. ... Sixty microliters of genomic DNA sample was digested with 60 U of restriction enzyme BsrGI (New England BioLabs) or mock digested at 37°C overnight, and 3-μl quantities of mock- or BsrGI-digested samples were used as templates in quantitative PCRs (qPCRs) with 20-μl mixtures.

    Article Title: MOF Suppresses Replication Stress and Contributes to Resolution of Stalled Replication Forks
    Article Snippet: Paragraph title: Quantitative resection assay using the ER-AsiSI system. ... Sixty microliters of genomic DNA sample was digested with 60 U of restriction enzyme BsrGI (New England BioLabs) or mock digested at 37°C overnight, and 3-μl quantities of mock- or BsrGI-digested samples were used as templates in quantitative PCRs (qPCRs) with 20-μl mixtures.

    Stable Transfection:

    Article Title: Stepwise Assembly of Fibrinogen Is Assisted by the Endoplasmic Reticulum Lectin-Chaperone System in HepG2 Cells
    Article Snippet: Paragraph title: Construction of Cyan Fluorescent Protein (CFP)-ERp57 Stably Overexpressing HepG2 Cells ... The obtained cDNA was digested with BsrGI (New England BioLabs Inc) and subcloned into a pECFP-ER vector (Clontech).

    Synthesized:

    Article Title: Vika/vox, a novel efficient and specific Cre/loxP-like site-specific recombination system
    Article Snippet: Analysis of the simulation and the image rendering was done using Tachyon software in visual molecular dynamics ( ). .. The Vika coding sequence was synthesized (GeneArt, Life Technologies Corporation) and cloned via BsrGI and XbaI New England Biolabs (NEB) into pEVO vectors as described previously ( ). .. Two of the recombination sites, loxP , rox , VloxP or vox , were inserted into the pEVO vector, producing pEVO-loxP , pEVO-rox , pEVO-VloxP and pEVO-vox .

    Article Title: Increased Na+/Ca2+ Exchanger Activity Promotes Resistance to Excitotoxicity in Cortical Neurons of the Ground Squirrel (a Hibernator)
    Article Snippet: The primers for ground squirrel NCXs were designed according to the sequence data of squirrel on Ensembl (Ensembl version: ENSSTOG00000025770.1, ENSSTOG00000020165.1, ENSSTOG00000003907.2). .. PrimeSTAR Max DNA Polymerase (Takara Biotechnology (Dalian) Co., Ltd., Dalian, China) was used to amplify the cDNA template according to the following PCR protocol: 35 cycles of 98°C for 10 s, 55–60°C for 15 s and 72°C for 20 s. Nucleotide sequence encoding for 2A peptide from porcine teschovirus-1 (P2A; GCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ) were synthesized by Ruibio Tech (Beijing, China), and annealed before they were inserted into a modified version of pFUGW ( ; courtesy of Prof. Zhang from Peking University) at the BsrGI/BamHI (restriction endonucleases from NEB, Beverly, MA, USA) sites; this construct was termed pFUGW-P2A when mentioned. .. NCX cDNAs were cloned into pFUGW-P2A at the NheI/BamHI sites.

    Construct:

    Article Title: Haplotype-specific modulation of a SOX10/CREB response element at the Charcot–Marie–Tooth disease type 4C locus SH3TC2
    Article Snippet: Subsequent to PCR amplification and purification, each genomic segment was cloned into the pDONR221 vector using BP Clonase (Invitrogen). .. Resulting constructs were genotyped by digestion with Bsr GI (New England Biolabs) and subjected to DNA sequence analysis to ensure sequence specificity. .. Each resulting pDONR221 construct was recombined with a destination vector harboring a minimal promoter directing a luciferase reporter gene (pE1B-luciferase) ( ) using LR Clonase (Invitrogen).

    Article Title: Vika/vox, a novel efficient and specific Cre/loxP-like site-specific recombination system
    Article Snippet: The Vika coding sequence was synthesized (GeneArt, Life Technologies Corporation) and cloned via BsrGI and XbaI New England Biolabs (NEB) into pEVO vectors as described previously ( ). .. Two of the recombination sites, loxP , rox , VloxP or vox , were inserted into the pEVO vector, producing pEVO-loxP , pEVO-rox , pEVO-VloxP and pEVO-vox .

    Article Title: Deregulation of Rb-E2F1 Axis Causes Chromosomal Instability by Engaging the Transactivation Function of Cdc20–Anaphase-Promoting Complex/Cyclosome
    Article Snippet: Paragraph title: Plasmids and siRNA constructs. ... The pmCherry-F plasmid was made by replacing the GFP fragment from the pEGFP-F plasmid (Clontech) with the mCherry fragment from the pmCherry-C1 vector (Clontech), using the restriction enzymes NheI and BsrGI (New England BioLabs, Beverly, MA).

    Article Title: Increased Na+/Ca2+ Exchanger Activity Promotes Resistance to Excitotoxicity in Cortical Neurons of the Ground Squirrel (a Hibernator)
    Article Snippet: The primers for ground squirrel NCXs were designed according to the sequence data of squirrel on Ensembl (Ensembl version: ENSSTOG00000025770.1, ENSSTOG00000020165.1, ENSSTOG00000003907.2). .. PrimeSTAR Max DNA Polymerase (Takara Biotechnology (Dalian) Co., Ltd., Dalian, China) was used to amplify the cDNA template according to the following PCR protocol: 35 cycles of 98°C for 10 s, 55–60°C for 15 s and 72°C for 20 s. Nucleotide sequence encoding for 2A peptide from porcine teschovirus-1 (P2A; GCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ) were synthesized by Ruibio Tech (Beijing, China), and annealed before they were inserted into a modified version of pFUGW ( ; courtesy of Prof. Zhang from Peking University) at the BsrGI/BamHI (restriction endonucleases from NEB, Beverly, MA, USA) sites; this construct was termed pFUGW-P2A when mentioned. .. NCX cDNAs were cloned into pFUGW-P2A at the NheI/BamHI sites.

    Article Title: Design and Screening of a Glial Cell-Specific, Cell Penetrating Peptide for Therapeutic Applications in Multiple Sclerosis
    Article Snippet: Histidine-tagged TD1, TD2, TD1.1, TD2.1 and TD2.2 recombinant proteins were induced and purified as outlined below. .. To construct the pET-EGFP-TD2.2 protein expression vector (for , and ), DNA inserts of EGFP and TD2.2 were amplified by PCR with complimentary NcoI (N-terminal), BsrGI (middle) and XhoI (C-terminal) restriction endonuclease digest sites (NEB Biolabs, Australia; ). .. DNA inserts were ligated to pGEM-T cloning vectors before DNA sequencing.

    End-sequence Profiling:

    Article Title: MCL-1 Depletion Impairs DNA Double-Strand Break Repair and Reinitiation of Stalled DNA Replication Forks
    Article Snippet: The agar ball was serially treated with 1 ml of EDTA-sarcosine-proteinase K (ESP) buffer (0.5 M EDTA, 2% N -lauroylsarcosine, 1 mg/ml of proteinase K, and 1 mM CaCl2 [pH 8.0]) and high-salt (HS) buffer (1.85 M NaCl, 0.15 M KCl, 5 mM MgCl2 , 2 mM EDTA, 4 mM Tris, and 0.5% Triton X-100 [pH 7.5]) for 20 h each time at 16°C with rotation, followed by washing with 1 ml of phosphate buffer (8 mM Na2 HPO4 , 1.5 mM KH2 PO4 , 133 mM KCl, and 0.8 mM MgCl2 [pH 7.4]) for 1 h at 4°C with rotation. .. Sixty microliters of genomic DNA sample was digested with 60 U of restriction enzyme BsrGI (New England BioLabs) or mock digested at 37°C overnight, and 3-μl quantities of mock- or BsrGI-digested samples were used as templates in quantitative PCRs (qPCRs) with 20-μl mixtures.

    Article Title: MOF Suppresses Replication Stress and Contributes to Resolution of Stalled Replication Forks
    Article Snippet: The agar ball was serially treated with 1 ml of EDTA-sarcosine-proteinase K (ESP) buffer (0.5 M EDTA, 2% N -lauroylsarcosine, 1 mg/ml of proteinase K, and 1 mM CaCl2 [pH 8.0]) and high-salt (HS) buffer (1.85 M NaCl, 0.15 M KCl, 5 mM MgCl2 , 2 mM EDTA, 4 mM Tris, and 0.5% Triton X-100 [pH 7.5]) for 20 h each time at 16°C with rotation, followed by washing with 1 ml of phosphate buffer (8 mM Na2 HPO4 , 1.5 mM KH2 PO4 , 133 mM KCl, and 0.8 mM MgCl2 [pH 7.4]) for 1 h at 4°C with rotation. .. Sixty microliters of genomic DNA sample was digested with 60 U of restriction enzyme BsrGI (New England BioLabs) or mock digested at 37°C overnight, and 3-μl quantities of mock- or BsrGI-digested samples were used as templates in quantitative PCRs (qPCRs) with 20-μl mixtures.

    Incubation:

    Article Title: Dimerization is required for GARS-mediated neurotoxicity in dominant CMT disease
    Article Snippet: Resulting clones were purified and digested with Bsr GI (New England Biolabs, Ipswich, MA, USA) to confirm recombination. .. The Δ grs1 haploid yeast strain [harboring a pRS316 maintenance vector to express wild-type GRS1 and URA3 ( ) was transformed with wild-type or mutant GRS1 in a LEU2 -bearing pRS315 vector and selected on medium lacking uracil and leucine (Teknova, Hollister, CA, USA).

    Article Title: Construction and high-throughput phenotypic screening of Zymoseptoria tritici over-expression strains
    Article Snippet: Reactions were incubated at 25 °C for 24 h then treated with Proteinase K (Invitrogen, UK) following the manufacturer’s instructions. .. In order to confirm recombination of the ccd B gene with the gene of interest, plasmids were digested with Bsr GI (NEB, UK), and digest reactions analyzed by gel electrophoresis.

    Article Title: MOF Suppresses Replication Stress and Contributes to Resolution of Stalled Replication Forks
    Article Snippet: The ER-AsiSI U2OS cells were incubated with tamoxifen (300 ng/ml) for 3 h and then mixed with 0.6% low-melting-temperature agarose in PBS at a concentration of 6 × 106 cells per ml. .. Sixty microliters of genomic DNA sample was digested with 60 U of restriction enzyme BsrGI (New England BioLabs) or mock digested at 37°C overnight, and 3-μl quantities of mock- or BsrGI-digested samples were used as templates in quantitative PCRs (qPCRs) with 20-μl mixtures.

    Article Title:
    Article Snippet: Nuclear extracts (100 µ g) prepared from HepG2 cells transfected with empty vector or cFos expression vector were incubated with 50 ng linearized CYP2C9 plasmid (containing −3077 to +1 of the CYP2C9 promoter) at room temperature for 45 minutes. .. After overnight ethanol precipitation at −20°C, complexes were digested with 10 U BsrGI (New England Biolabs, Ipswich, MA) at 37°C for 2 hours.

    Luciferase:

    Article Title: Haplotype-specific modulation of a SOX10/CREB response element at the Charcot–Marie–Tooth disease type 4C locus SH3TC2
    Article Snippet: Resulting constructs were genotyped by digestion with Bsr GI (New England Biolabs) and subjected to DNA sequence analysis to ensure sequence specificity. .. Each resulting pDONR221 construct was recombined with a destination vector harboring a minimal promoter directing a luciferase reporter gene (pE1B-luciferase) ( ) using LR Clonase (Invitrogen).

    Introduce:

    Article Title: Haplotype-specific modulation of a SOX10/CREB response element at the Charcot–Marie–Tooth disease type 4C locus SH3TC2
    Article Snippet: Resulting constructs were genotyped by digestion with Bsr GI (New England Biolabs) and subjected to DNA sequence analysis to ensure sequence specificity. .. Site-directed mutagenesis reactions were performed using the QuikChange II Mutagenesis Kit (Agilent Technologies) and appropriate mutation-bearing primers ( ).

    Expressing:

    Article Title: A Systematic Screen for Transcriptional Regulators of the Yeast Cell Cycle
    Article Snippet: We replaced the wild-type sequence with the custom-synthesized sequence as follows: pMW104 and the Cel-Tek fragment were digested with Nru I and Sph I (New England Biolabs), gel purified, and ligated together to create pMW113, which is identical to pMW104, with the exception of the three threonine-to-alanine mutations. pMW100, pMW104, and pMW113 were transformed into the relevant homozygous diploid deletion or wild-type parental strain, either Δ sfg1 or BY4743. .. To create an empty vector as a control for expression profiling experiments with the PGAL1 - SFG1 overexpression strain, we obtained the MORF- HIS5 plasmid from the MORF yeast ORF collection at Open Biosystems and digested the plasmid with Bsr GI (New England Biolabs) to remove the only the ORF. .. The empty vector was gel purified and closed by ligation, creating the empty plasmid pMW102.

    Article Title: Haplotype-specific modulation of a SOX10/CREB response element at the Charcot–Marie–Tooth disease type 4C locus SH3TC2
    Article Snippet: Paragraph title: Expression vector construction ... Resulting constructs were genotyped by digestion with Bsr GI (New England Biolabs) and subjected to DNA sequence analysis to ensure sequence specificity.

    Article Title:
    Article Snippet: Nuclear extracts (100 µ g) prepared from HepG2 cells transfected with empty vector or cFos expression vector were incubated with 50 ng linearized CYP2C9 plasmid (containing −3077 to +1 of the CYP2C9 promoter) at room temperature for 45 minutes. .. After overnight ethanol precipitation at −20°C, complexes were digested with 10 U BsrGI (New England Biolabs, Ipswich, MA) at 37°C for 2 hours.

    Article Title: Vika/vox, a novel efficient and specific Cre/loxP-like site-specific recombination system
    Article Snippet: Paragraph title: Construction of expression plasmids ... The Vika coding sequence was synthesized (GeneArt, Life Technologies Corporation) and cloned via BsrGI and XbaI New England Biolabs (NEB) into pEVO vectors as described previously ( ).

    Article Title: Discovery of Nigri/nox and Panto/pox site-specific recombinase systems facilitates advanced genome engineering
    Article Snippet: To compare the recombination efficiency of the tyrosine recombinases Cre, Vika, Dre, VCre, Nigri and Panto on their native target sites loxP, vox, rox, VloxP, nox and pox , respectively, recombinase expression was induced with increasing concentrations of L-(+)-arabinose (0, 1, 10 or 100 μg/ml medium) overnight in 3 ml culture volume. .. Plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany) and recombination efficiency was evaluated by agarose gel electrophoresis after digestion with BsrGI (NEB, Ipswich, MA, USA).

    Article Title: Deregulation of Rb-E2F1 Axis Causes Chromosomal Instability by Engaging the Transactivation Function of Cdc20–Anaphase-Promoting Complex/Cyclosome
    Article Snippet: The plasmid expressing the DNA binding domain mutant of E2F1 (pCMV-HA-ER-E2F1 DBD) and its wild-type counterpart (pCMV-HA-ER-E2F1) were kindly provided by Peggy Farnham (University of Southern California, Los Angeles, CA). .. The pmCherry-F plasmid was made by replacing the GFP fragment from the pEGFP-F plasmid (Clontech) with the mCherry fragment from the pmCherry-C1 vector (Clontech), using the restriction enzymes NheI and BsrGI (New England BioLabs, Beverly, MA).

    Article Title: Stepwise Assembly of Fibrinogen Is Assisted by the Endoplasmic Reticulum Lectin-Chaperone System in HepG2 Cells
    Article Snippet: The obtained cDNA was digested with BsrGI (New England BioLabs Inc) and subcloned into a pECFP-ER vector (Clontech). .. HepG2 cells were infected with retrovirus recovered from the media of packaging cells , .

    Article Title: Design and Screening of a Glial Cell-Specific, Cell Penetrating Peptide for Therapeutic Applications in Multiple Sclerosis
    Article Snippet: Histidine-tagged TD1, TD2, TD1.1, TD2.1 and TD2.2 recombinant proteins were induced and purified as outlined below. .. To construct the pET-EGFP-TD2.2 protein expression vector (for , and ), DNA inserts of EGFP and TD2.2 were amplified by PCR with complimentary NcoI (N-terminal), BsrGI (middle) and XhoI (C-terminal) restriction endonuclease digest sites (NEB Biolabs, Australia; ). .. DNA inserts were ligated to pGEM-T cloning vectors before DNA sequencing.

    Modification:

    Article Title: Discovery of Nigri/nox and Panto/pox site-specific recombinase systems facilitates advanced genome engineering
    Article Snippet: Plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany) and recombination efficiency was evaluated by agarose gel electrophoresis after digestion with BsrGI (NEB, Ipswich, MA, USA). .. To generate point mutations in the Cre coding sequence, site-directed mutagenesis was performed using the Q5 Site-Directed Mutagenesis Kit (NEB, Ipswich, MA, USA) following the manufacture’s instructions. pEVO plasmids carrying loxP , or rox sites and the respective recombinase mutants were grown without (assay on loxP ), or in the presence of 1 mg/ml L-arabinose (assay on rox ), respectively.

    Article Title: Increased Na+/Ca2+ Exchanger Activity Promotes Resistance to Excitotoxicity in Cortical Neurons of the Ground Squirrel (a Hibernator)
    Article Snippet: The primers for ground squirrel NCXs were designed according to the sequence data of squirrel on Ensembl (Ensembl version: ENSSTOG00000025770.1, ENSSTOG00000020165.1, ENSSTOG00000003907.2). .. PrimeSTAR Max DNA Polymerase (Takara Biotechnology (Dalian) Co., Ltd., Dalian, China) was used to amplify the cDNA template according to the following PCR protocol: 35 cycles of 98°C for 10 s, 55–60°C for 15 s and 72°C for 20 s. Nucleotide sequence encoding for 2A peptide from porcine teschovirus-1 (P2A; GCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ) were synthesized by Ruibio Tech (Beijing, China), and annealed before they were inserted into a modified version of pFUGW ( ; courtesy of Prof. Zhang from Peking University) at the BsrGI/BamHI (restriction endonucleases from NEB, Beverly, MA, USA) sites; this construct was termed pFUGW-P2A when mentioned. .. NCX cDNAs were cloned into pFUGW-P2A at the NheI/BamHI sites.

    Transformation Assay:

    Article Title: High-Throughput System for the Presentation of Secreted and Surface-Exposed Proteins from Gram-Positive Bacteria in Functional Metagenomics Studies
    Article Snippet: After each transformation, transformant colonies were pooled and plasmids extracted using a QIAprep Spin Miniprep Kit (Qiagen). .. The presence of inserts in pDONR223 and pDG148-GW was verified by digestion with Bsr GI and Eco RI (New England Biolabs), respectively, and PCR amplifications using the pDONR223-specific primers 5′-CCCAGTCACGACGTTGTAAAACG and 5′-GTAACATCAGAGATTTTGAGACAC .

    Article Title: A Systematic Screen for Transcriptional Regulators of the Yeast Cell Cycle
    Article Snippet: We replaced the wild-type sequence with the custom-synthesized sequence as follows: pMW104 and the Cel-Tek fragment were digested with Nru I and Sph I (New England Biolabs), gel purified, and ligated together to create pMW113, which is identical to pMW104, with the exception of the three threonine-to-alanine mutations. pMW100, pMW104, and pMW113 were transformed into the relevant homozygous diploid deletion or wild-type parental strain, either Δ sfg1 or BY4743. .. To create an empty vector as a control for expression profiling experiments with the PGAL1 - SFG1 overexpression strain, we obtained the MORF- HIS5 plasmid from the MORF yeast ORF collection at Open Biosystems and digested the plasmid with Bsr GI (New England Biolabs) to remove the only the ORF.

    Article Title: Construction and high-throughput phenotypic screening of Zymoseptoria tritici over-expression strains
    Article Snippet: E . coli strain DH5α was transformed with 5 μl of each reaction mixture. .. In order to confirm recombination of the ccd B gene with the gene of interest, plasmids were digested with Bsr GI (NEB, UK), and digest reactions analyzed by gel electrophoresis.

    Article Title: Role for the αV Integrin Subunit in Varicella-Zoster Virus-Mediated Fusion and Infection
    Article Snippet: The PCR fragments were separated on a 1% agarose gel, purified by gel extraction (Qiagen), and digested with restriction enzyme, BsrGI (New England BioLabs). .. The products were then ligated (T4 ligase; Invitrogen) with an XbaI (New England BioLabs)-digested PCR fragment amplified from the pGIPZ vector using primers pGIPZ_XbaI and pGIPZ_5CMV and a BsrG1- and XbaI-digested pGIPZ vector.

    Over Expression:

    Article Title: A Systematic Screen for Transcriptional Regulators of the Yeast Cell Cycle
    Article Snippet: We replaced the wild-type sequence with the custom-synthesized sequence as follows: pMW104 and the Cel-Tek fragment were digested with Nru I and Sph I (New England Biolabs), gel purified, and ligated together to create pMW113, which is identical to pMW104, with the exception of the three threonine-to-alanine mutations. pMW100, pMW104, and pMW113 were transformed into the relevant homozygous diploid deletion or wild-type parental strain, either Δ sfg1 or BY4743. .. To create an empty vector as a control for expression profiling experiments with the PGAL1 - SFG1 overexpression strain, we obtained the MORF- HIS5 plasmid from the MORF yeast ORF collection at Open Biosystems and digested the plasmid with Bsr GI (New England Biolabs) to remove the only the ORF. .. The empty vector was gel purified and closed by ligation, creating the empty plasmid pMW102.

    Transfection:

    Article Title:
    Article Snippet: Nuclear extracts (100 µ g) prepared from HepG2 cells transfected with empty vector or cFos expression vector were incubated with 50 ng linearized CYP2C9 plasmid (containing −3077 to +1 of the CYP2C9 promoter) at room temperature for 45 minutes. .. After overnight ethanol precipitation at −20°C, complexes were digested with 10 U BsrGI (New England Biolabs, Ipswich, MA) at 37°C for 2 hours.

    Article Title: Increased Na+/Ca2+ Exchanger Activity Promotes Resistance to Excitotoxicity in Cortical Neurons of the Ground Squirrel (a Hibernator)
    Article Snippet: Paragraph title: NCX cloning, plasmid preparation, cell transfection and determination of cell viability ... PrimeSTAR Max DNA Polymerase (Takara Biotechnology (Dalian) Co., Ltd., Dalian, China) was used to amplify the cDNA template according to the following PCR protocol: 35 cycles of 98°C for 10 s, 55–60°C for 15 s and 72°C for 20 s. Nucleotide sequence encoding for 2A peptide from porcine teschovirus-1 (P2A; GCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ) were synthesized by Ruibio Tech (Beijing, China), and annealed before they were inserted into a modified version of pFUGW ( ; courtesy of Prof. Zhang from Peking University) at the BsrGI/BamHI (restriction endonucleases from NEB, Beverly, MA, USA) sites; this construct was termed pFUGW-P2A when mentioned.

    Southern Blot:

    Article Title: The Sialidases of Clostridium perfringens Type D Strain CN3718 Differ in Their Properties and Sensitivities to Inhibitors
    Article Snippet: Paragraph title: DNA isolation and Southern blot analysis of the mutant strains. ... A 3-μg aliquot of each isolated DNA in Tris-EDTA (TE) buffer (Epicenter) was digested overnight with BsrGI at 37°C according to the manufacturer's instructions (New England BioLabs).

    Ligation:

    Article Title:
    Article Snippet: After overnight ethanol precipitation at −20°C, complexes were digested with 10 U BsrGI (New England Biolabs, Ipswich, MA) at 37°C for 2 hours. .. BsrGI enzyme activity was inactivated by incubation at 80°C for 20 minutes.

    Article Title: Design and Screening of a Glial Cell-Specific, Cell Penetrating Peptide for Therapeutic Applications in Multiple Sclerosis
    Article Snippet: To construct the pET-EGFP-TD2.2 protein expression vector (for , and ), DNA inserts of EGFP and TD2.2 were amplified by PCR with complimentary NcoI (N-terminal), BsrGI (middle) and XhoI (C-terminal) restriction endonuclease digest sites (NEB Biolabs, Australia; ). .. DNA inserts were ligated to pGEM-T cloning vectors before DNA sequencing.

    Infection:

    Article Title: Stepwise Assembly of Fibrinogen Is Assisted by the Endoplasmic Reticulum Lectin-Chaperone System in HepG2 Cells
    Article Snippet: The obtained cDNA was digested with BsrGI (New England BioLabs Inc) and subcloned into a pECFP-ER vector (Clontech). .. DNA fragments containing the CFP-ERp57 region were inserted into the pCX4-bsr vector, and the packaging cell (Phoenix Amp) was transfected with the vector.

    Hemagglutination Assay:

    Article Title: A Systematic Screen for Transcriptional Regulators of the Yeast Cell Cycle
    Article Snippet: The final product, pMW104, is a CEN plasmid that produces HA-tagged Sfg1 from its native promoter. .. To create an empty vector as a control for expression profiling experiments with the PGAL1 - SFG1 overexpression strain, we obtained the MORF- HIS5 plasmid from the MORF yeast ORF collection at Open Biosystems and digested the plasmid with Bsr GI (New England Biolabs) to remove the only the ORF.

    Generated:

    Article Title: Role for the αV Integrin Subunit in Varicella-Zoster Virus-Mediated Fusion and Infection
    Article Snippet: pGIPZ-DSP1 and pGIPZ-DSP2 vectors were generated by subcloning the R8(1-8) (DSP1) and R8(9-11) (DSP2) cassettes from a pair of phRL-CMV vectors that expressed the DSP proteins (gift from Zene Matsuda, University of Tokyo, Tokyo, Japan) ( ). .. The PCR fragments were separated on a 1% agarose gel, purified by gel extraction (Qiagen), and digested with restriction enzyme, BsrGI (New England BioLabs).

    Article Title: Design and Screening of a Glial Cell-Specific, Cell Penetrating Peptide for Therapeutic Applications in Multiple Sclerosis
    Article Snippet: To construct the pET-EGFP-TD2.2 protein expression vector (for , and ), DNA inserts of EGFP and TD2.2 were amplified by PCR with complimentary NcoI (N-terminal), BsrGI (middle) and XhoI (C-terminal) restriction endonuclease digest sites (NEB Biolabs, Australia; ). .. Clones with confirmed inserts underwent subsequent digestion before dual ligation to pET28-c ( ).

    DNA Sequencing:

    Article Title: Design and Screening of a Glial Cell-Specific, Cell Penetrating Peptide for Therapeutic Applications in Multiple Sclerosis
    Article Snippet: To construct the pET-EGFP-TD2.2 protein expression vector (for , and ), DNA inserts of EGFP and TD2.2 were amplified by PCR with complimentary NcoI (N-terminal), BsrGI (middle) and XhoI (C-terminal) restriction endonuclease digest sites (NEB Biolabs, Australia; ). .. Clones with confirmed inserts underwent subsequent digestion before dual ligation to pET28-c ( ).

    Sequencing:

    Article Title: A Systematic Screen for Transcriptional Regulators of the Yeast Cell Cycle
    Article Snippet: We replaced the wild-type sequence with the custom-synthesized sequence as follows: pMW104 and the Cel-Tek fragment were digested with Nru I and Sph I (New England Biolabs), gel purified, and ligated together to create pMW113, which is identical to pMW104, with the exception of the three threonine-to-alanine mutations. pMW100, pMW104, and pMW113 were transformed into the relevant homozygous diploid deletion or wild-type parental strain, either Δ sfg1 or BY4743. .. To create an empty vector as a control for expression profiling experiments with the PGAL1 - SFG1 overexpression strain, we obtained the MORF- HIS5 plasmid from the MORF yeast ORF collection at Open Biosystems and digested the plasmid with Bsr GI (New England Biolabs) to remove the only the ORF.

    Article Title: Directional cDNA library construction assisted by the in vitro recombination reaction
    Article Snippet: DNA fragments containing the tetracycline-resistance gene (Tet) and beta-galactosidase gene (βGal) were amplified from control plasmids included in the field test kit provided by Life Technologies using the same set of PCR primers. .. MCS, Tet and βGal thus obtained were digested with Bsr GI (New England BioLabs), which cleaves at the TGTACA sequence within the common 15 bp core region of each att sequence, leaving four-base 5′ overhangs. .. The products with or without Bsr GI digestion were finally purified using the Concert Rapid PCR Purification System (Life Technologies) and then used for LC or RC, respectively.

    Article Title: Haplotype-specific modulation of a SOX10/CREB response element at the Charcot–Marie–Tooth disease type 4C locus SH3TC2
    Article Snippet: Subsequent to PCR amplification and purification, each genomic segment was cloned into the pDONR221 vector using BP Clonase (Invitrogen). .. Resulting constructs were genotyped by digestion with Bsr GI (New England Biolabs) and subjected to DNA sequence analysis to ensure sequence specificity. .. Each resulting pDONR221 construct was recombined with a destination vector harboring a minimal promoter directing a luciferase reporter gene (pE1B-luciferase) ( ) using LR Clonase (Invitrogen).

    Article Title: Cystathionine ?-lyase: clinical, metabolic, genetic, and structural studies
    Article Snippet: DNA sequences were aligned with ABI Sequence Navigator software. .. For the c.932C > T (p.Thr311Ile) mutation in exon 9, control samples were digested with BsrGI (New England Biolabs, Pickering, ON, Canada) in NEB buffer 2, and for the c.200C > T (Thr67Ile) mutation in exon 2 samples were PCR amplified and digested using BfaI (New England Biolabs, Pickering, ON, Canada) in NEB buffer 4.

    Article Title: Pharmacogenetic characterization of naturally occurring germline NT5C1A variants to chemotherapeutic nucleoside analogs
    Article Snippet: WT and variant myc-NT5C1A cDNAs were amplified by PCR with primers containing attB sites on the 5’ and 3’ ends and transferred using Invitrogen's Gateway® system and BP/LR II recombinase enzymes into pDONR221 vectors and ultimately into the pLenti6.3 destination vector. .. Vector recombination was confirmed based on BsrgI (New England Biolabs, Ipswich, Massachusetts, USA) restriction digest and by Sanger sequencing. .. HEK293 cells grown in IDMEM (Invitrogen, Carlsbad, California, USA) and 10% FBS (Thermo Scientific, Waltham, Massachusetts, USA) were transfected with pLenti-6.3-myc-NT51A WT or variant vectors, pDM2D, and pΔ874 (4ug DNA total) using Lipofectamine 2000 (Invitrogen) and Opti-MEM (Invitrogen).

    Article Title: Vika/vox, a novel efficient and specific Cre/loxP-like site-specific recombination system
    Article Snippet: Analysis of the simulation and the image rendering was done using Tachyon software in visual molecular dynamics ( ). .. The Vika coding sequence was synthesized (GeneArt, Life Technologies Corporation) and cloned via BsrGI and XbaI New England Biolabs (NEB) into pEVO vectors as described previously ( ). .. Two of the recombination sites, loxP , rox , VloxP or vox , were inserted into the pEVO vector, producing pEVO-loxP , pEVO-rox , pEVO-VloxP and pEVO-vox .

    Article Title: Discovery of Nigri/nox and Panto/pox site-specific recombinase systems facilitates advanced genome engineering
    Article Snippet: Plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany) and recombination efficiency was evaluated by agarose gel electrophoresis after digestion with BsrGI (NEB, Ipswich, MA, USA). .. The plasmid co-integration assay was performed as described previously , with plasmids carrying the respective target sites and recombinase genes.

    Article Title: Role for the αV Integrin Subunit in Varicella-Zoster Virus-Mediated Fusion and Infection
    Article Snippet: The PCR fragments were separated on a 1% agarose gel, purified by gel extraction (Qiagen), and digested with restriction enzyme, BsrGI (New England BioLabs). .. TOP10 (Invitrogen) electrocompetent cells were transformed with the ligated products and plated on LB agar plates supplemented with ampicillin (100 μg/ml; Sigma) and Zeocin (25 μg/ml; Invitrogen) antibiotics.

    Article Title: Increased Na+/Ca2+ Exchanger Activity Promotes Resistance to Excitotoxicity in Cortical Neurons of the Ground Squirrel (a Hibernator)
    Article Snippet: The primers for ground squirrel NCXs were designed according to the sequence data of squirrel on Ensembl (Ensembl version: ENSSTOG00000025770.1, ENSSTOG00000020165.1, ENSSTOG00000003907.2). .. PrimeSTAR Max DNA Polymerase (Takara Biotechnology (Dalian) Co., Ltd., Dalian, China) was used to amplify the cDNA template according to the following PCR protocol: 35 cycles of 98°C for 10 s, 55–60°C for 15 s and 72°C for 20 s. Nucleotide sequence encoding for 2A peptide from porcine teschovirus-1 (P2A; GCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ) were synthesized by Ruibio Tech (Beijing, China), and annealed before they were inserted into a modified version of pFUGW ( ; courtesy of Prof. Zhang from Peking University) at the BsrGI/BamHI (restriction endonucleases from NEB, Beverly, MA, USA) sites; this construct was termed pFUGW-P2A when mentioned. .. NCX cDNAs were cloned into pFUGW-P2A at the NheI/BamHI sites.

    Binding Assay:

    Article Title: Deregulation of Rb-E2F1 Axis Causes Chromosomal Instability by Engaging the Transactivation Function of Cdc20–Anaphase-Promoting Complex/Cyclosome
    Article Snippet: The plasmid expressing the DNA binding domain mutant of E2F1 (pCMV-HA-ER-E2F1 DBD) and its wild-type counterpart (pCMV-HA-ER-E2F1) were kindly provided by Peggy Farnham (University of Southern California, Los Angeles, CA). .. The pmCherry-F plasmid was made by replacing the GFP fragment from the pEGFP-F plasmid (Clontech) with the mCherry fragment from the pmCherry-C1 vector (Clontech), using the restriction enzymes NheI and BsrGI (New England BioLabs, Beverly, MA).

    DNA Extraction:

    Article Title: The Sialidases of Clostridium perfringens Type D Strain CN3718 Differ in Their Properties and Sensitivities to Inhibitors
    Article Snippet: Paragraph title: DNA isolation and Southern blot analysis of the mutant strains. ... A 3-μg aliquot of each isolated DNA in Tris-EDTA (TE) buffer (Epicenter) was digested overnight with BsrGI at 37°C according to the manufacturer's instructions (New England BioLabs).

    Nucleic Acid Electrophoresis:

    Article Title: Construction and high-throughput phenotypic screening of Zymoseptoria tritici over-expression strains
    Article Snippet: Colonies were grown over-night in LB medium with selection, and plasmids extracted using Plasmid Mini Kit (Qiagen, UK). .. In order to confirm recombination of the ccd B gene with the gene of interest, plasmids were digested with Bsr GI (NEB, UK), and digest reactions analyzed by gel electrophoresis. .. Putative Gateway®Entry vectors were Sanger Sequenced (Eurofins, UK) using primer GOXF (tcgcgttaacgctagcatgga).

    In Vivo:

    Article Title:
    Article Snippet: Paragraph title: In Vitro and In Vivo 3C Assays. ... After overnight ethanol precipitation at −20°C, complexes were digested with 10 U BsrGI (New England Biolabs, Ipswich, MA) at 37°C for 2 hours.

    Fluorescence:

    Article Title: Increased Na+/Ca2+ Exchanger Activity Promotes Resistance to Excitotoxicity in Cortical Neurons of the Ground Squirrel (a Hibernator)
    Article Snippet: PrimeSTAR Max DNA Polymerase (Takara Biotechnology (Dalian) Co., Ltd., Dalian, China) was used to amplify the cDNA template according to the following PCR protocol: 35 cycles of 98°C for 10 s, 55–60°C for 15 s and 72°C for 20 s. Nucleotide sequence encoding for 2A peptide from porcine teschovirus-1 (P2A; GCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ) were synthesized by Ruibio Tech (Beijing, China), and annealed before they were inserted into a modified version of pFUGW ( ; courtesy of Prof. Zhang from Peking University) at the BsrGI/BamHI (restriction endonucleases from NEB, Beverly, MA, USA) sites; this construct was termed pFUGW-P2A when mentioned. .. Neuronal viability was determined by assessing cell and nucleus morphology after staining with 0.4 µg/ml Hoechst 33342 (Sigma) for 10 min at 37°C.

    Mutagenesis:

    Article Title: Dimerization is required for GARS-mediated neurotoxicity in dominant CMT disease
    Article Snippet: Resulting clones were purified and digested with Bsr GI (New England Biolabs, Ipswich, MA, USA) to confirm recombination. .. Resulting clones were purified and digested with Bsr GI (New England Biolabs, Ipswich, MA, USA) to confirm recombination.

    Article Title: Haplotype-specific modulation of a SOX10/CREB response element at the Charcot–Marie–Tooth disease type 4C locus SH3TC2
    Article Snippet: Resulting constructs were genotyped by digestion with Bsr GI (New England Biolabs) and subjected to DNA sequence analysis to ensure sequence specificity. .. Resulting constructs were genotyped by digestion with Bsr GI (New England Biolabs) and subjected to DNA sequence analysis to ensure sequence specificity.

    Article Title: Cystathionine ?-lyase: clinical, metabolic, genetic, and structural studies
    Article Snippet: For the c.589C > T (p.Arg197Cys) mutation in exon 6, control samples were PCR amplified and digested using HaeII (New England Biolabs, Pickering, ON, Canada) in NEB buffer 4. .. For the c.932C > T (p.Thr311Ile) mutation in exon 9, control samples were digested with BsrGI (New England Biolabs, Pickering, ON, Canada) in NEB buffer 2, and for the c.200C > T (Thr67Ile) mutation in exon 2 samples were PCR amplified and digested using BfaI (New England Biolabs, Pickering, ON, Canada) in NEB buffer 4. .. Mutations in exons 2 and 6 were analyzed by electrophoresis on 2.5% agarose, while exon 9 was analyzed on 8% polyacrylamide.

    Article Title: Pharmacogenetic characterization of naturally occurring germline NT5C1A variants to chemotherapeutic nucleoside analogs
    Article Snippet: A myc-NT5C1A wild-type (WT) cDNA sequence underwent site directed mutagenesis to create 11 different mutations using the QuikChange Lightning kit (Agilent Technologies, Santa Clara, California, USA) and primers (Sigma-Genosys, Woodlands, Texas, USA). .. Vector recombination was confirmed based on BsrgI (New England Biolabs, Ipswich, Massachusetts, USA) restriction digest and by Sanger sequencing.

    Article Title: Vika/vox, a novel efficient and specific Cre/loxP-like site-specific recombination system
    Article Snippet: The Vika coding sequence was synthesized (GeneArt, Life Technologies Corporation) and cloned via BsrGI and XbaI New England Biolabs (NEB) into pEVO vectors as described previously ( ). .. Two of the recombination sites, loxP , rox , VloxP or vox , were inserted into the pEVO vector, producing pEVO-loxP , pEVO-rox , pEVO-VloxP and pEVO-vox .

    Article Title: Discovery of Nigri/nox and Panto/pox site-specific recombinase systems facilitates advanced genome engineering
    Article Snippet: Plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany) and recombination efficiency was evaluated by agarose gel electrophoresis after digestion with BsrGI (NEB, Ipswich, MA, USA). .. The plasmid co-integration assay was performed as described previously , with plasmids carrying the respective target sites and recombinase genes.

    Article Title: Deregulation of Rb-E2F1 Axis Causes Chromosomal Instability by Engaging the Transactivation Function of Cdc20–Anaphase-Promoting Complex/Cyclosome
    Article Snippet: The plasmid expressing the DNA binding domain mutant of E2F1 (pCMV-HA-ER-E2F1 DBD) and its wild-type counterpart (pCMV-HA-ER-E2F1) were kindly provided by Peggy Farnham (University of Southern California, Los Angeles, CA). .. The pmCherry-F plasmid was made by replacing the GFP fragment from the pEGFP-F plasmid (Clontech) with the mCherry fragment from the pmCherry-C1 vector (Clontech), using the restriction enzymes NheI and BsrGI (New England BioLabs, Beverly, MA).

    Article Title: The Sialidases of Clostridium perfringens Type D Strain CN3718 Differ in Their Properties and Sensitivities to Inhibitors
    Article Snippet: Paragraph title: DNA isolation and Southern blot analysis of the mutant strains. ... A 3-μg aliquot of each isolated DNA in Tris-EDTA (TE) buffer (Epicenter) was digested overnight with BsrGI at 37°C according to the manufacturer's instructions (New England BioLabs).

    Isolation:

    Article Title: Dimerization is required for GARS-mediated neurotoxicity in dominant CMT disease
    Article Snippet: Resulting clones were purified and digested with Bsr GI (New England Biolabs, Ipswich, MA, USA) to confirm recombination. .. Resulting clones were purified and digested with Bsr GI (New England Biolabs, Ipswich, MA, USA) to confirm recombination.

    Article Title: Discovery of Nigri/nox and Panto/pox site-specific recombinase systems facilitates advanced genome engineering
    Article Snippet: To compare the recombination efficiency of the tyrosine recombinases Cre, Vika, Dre, VCre, Nigri and Panto on their native target sites loxP, vox, rox, VloxP, nox and pox , respectively, recombinase expression was induced with increasing concentrations of L-(+)-arabinose (0, 1, 10 or 100 μg/ml medium) overnight in 3 ml culture volume. .. Plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany) and recombination efficiency was evaluated by agarose gel electrophoresis after digestion with BsrGI (NEB, Ipswich, MA, USA). .. Quantification of recombination efficiency was performed by measuring the band intensities using ImageJ software applying the Gel analysis feature.

    Article Title: Stepwise Assembly of Fibrinogen Is Assisted by the Endoplasmic Reticulum Lectin-Chaperone System in HepG2 Cells
    Article Snippet: cDNA of ERp57 was obtained from reverse-transcribed mRNA isolated from HepG2 cells using the primer 5′-GGTTTTCCATCTCTGATGGA-3′ and amplified by PCR using the primers 5′-GCCCGCCTCGTGTACACCTCCGACGTGC-3′ and 5′-GTGTTTGGCTTGTACATTAGAGATCCTCCTGTG-3′ . .. The obtained cDNA was digested with BsrGI (New England BioLabs Inc) and subcloned into a pECFP-ER vector (Clontech).

    Article Title: The Sialidases of Clostridium perfringens Type D Strain CN3718 Differ in Their Properties and Sensitivities to Inhibitors
    Article Snippet: DNA was isolated from wild-type CN3718 or the ENanJ, ENanI, ENanH, and BMC205 mutants, using the MasterPure Gram Positive DNA Purification kit (Epicenter). .. A 3-μg aliquot of each isolated DNA in Tris-EDTA (TE) buffer (Epicenter) was digested overnight with BsrGI at 37°C according to the manufacturer's instructions (New England BioLabs). .. The digested DNA samples were then electrophoresed on a 1% agarose gel and transferred onto a positively charged nylon membrane (Roche) for hybridization with the digoxigenin (DIG)-labeled intron sequence-specific probe, which was prepared using the Roche DIG-labeled kit as earlier described ( ).

    Subcloning:

    Article Title: Role for the αV Integrin Subunit in Varicella-Zoster Virus-Mediated Fusion and Infection
    Article Snippet: pGIPZ-DSP1 and pGIPZ-DSP2 vectors were generated by subcloning the R8(1-8) (DSP1) and R8(9-11) (DSP2) cassettes from a pair of phRL-CMV vectors that expressed the DSP proteins (gift from Zene Matsuda, University of Tokyo, Tokyo, Japan) ( ). .. The PCR fragments were separated on a 1% agarose gel, purified by gel extraction (Qiagen), and digested with restriction enzyme, BsrGI (New England BioLabs).

    Microscopy:

    Article Title: Increased Na+/Ca2+ Exchanger Activity Promotes Resistance to Excitotoxicity in Cortical Neurons of the Ground Squirrel (a Hibernator)
    Article Snippet: PrimeSTAR Max DNA Polymerase (Takara Biotechnology (Dalian) Co., Ltd., Dalian, China) was used to amplify the cDNA template according to the following PCR protocol: 35 cycles of 98°C for 10 s, 55–60°C for 15 s and 72°C for 20 s. Nucleotide sequence encoding for 2A peptide from porcine teschovirus-1 (P2A; GCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ) were synthesized by Ruibio Tech (Beijing, China), and annealed before they were inserted into a modified version of pFUGW ( ; courtesy of Prof. Zhang from Peking University) at the BsrGI/BamHI (restriction endonucleases from NEB, Beverly, MA, USA) sites; this construct was termed pFUGW-P2A when mentioned. .. Neuronal viability was determined by assessing cell and nucleus morphology after staining with 0.4 µg/ml Hoechst 33342 (Sigma) for 10 min at 37°C.

    Purification:

    Article Title: Dimerization is required for GARS-mediated neurotoxicity in dominant CMT disease
    Article Snippet: The T209K GRS1 /pDONR221 entry clone was recombined into a Gateway-compatible LEU2 -bearing pRS315 destination vector. .. Resulting clones were purified and digested with Bsr GI (New England Biolabs, Ipswich, MA, USA) to confirm recombination. .. The Δ grs1 haploid yeast strain [harboring a pRS316 maintenance vector to express wild-type GRS1 and URA3 ( ) was transformed with wild-type or mutant GRS1 in a LEU2 -bearing pRS315 vector and selected on medium lacking uracil and leucine (Teknova, Hollister, CA, USA).

    Article Title: A Systematic Screen for Transcriptional Regulators of the Yeast Cell Cycle
    Article Snippet: We replaced the wild-type sequence with the custom-synthesized sequence as follows: pMW104 and the Cel-Tek fragment were digested with Nru I and Sph I (New England Biolabs), gel purified, and ligated together to create pMW113, which is identical to pMW104, with the exception of the three threonine-to-alanine mutations. pMW100, pMW104, and pMW113 were transformed into the relevant homozygous diploid deletion or wild-type parental strain, either Δ sfg1 or BY4743. .. To create an empty vector as a control for expression profiling experiments with the PGAL1 - SFG1 overexpression strain, we obtained the MORF- HIS5 plasmid from the MORF yeast ORF collection at Open Biosystems and digested the plasmid with Bsr GI (New England Biolabs) to remove the only the ORF.

    Article Title: Directional cDNA library construction assisted by the in vitro recombination reaction
    Article Snippet: MCS, Tet and βGal thus obtained were digested with Bsr GI (New England BioLabs), which cleaves at the TGTACA sequence within the common 15 bp core region of each att sequence, leaving four-base 5′ overhangs. .. To prepare a vector for LC, attR-pSP73 plasmid was digested with Bsr GI and dephosphorylated with bacterial alkaline phosphatase.

    Article Title: Haplotype-specific modulation of a SOX10/CREB response element at the Charcot–Marie–Tooth disease type 4C locus SH3TC2
    Article Snippet: Subsequent to PCR amplification and purification, each genomic segment was cloned into the pDONR221 vector using BP Clonase (Invitrogen). .. Resulting constructs were genotyped by digestion with Bsr GI (New England Biolabs) and subjected to DNA sequence analysis to ensure sequence specificity.

    Article Title: Construction and high-throughput phenotypic screening of Zymoseptoria tritici over-expression strains
    Article Snippet: For construction of Gateway®Entry vectors, 150 ng of pDONR207 was mixed with 2.5 μl of purified PCR product, 1 μl of Gateway® BP Clonase™ with TE buffer added to a total volume of 10 μl. .. In order to confirm recombination of the ccd B gene with the gene of interest, plasmids were digested with Bsr GI (NEB, UK), and digest reactions analyzed by gel electrophoresis.

    Article Title: Cystathionine ?-lyase: clinical, metabolic, genetic, and structural studies
    Article Snippet: Purified PCR fragments were directly sequenced in both directions on an ABI 3730 Automated DNA Sequencer (Applied Biosystems, Mississauga, ON, Canada). .. For the c.932C > T (p.Thr311Ile) mutation in exon 9, control samples were digested with BsrGI (New England Biolabs, Pickering, ON, Canada) in NEB buffer 2, and for the c.200C > T (Thr67Ile) mutation in exon 2 samples were PCR amplified and digested using BfaI (New England Biolabs, Pickering, ON, Canada) in NEB buffer 4.

    Article Title: Role for the αV Integrin Subunit in Varicella-Zoster Virus-Mediated Fusion and Infection
    Article Snippet: Briefly, the DSP1 and DSP2 genes were amplified by PCR (AccuPrime Taq; Invitrogen) from pH-RL-CMV-R8(1-8) and pH-RL-CMV-R8(9-11) using primers [P]R8(1-8)-pGIPZ, BsrG1(1-8)-pGIPZ, [P]R8(9-11)-pGIPZ, and BsrG1(9-11)-pGIPZ ( ). .. The PCR fragments were separated on a 1% agarose gel, purified by gel extraction (Qiagen), and digested with restriction enzyme, BsrGI (New England BioLabs). .. The products were then ligated (T4 ligase; Invitrogen) with an XbaI (New England BioLabs)-digested PCR fragment amplified from the pGIPZ vector using primers pGIPZ_XbaI and pGIPZ_5CMV and a BsrG1- and XbaI-digested pGIPZ vector.

    Article Title: Increased Na+/Ca2+ Exchanger Activity Promotes Resistance to Excitotoxicity in Cortical Neurons of the Ground Squirrel (a Hibernator)
    Article Snippet: The purified RNA was reverse transcribed into cDNA with oligo (dT) 15 primers. .. PrimeSTAR Max DNA Polymerase (Takara Biotechnology (Dalian) Co., Ltd., Dalian, China) was used to amplify the cDNA template according to the following PCR protocol: 35 cycles of 98°C for 10 s, 55–60°C for 15 s and 72°C for 20 s. Nucleotide sequence encoding for 2A peptide from porcine teschovirus-1 (P2A; GCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ) were synthesized by Ruibio Tech (Beijing, China), and annealed before they were inserted into a modified version of pFUGW ( ; courtesy of Prof. Zhang from Peking University) at the BsrGI/BamHI (restriction endonucleases from NEB, Beverly, MA, USA) sites; this construct was termed pFUGW-P2A when mentioned.

    Polymerase Chain Reaction:

    Article Title: High-Throughput System for the Presentation of Secreted and Surface-Exposed Proteins from Gram-Positive Bacteria in Functional Metagenomics Studies
    Article Snippet: After each transformation, transformant colonies were pooled and plasmids extracted using a QIAprep Spin Miniprep Kit (Qiagen). .. The presence of inserts in pDONR223 and pDG148-GW was verified by digestion with Bsr GI and Eco RI (New England Biolabs), respectively, and PCR amplifications using the pDONR223-specific primers 5′-CCCAGTCACGACGTTGTAAAACG and 5′-GTAACATCAGAGATTTTGAGACAC . .. The plasmid pool obtained after LR recombination and transformation was used to transform chemically competent E. coli TG1, in order to generate multimeric plasmids suitable for transformation of competent B. subtilis .

    Article Title: A Systematic Screen for Transcriptional Regulators of the Yeast Cell Cycle
    Article Snippet: The resulting PCR product and pMW100 were digested with Not I and Sal I (New England Biolabs), gel purified, and ligated together. .. To create an empty vector as a control for expression profiling experiments with the PGAL1 - SFG1 overexpression strain, we obtained the MORF- HIS5 plasmid from the MORF yeast ORF collection at Open Biosystems and digested the plasmid with Bsr GI (New England Biolabs) to remove the only the ORF.

    Article Title: Directional cDNA library construction assisted by the in vitro recombination reaction
    Article Snippet: DNA fragments containing the tetracycline-resistance gene (Tet) and beta-galactosidase gene (βGal) were amplified from control plasmids included in the field test kit provided by Life Technologies using the same set of PCR primers. .. MCS, Tet and βGal thus obtained were digested with Bsr GI (New England BioLabs), which cleaves at the TGTACA sequence within the common 15 bp core region of each att sequence, leaving four-base 5′ overhangs.

    Article Title: Haplotype-specific modulation of a SOX10/CREB response element at the Charcot–Marie–Tooth disease type 4C locus SH3TC2
    Article Snippet: Subsequent to PCR amplification and purification, each genomic segment was cloned into the pDONR221 vector using BP Clonase (Invitrogen). .. Resulting constructs were genotyped by digestion with Bsr GI (New England Biolabs) and subjected to DNA sequence analysis to ensure sequence specificity.

    Article Title: Construction and high-throughput phenotypic screening of Zymoseptoria tritici over-expression strains
    Article Snippet: For construction of Gateway®Entry vectors, 150 ng of pDONR207 was mixed with 2.5 μl of purified PCR product, 1 μl of Gateway® BP Clonase™ with TE buffer added to a total volume of 10 μl. .. In order to confirm recombination of the ccd B gene with the gene of interest, plasmids were digested with Bsr GI (NEB, UK), and digest reactions analyzed by gel electrophoresis.

    Article Title: Role of interleukin-21 and interleukin-21 receptor polymorphisms in the treatment of HBeAg-positive chronic hepatitis B patients with peginterferon
    Article Snippet: PCR was carried out in a volume of 20 μL containing 3.0 μL DNA, 1.0 μL of each primer, 12.5 μL 2∗Taq PCR MasterMix (TianGen Biotech Co. Ltd, Beijing, China) and 7.5 μL ddH2 O. PCR was carried out with initial denaturation for 3 minutes at 94°C, followed by 30 (IL-21 rs907715 and rs2221903) or 35 (IL-21R rs2285452 and rs3093301) cycles of denaturation for 30 seconds at 94°C, annealing for 30 seconds at 60°C (IL-21 rs2221903), 55°C (IL-21 rs907715), 56°C (IL-21R rs3093301 and rs2285452), extension for 30 seconds at 72°C, and a final extension for 10 minutes at 72°C. .. The products were digested with restriction enzyme HpyCH4 V, MobII, MluI, BsrGI (New England Biolabs) at 37°C for 2 hours, and analyzed on a 8% polyacrylamide gel electrophoresis.

    Article Title: Cystathionine ?-lyase: clinical, metabolic, genetic, and structural studies
    Article Snippet: For the c.589C > T (p.Arg197Cys) mutation in exon 6, control samples were PCR amplified and digested using HaeII (New England Biolabs, Pickering, ON, Canada) in NEB buffer 4. .. For the c.932C > T (p.Thr311Ile) mutation in exon 9, control samples were digested with BsrGI (New England Biolabs, Pickering, ON, Canada) in NEB buffer 2, and for the c.200C > T (Thr67Ile) mutation in exon 2 samples were PCR amplified and digested using BfaI (New England Biolabs, Pickering, ON, Canada) in NEB buffer 4. .. Mutations in exons 2 and 6 were analyzed by electrophoresis on 2.5% agarose, while exon 9 was analyzed on 8% polyacrylamide.

    Article Title: Pharmacogenetic characterization of naturally occurring germline NT5C1A variants to chemotherapeutic nucleoside analogs
    Article Snippet: WT and variant myc-NT5C1A cDNAs were amplified by PCR with primers containing attB sites on the 5’ and 3’ ends and transferred using Invitrogen's Gateway® system and BP/LR II recombinase enzymes into pDONR221 vectors and ultimately into the pLenti6.3 destination vector. .. Vector recombination was confirmed based on BsrgI (New England Biolabs, Ipswich, Massachusetts, USA) restriction digest and by Sanger sequencing.

    Article Title: Discovery of Nigri/nox and Panto/pox site-specific recombinase systems facilitates advanced genome engineering
    Article Snippet: Without recombination the PCR product size is 1.7 kb, whereas after recombination the size is 0.6 kb. .. Plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany) and recombination efficiency was evaluated by agarose gel electrophoresis after digestion with BsrGI (NEB, Ipswich, MA, USA).

    Article Title: Role for the αV Integrin Subunit in Varicella-Zoster Virus-Mediated Fusion and Infection
    Article Snippet: Briefly, the DSP1 and DSP2 genes were amplified by PCR (AccuPrime Taq; Invitrogen) from pH-RL-CMV-R8(1-8) and pH-RL-CMV-R8(9-11) using primers [P]R8(1-8)-pGIPZ, BsrG1(1-8)-pGIPZ, [P]R8(9-11)-pGIPZ, and BsrG1(9-11)-pGIPZ ( ). .. The PCR fragments were separated on a 1% agarose gel, purified by gel extraction (Qiagen), and digested with restriction enzyme, BsrGI (New England BioLabs). .. The products were then ligated (T4 ligase; Invitrogen) with an XbaI (New England BioLabs)-digested PCR fragment amplified from the pGIPZ vector using primers pGIPZ_XbaI and pGIPZ_5CMV and a BsrG1- and XbaI-digested pGIPZ vector.

    Article Title: Stepwise Assembly of Fibrinogen Is Assisted by the Endoplasmic Reticulum Lectin-Chaperone System in HepG2 Cells
    Article Snippet: cDNA of ERp57 was obtained from reverse-transcribed mRNA isolated from HepG2 cells using the primer 5′-GGTTTTCCATCTCTGATGGA-3′ and amplified by PCR using the primers 5′-GCCCGCCTCGTGTACACCTCCGACGTGC-3′ and 5′-GTGTTTGGCTTGTACATTAGAGATCCTCCTGTG-3′ . .. The obtained cDNA was digested with BsrGI (New England BioLabs Inc) and subcloned into a pECFP-ER vector (Clontech).

    Article Title: Increased Na+/Ca2+ Exchanger Activity Promotes Resistance to Excitotoxicity in Cortical Neurons of the Ground Squirrel (a Hibernator)
    Article Snippet: The primers for ground squirrel NCXs were designed according to the sequence data of squirrel on Ensembl (Ensembl version: ENSSTOG00000025770.1, ENSSTOG00000020165.1, ENSSTOG00000003907.2). .. PrimeSTAR Max DNA Polymerase (Takara Biotechnology (Dalian) Co., Ltd., Dalian, China) was used to amplify the cDNA template according to the following PCR protocol: 35 cycles of 98°C for 10 s, 55–60°C for 15 s and 72°C for 20 s. Nucleotide sequence encoding for 2A peptide from porcine teschovirus-1 (P2A; GCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ) were synthesized by Ruibio Tech (Beijing, China), and annealed before they were inserted into a modified version of pFUGW ( ; courtesy of Prof. Zhang from Peking University) at the BsrGI/BamHI (restriction endonucleases from NEB, Beverly, MA, USA) sites; this construct was termed pFUGW-P2A when mentioned. .. NCX cDNAs were cloned into pFUGW-P2A at the NheI/BamHI sites.

    Cell Culture:

    Article Title: Discovery of Nigri/nox and Panto/pox site-specific recombinase systems facilitates advanced genome engineering
    Article Snippet: Single clones containing pEVO plasmid with the recombinase and recombination target sites were cultured overnight in 3 ml LB medium with 25 μg/ml Cm and 100 μg/ml L-(+)-arabinose at 37 °C and 200 rpm. .. Plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany) and recombination efficiency was evaluated by agarose gel electrophoresis after digestion with BsrGI (NEB, Ipswich, MA, USA).

    Polyacrylamide Gel Electrophoresis:

    Article Title: Role of interleukin-21 and interleukin-21 receptor polymorphisms in the treatment of HBeAg-positive chronic hepatitis B patients with peginterferon
    Article Snippet: PCR was carried out in a volume of 20 μL containing 3.0 μL DNA, 1.0 μL of each primer, 12.5 μL 2∗Taq PCR MasterMix (TianGen Biotech Co. Ltd, Beijing, China) and 7.5 μL ddH2 O. PCR was carried out with initial denaturation for 3 minutes at 94°C, followed by 30 (IL-21 rs907715 and rs2221903) or 35 (IL-21R rs2285452 and rs3093301) cycles of denaturation for 30 seconds at 94°C, annealing for 30 seconds at 60°C (IL-21 rs2221903), 55°C (IL-21 rs907715), 56°C (IL-21R rs3093301 and rs2285452), extension for 30 seconds at 72°C, and a final extension for 10 minutes at 72°C. .. The products were digested with restriction enzyme HpyCH4 V, MobII, MluI, BsrGI (New England Biolabs) at 37°C for 2 hours, and analyzed on a 8% polyacrylamide gel electrophoresis. .. The representative endonuclease digestion figure was showed in Figure .

    Gel Extraction:

    Article Title: Directional cDNA library construction assisted by the in vitro recombination reaction
    Article Snippet: MCS, Tet and βGal thus obtained were digested with Bsr GI (New England BioLabs), which cleaves at the TGTACA sequence within the common 15 bp core region of each att sequence, leaving four-base 5′ overhangs. .. To prepare a vector for LC, attR-pSP73 plasmid was digested with Bsr GI and dephosphorylated with bacterial alkaline phosphatase.

    Article Title: Cystathionine ?-lyase: clinical, metabolic, genetic, and structural studies
    Article Snippet: Amplification products were run on 2% agarose gels and purified with the QIAquick gel extraction kit (QIAGEN, Valencia, CA). .. For the c.932C > T (p.Thr311Ile) mutation in exon 9, control samples were digested with BsrGI (New England Biolabs, Pickering, ON, Canada) in NEB buffer 2, and for the c.200C > T (Thr67Ile) mutation in exon 2 samples were PCR amplified and digested using BfaI (New England Biolabs, Pickering, ON, Canada) in NEB buffer 4.

    Article Title: Role for the αV Integrin Subunit in Varicella-Zoster Virus-Mediated Fusion and Infection
    Article Snippet: Briefly, the DSP1 and DSP2 genes were amplified by PCR (AccuPrime Taq; Invitrogen) from pH-RL-CMV-R8(1-8) and pH-RL-CMV-R8(9-11) using primers [P]R8(1-8)-pGIPZ, BsrG1(1-8)-pGIPZ, [P]R8(9-11)-pGIPZ, and BsrG1(9-11)-pGIPZ ( ). .. The PCR fragments were separated on a 1% agarose gel, purified by gel extraction (Qiagen), and digested with restriction enzyme, BsrGI (New England BioLabs). .. The products were then ligated (T4 ligase; Invitrogen) with an XbaI (New England BioLabs)-digested PCR fragment amplified from the pGIPZ vector using primers pGIPZ_XbaI and pGIPZ_5CMV and a BsrG1- and XbaI-digested pGIPZ vector.

    Liquid Chromatography:

    Article Title: Directional cDNA library construction assisted by the in vitro recombination reaction
    Article Snippet: Paragraph title: Examination of size bias and chimerization by LC and RC ... MCS, Tet and βGal thus obtained were digested with Bsr GI (New England BioLabs), which cleaves at the TGTACA sequence within the common 15 bp core region of each att sequence, leaving four-base 5′ overhangs.

    Plasmid Preparation:

    Article Title: High-Throughput System for the Presentation of Secreted and Surface-Exposed Proteins from Gram-Positive Bacteria in Functional Metagenomics Studies
    Article Snippet: The resulting entry clones (25–50) were pooled and the plasmid inserts, now flanked by att L1 and att L2, were transferred to pDG148-GW by site-specific recombination between the att L1 and att L2 sites and the att R1 and att R2 sites, respectively, present on the latter plasmid, in vitro , using LR clonase II (Invitrogen), followed by transformation of E. coli TOP10 with selection for ampicilin. .. The presence of inserts in pDONR223 and pDG148-GW was verified by digestion with Bsr GI and Eco RI (New England Biolabs), respectively, and PCR amplifications using the pDONR223-specific primers 5′-CCCAGTCACGACGTTGTAAAACG and 5′-GTAACATCAGAGATTTTGAGACAC .

    Article Title: Dimerization is required for GARS-mediated neurotoxicity in dominant CMT disease
    Article Snippet: The T209K GRS1 /pDONR221 entry clone was recombined into a Gateway-compatible LEU2 -bearing pRS315 destination vector. .. Resulting clones were purified and digested with Bsr GI (New England Biolabs, Ipswich, MA, USA) to confirm recombination.

    Article Title: A Systematic Screen for Transcriptional Regulators of the Yeast Cell Cycle
    Article Snippet: We replaced the wild-type sequence with the custom-synthesized sequence as follows: pMW104 and the Cel-Tek fragment were digested with Nru I and Sph I (New England Biolabs), gel purified, and ligated together to create pMW113, which is identical to pMW104, with the exception of the three threonine-to-alanine mutations. pMW100, pMW104, and pMW113 were transformed into the relevant homozygous diploid deletion or wild-type parental strain, either Δ sfg1 or BY4743. .. To create an empty vector as a control for expression profiling experiments with the PGAL1 - SFG1 overexpression strain, we obtained the MORF- HIS5 plasmid from the MORF yeast ORF collection at Open Biosystems and digested the plasmid with Bsr GI (New England Biolabs) to remove the only the ORF. .. The empty vector was gel purified and closed by ligation, creating the empty plasmid pMW102.

    Article Title: Directional cDNA library construction assisted by the in vitro recombination reaction
    Article Snippet: The resultant plasmid, attB-pBluescript, was used as a template for preparation of a DNA fragment containing multiple cloning sites (MCS). .. MCS, Tet and βGal thus obtained were digested with Bsr GI (New England BioLabs), which cleaves at the TGTACA sequence within the common 15 bp core region of each att sequence, leaving four-base 5′ overhangs.

    Article Title: Haplotype-specific modulation of a SOX10/CREB response element at the Charcot–Marie–Tooth disease type 4C locus SH3TC2
    Article Snippet: Paragraph title: Expression vector construction ... Resulting constructs were genotyped by digestion with Bsr GI (New England Biolabs) and subjected to DNA sequence analysis to ensure sequence specificity.

    Article Title: Construction and high-throughput phenotypic screening of Zymoseptoria tritici over-expression strains
    Article Snippet: Colonies were grown over-night in LB medium with selection, and plasmids extracted using Plasmid Mini Kit (Qiagen, UK). .. In order to confirm recombination of the ccd B gene with the gene of interest, plasmids were digested with Bsr GI (NEB, UK), and digest reactions analyzed by gel electrophoresis.

    Article Title:
    Article Snippet: Nuclear extracts (100 µ g) prepared from HepG2 cells transfected with empty vector or cFos expression vector were incubated with 50 ng linearized CYP2C9 plasmid (containing −3077 to +1 of the CYP2C9 promoter) at room temperature for 45 minutes. .. After overnight ethanol precipitation at −20°C, complexes were digested with 10 U BsrGI (New England Biolabs, Ipswich, MA) at 37°C for 2 hours.

    Article Title: Pharmacogenetic characterization of naturally occurring germline NT5C1A variants to chemotherapeutic nucleoside analogs
    Article Snippet: WT and variant myc-NT5C1A cDNAs were amplified by PCR with primers containing attB sites on the 5’ and 3’ ends and transferred using Invitrogen's Gateway® system and BP/LR II recombinase enzymes into pDONR221 vectors and ultimately into the pLenti6.3 destination vector. .. Vector recombination was confirmed based on BsrgI (New England Biolabs, Ipswich, Massachusetts, USA) restriction digest and by Sanger sequencing. .. HEK293 cells grown in IDMEM (Invitrogen, Carlsbad, California, USA) and 10% FBS (Thermo Scientific, Waltham, Massachusetts, USA) were transfected with pLenti-6.3-myc-NT51A WT or variant vectors, pDM2D, and pΔ874 (4ug DNA total) using Lipofectamine 2000 (Invitrogen) and Opti-MEM (Invitrogen).

    Article Title: Discovery of Nigri/nox and Panto/pox site-specific recombinase systems facilitates advanced genome engineering
    Article Snippet: To compare the recombination efficiency of the tyrosine recombinases Cre, Vika, Dre, VCre, Nigri and Panto on their native target sites loxP, vox, rox, VloxP, nox and pox , respectively, recombinase expression was induced with increasing concentrations of L-(+)-arabinose (0, 1, 10 or 100 μg/ml medium) overnight in 3 ml culture volume. .. Plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany) and recombination efficiency was evaluated by agarose gel electrophoresis after digestion with BsrGI (NEB, Ipswich, MA, USA). .. Quantification of recombination efficiency was performed by measuring the band intensities using ImageJ software applying the Gel analysis feature.

    Article Title: Deregulation of Rb-E2F1 Axis Causes Chromosomal Instability by Engaging the Transactivation Function of Cdc20–Anaphase-Promoting Complex/Cyclosome
    Article Snippet: The plasmid expressing the DNA binding domain mutant of E2F1 (pCMV-HA-ER-E2F1 DBD) and its wild-type counterpart (pCMV-HA-ER-E2F1) were kindly provided by Peggy Farnham (University of Southern California, Los Angeles, CA). .. The pmCherry-F plasmid was made by replacing the GFP fragment from the pEGFP-F plasmid (Clontech) with the mCherry fragment from the pmCherry-C1 vector (Clontech), using the restriction enzymes NheI and BsrGI (New England BioLabs, Beverly, MA). .. Various siRNA constructs (Santa Cruz Biotechnology, Santa Cruz, CA), directed against E2F1 (sc-29297), Cdc20 (sc-36160), Cdc27 (sc-77362), Mad2 (sc-35837), DP-1 (sc-37813), Lin-9 (sc-88786), ANAPC2 (Thermo Scientific), Cdc27 (Thermo Scientific), and Rb (Eurogentec, Seraing, Belgium), as well as a scrambled control (Ambion, Austin, TX), were used at a final concentration of 80 nM.

    Article Title: Stepwise Assembly of Fibrinogen Is Assisted by the Endoplasmic Reticulum Lectin-Chaperone System in HepG2 Cells
    Article Snippet: cDNA of ERp57 was obtained from reverse-transcribed mRNA isolated from HepG2 cells using the primer 5′-GGTTTTCCATCTCTGATGGA-3′ and amplified by PCR using the primers 5′-GCCCGCCTCGTGTACACCTCCGACGTGC-3′ and 5′-GTGTTTGGCTTGTACATTAGAGATCCTCCTGTG-3′ . .. The obtained cDNA was digested with BsrGI (New England BioLabs Inc) and subcloned into a pECFP-ER vector (Clontech). .. DNA fragments containing the CFP-ERp57 region were inserted into the pCX4-bsr vector, and the packaging cell (Phoenix Amp) was transfected with the vector.

    Article Title: Increased Na+/Ca2+ Exchanger Activity Promotes Resistance to Excitotoxicity in Cortical Neurons of the Ground Squirrel (a Hibernator)
    Article Snippet: Paragraph title: NCX cloning, plasmid preparation, cell transfection and determination of cell viability ... PrimeSTAR Max DNA Polymerase (Takara Biotechnology (Dalian) Co., Ltd., Dalian, China) was used to amplify the cDNA template according to the following PCR protocol: 35 cycles of 98°C for 10 s, 55–60°C for 15 s and 72°C for 20 s. Nucleotide sequence encoding for 2A peptide from porcine teschovirus-1 (P2A; GCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ) were synthesized by Ruibio Tech (Beijing, China), and annealed before they were inserted into a modified version of pFUGW ( ; courtesy of Prof. Zhang from Peking University) at the BsrGI/BamHI (restriction endonucleases from NEB, Beverly, MA, USA) sites; this construct was termed pFUGW-P2A when mentioned.

    Article Title: Design and Screening of a Glial Cell-Specific, Cell Penetrating Peptide for Therapeutic Applications in Multiple Sclerosis
    Article Snippet: Histidine-tagged TD1, TD2, TD1.1, TD2.1 and TD2.2 recombinant proteins were induced and purified as outlined below. .. To construct the pET-EGFP-TD2.2 protein expression vector (for , and ), DNA inserts of EGFP and TD2.2 were amplified by PCR with complimentary NcoI (N-terminal), BsrGI (middle) and XhoI (C-terminal) restriction endonuclease digest sites (NEB Biolabs, Australia; ). .. DNA inserts were ligated to pGEM-T cloning vectors before DNA sequencing.

    Software:

    Article Title: Cystathionine ?-lyase: clinical, metabolic, genetic, and structural studies
    Article Snippet: DNA sequences were aligned with ABI Sequence Navigator software. .. For the c.932C > T (p.Thr311Ile) mutation in exon 9, control samples were digested with BsrGI (New England Biolabs, Pickering, ON, Canada) in NEB buffer 2, and for the c.200C > T (Thr67Ile) mutation in exon 2 samples were PCR amplified and digested using BfaI (New England Biolabs, Pickering, ON, Canada) in NEB buffer 4.

    Positron Emission Tomography:

    Article Title: Design and Screening of a Glial Cell-Specific, Cell Penetrating Peptide for Therapeutic Applications in Multiple Sclerosis
    Article Snippet: Histidine-tagged TD1, TD2, TD1.1, TD2.1 and TD2.2 recombinant proteins were induced and purified as outlined below. .. To construct the pET-EGFP-TD2.2 protein expression vector (for , and ), DNA inserts of EGFP and TD2.2 were amplified by PCR with complimentary NcoI (N-terminal), BsrGI (middle) and XhoI (C-terminal) restriction endonuclease digest sites (NEB Biolabs, Australia; ). .. DNA inserts were ligated to pGEM-T cloning vectors before DNA sequencing.

    Agarose Gel Electrophoresis:

    Article Title: Directional cDNA library construction assisted by the in vitro recombination reaction
    Article Snippet: MCS, Tet and βGal thus obtained were digested with Bsr GI (New England BioLabs), which cleaves at the TGTACA sequence within the common 15 bp core region of each att sequence, leaving four-base 5′ overhangs. .. To prepare a vector for LC, attR-pSP73 plasmid was digested with Bsr GI and dephosphorylated with bacterial alkaline phosphatase.

    Article Title: Discovery of Nigri/nox and Panto/pox site-specific recombinase systems facilitates advanced genome engineering
    Article Snippet: To compare the recombination efficiency of the tyrosine recombinases Cre, Vika, Dre, VCre, Nigri and Panto on their native target sites loxP, vox, rox, VloxP, nox and pox , respectively, recombinase expression was induced with increasing concentrations of L-(+)-arabinose (0, 1, 10 or 100 μg/ml medium) overnight in 3 ml culture volume. .. Plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany) and recombination efficiency was evaluated by agarose gel electrophoresis after digestion with BsrGI (NEB, Ipswich, MA, USA). .. Quantification of recombination efficiency was performed by measuring the band intensities using ImageJ software applying the Gel analysis feature.

    Article Title: Role for the αV Integrin Subunit in Varicella-Zoster Virus-Mediated Fusion and Infection
    Article Snippet: Briefly, the DSP1 and DSP2 genes were amplified by PCR (AccuPrime Taq; Invitrogen) from pH-RL-CMV-R8(1-8) and pH-RL-CMV-R8(9-11) using primers [P]R8(1-8)-pGIPZ, BsrG1(1-8)-pGIPZ, [P]R8(9-11)-pGIPZ, and BsrG1(9-11)-pGIPZ ( ). .. The PCR fragments were separated on a 1% agarose gel, purified by gel extraction (Qiagen), and digested with restriction enzyme, BsrGI (New England BioLabs). .. The products were then ligated (T4 ligase; Invitrogen) with an XbaI (New England BioLabs)-digested PCR fragment amplified from the pGIPZ vector using primers pGIPZ_XbaI and pGIPZ_5CMV and a BsrG1- and XbaI-digested pGIPZ vector.

    In Vitro:

    Article Title: High-Throughput System for the Presentation of Secreted and Surface-Exposed Proteins from Gram-Positive Bacteria in Functional Metagenomics Studies
    Article Snippet: The resulting entry clones (25–50) were pooled and the plasmid inserts, now flanked by att L1 and att L2, were transferred to pDG148-GW by site-specific recombination between the att L1 and att L2 sites and the att R1 and att R2 sites, respectively, present on the latter plasmid, in vitro , using LR clonase II (Invitrogen), followed by transformation of E. coli TOP10 with selection for ampicilin. .. The presence of inserts in pDONR223 and pDG148-GW was verified by digestion with Bsr GI and Eco RI (New England Biolabs), respectively, and PCR amplifications using the pDONR223-specific primers 5′-CCCAGTCACGACGTTGTAAAACG and 5′-GTAACATCAGAGATTTTGAGACAC .

    Article Title:
    Article Snippet: Paragraph title: In Vitro and In Vivo 3C Assays. ... After overnight ethanol precipitation at −20°C, complexes were digested with 10 U BsrGI (New England Biolabs, Ipswich, MA) at 37°C for 2 hours.

    Article Title: Increased Na+/Ca2+ Exchanger Activity Promotes Resistance to Excitotoxicity in Cortical Neurons of the Ground Squirrel (a Hibernator)
    Article Snippet: PrimeSTAR Max DNA Polymerase (Takara Biotechnology (Dalian) Co., Ltd., Dalian, China) was used to amplify the cDNA template according to the following PCR protocol: 35 cycles of 98°C for 10 s, 55–60°C for 15 s and 72°C for 20 s. Nucleotide sequence encoding for 2A peptide from porcine teschovirus-1 (P2A; GCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ) were synthesized by Ruibio Tech (Beijing, China), and annealed before they were inserted into a modified version of pFUGW ( ; courtesy of Prof. Zhang from Peking University) at the BsrGI/BamHI (restriction endonucleases from NEB, Beverly, MA, USA) sites; this construct was termed pFUGW-P2A when mentioned. .. NCX cDNAs were cloned into pFUGW-P2A at the NheI/BamHI sites.

    Selection:

    Article Title: High-Throughput System for the Presentation of Secreted and Surface-Exposed Proteins from Gram-Positive Bacteria in Functional Metagenomics Studies
    Article Snippet: The resulting entry clones (25–50) were pooled and the plasmid inserts, now flanked by att L1 and att L2, were transferred to pDG148-GW by site-specific recombination between the att L1 and att L2 sites and the att R1 and att R2 sites, respectively, present on the latter plasmid, in vitro , using LR clonase II (Invitrogen), followed by transformation of E. coli TOP10 with selection for ampicilin. .. The presence of inserts in pDONR223 and pDG148-GW was verified by digestion with Bsr GI and Eco RI (New England Biolabs), respectively, and PCR amplifications using the pDONR223-specific primers 5′-CCCAGTCACGACGTTGTAAAACG and 5′-GTAACATCAGAGATTTTGAGACAC .

    Article Title: Dimerization is required for GARS-mediated neurotoxicity in dominant CMT disease
    Article Snippet: Resulting clones were purified and digested with Bsr GI (New England Biolabs, Ipswich, MA, USA) to confirm recombination. .. The Δ grs1 haploid yeast strain [harboring a pRS316 maintenance vector to express wild-type GRS1 and URA3 ( ) was transformed with wild-type or mutant GRS1 in a LEU2 -bearing pRS315 vector and selected on medium lacking uracil and leucine (Teknova, Hollister, CA, USA).

    Article Title: Construction and high-throughput phenotypic screening of Zymoseptoria tritici over-expression strains
    Article Snippet: Colonies were grown over-night in LB medium with selection, and plasmids extracted using Plasmid Mini Kit (Qiagen, UK). .. In order to confirm recombination of the ccd B gene with the gene of interest, plasmids were digested with Bsr GI (NEB, UK), and digest reactions analyzed by gel electrophoresis.

    Ethanol Precipitation:

    Article Title:
    Article Snippet: The cross-linking reaction was quenched with 0.125 M glycine for 10 minutes. .. After overnight ethanol precipitation at −20°C, complexes were digested with 10 U BsrGI (New England Biolabs, Ipswich, MA) at 37°C for 2 hours. .. BsrGI enzyme activity was inactivated by incubation at 80°C for 20 minutes.

    Concentration Assay:

    Article Title: MCL-1 Depletion Impairs DNA Double-Strand Break Repair and Reinitiation of Stalled DNA Replication Forks
    Article Snippet: ER-AsiSI U2OS cells were mixed with 0.6% low-melting-temperature agarose (FMC) in PBS at a concentration of 6 × 106 cells per ml. .. Sixty microliters of genomic DNA sample was digested with 60 U of restriction enzyme BsrGI (New England BioLabs) or mock digested at 37°C overnight, and 3-μl quantities of mock- or BsrGI-digested samples were used as templates in quantitative PCRs (qPCRs) with 20-μl mixtures.

    Article Title: MOF Suppresses Replication Stress and Contributes to Resolution of Stalled Replication Forks
    Article Snippet: The ER-AsiSI U2OS cells were incubated with tamoxifen (300 ng/ml) for 3 h and then mixed with 0.6% low-melting-temperature agarose in PBS at a concentration of 6 × 106 cells per ml. .. Sixty microliters of genomic DNA sample was digested with 60 U of restriction enzyme BsrGI (New England BioLabs) or mock digested at 37°C overnight, and 3-μl quantities of mock- or BsrGI-digested samples were used as templates in quantitative PCRs (qPCRs) with 20-μl mixtures.

    DNA Purification:

    Article Title: The Sialidases of Clostridium perfringens Type D Strain CN3718 Differ in Their Properties and Sensitivities to Inhibitors
    Article Snippet: DNA was isolated from wild-type CN3718 or the ENanJ, ENanI, ENanH, and BMC205 mutants, using the MasterPure Gram Positive DNA Purification kit (Epicenter). .. A 3-μg aliquot of each isolated DNA in Tris-EDTA (TE) buffer (Epicenter) was digested overnight with BsrGI at 37°C according to the manufacturer's instructions (New England BioLabs).

    Staining:

    Article Title: Cystathionine ?-lyase: clinical, metabolic, genetic, and structural studies
    Article Snippet: For the c.932C > T (p.Thr311Ile) mutation in exon 9, control samples were digested with BsrGI (New England Biolabs, Pickering, ON, Canada) in NEB buffer 2, and for the c.200C > T (Thr67Ile) mutation in exon 2 samples were PCR amplified and digested using BfaI (New England Biolabs, Pickering, ON, Canada) in NEB buffer 4. .. Mutations in exons 2 and 6 were analyzed by electrophoresis on 2.5% agarose, while exon 9 was analyzed on 8% polyacrylamide.

    Article Title: Increased Na+/Ca2+ Exchanger Activity Promotes Resistance to Excitotoxicity in Cortical Neurons of the Ground Squirrel (a Hibernator)
    Article Snippet: PrimeSTAR Max DNA Polymerase (Takara Biotechnology (Dalian) Co., Ltd., Dalian, China) was used to amplify the cDNA template according to the following PCR protocol: 35 cycles of 98°C for 10 s, 55–60°C for 15 s and 72°C for 20 s. Nucleotide sequence encoding for 2A peptide from porcine teschovirus-1 (P2A; GCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ) were synthesized by Ruibio Tech (Beijing, China), and annealed before they were inserted into a modified version of pFUGW ( ; courtesy of Prof. Zhang from Peking University) at the BsrGI/BamHI (restriction endonucleases from NEB, Beverly, MA, USA) sites; this construct was termed pFUGW-P2A when mentioned. .. PrimeSTAR Max DNA Polymerase (Takara Biotechnology (Dalian) Co., Ltd., Dalian, China) was used to amplify the cDNA template according to the following PCR protocol: 35 cycles of 98°C for 10 s, 55–60°C for 15 s and 72°C for 20 s. Nucleotide sequence encoding for 2A peptide from porcine teschovirus-1 (P2A; GCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ) were synthesized by Ruibio Tech (Beijing, China), and annealed before they were inserted into a modified version of pFUGW ( ; courtesy of Prof. Zhang from Peking University) at the BsrGI/BamHI (restriction endonucleases from NEB, Beverly, MA, USA) sites; this construct was termed pFUGW-P2A when mentioned.

    Variant Assay:

    Article Title: High-Throughput System for the Presentation of Secreted and Surface-Exposed Proteins from Gram-Positive Bacteria in Functional Metagenomics Studies
    Article Snippet: The presence of inserts in pDONR223 and pDG148-GW was verified by digestion with Bsr GI and Eco RI (New England Biolabs), respectively, and PCR amplifications using the pDONR223-specific primers 5′-CCCAGTCACGACGTTGTAAAACG and 5′-GTAACATCAGAGATTTTGAGACAC . .. Three B. subtilis clones were verified by colony PCR using the vector-specific primers 5′-CGCACCCTGAAGAAGATTTA and 5′-GCCGACTCAAACATCAAATC .

    Article Title: Pharmacogenetic characterization of naturally occurring germline NT5C1A variants to chemotherapeutic nucleoside analogs
    Article Snippet: WT and variant myc-NT5C1A cDNAs were amplified by PCR with primers containing attB sites on the 5’ and 3’ ends and transferred using Invitrogen's Gateway® system and BP/LR II recombinase enzymes into pDONR221 vectors and ultimately into the pLenti6.3 destination vector. .. Vector recombination was confirmed based on BsrgI (New England Biolabs, Ipswich, Massachusetts, USA) restriction digest and by Sanger sequencing.

    Article Title: Vika/vox, a novel efficient and specific Cre/loxP-like site-specific recombination system
    Article Snippet: The Vika coding sequence was synthesized (GeneArt, Life Technologies Corporation) and cloned via BsrGI and XbaI New England Biolabs (NEB) into pEVO vectors as described previously ( ). .. Two of the recombination sites, loxP , rox , VloxP or vox , were inserted into the pEVO vector, producing pEVO-loxP , pEVO-rox , pEVO-VloxP and pEVO-vox .

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs bsrgi
    Bsrgi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsrgi/product/New England Biolabs
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    bsrgi - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results