materials cas9 nuclease  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Cas9 Nuclease S pyogenes
    Description:
    Cas9 Nuclease S pyogenes 2 000 pmol
    Catalog Number:
    m0386m
    Price:
    540
    Size:
    2 000 pmol
    Category:
    Other Endonucleases
    Buy from Supplier


    Structured Review

    New England Biolabs materials cas9 nuclease
    Cas9 Nuclease S pyogenes
    Cas9 Nuclease S pyogenes 2 000 pmol
    https://www.bioz.com/result/materials cas9 nuclease/product/New England Biolabs
    Average 99 stars, based on 9089 article reviews
    Price from $9.99 to $1999.99
    materials cas9 nuclease - by Bioz Stars, 2020-07
    99/100 stars

    Images

    1) Product Images from "Conditional control of RNA-guided nucleic acid cleavage and gene editing"

    Article Title: Conditional control of RNA-guided nucleic acid cleavage and gene editing

    Journal: Nature Communications

    doi: 10.1038/s41467-019-13765-3

    Gene editing in live cells. The T7E1 nuclease assay was performed 24 h post-transfection using Cas9-expressing HeLa-OC cells transfected with gRNA-HBEGF with different treatments. a Uncleaved HBEGF DNA (621 bp) cut to shorter cleavage fragments (311 bp and 310 bp) were indicated. Lane 1: target control; lane 2: no gRNA-HBEGF control; lane 3: original gRNA-HBEGF; lane 4: original gRNA-HBEGF, 300 μM DPBM; lanes 5–9: masked gRNA-HBEGF (200 mM, 1 h), different concentrations of DPBM; lane 10: DNA markers. The “Lanes and Bands” tool in Image Lab software version 5.1 (Bio-Rad) was used for image acquisition and differential densitometric analysis of the associated bands from the gels. Although long exposure times were necessary to visualize faint bands, the calculations of indel formation were not influenced by the extent of exposure. b The Cyan color represents the original gRNA-HBEGF group, while the Blue color represents the masked gRNA-HBEGF group. Error bars: ±SEM. Source data are provided as a Source Data file.
    Figure Legend Snippet: Gene editing in live cells. The T7E1 nuclease assay was performed 24 h post-transfection using Cas9-expressing HeLa-OC cells transfected with gRNA-HBEGF with different treatments. a Uncleaved HBEGF DNA (621 bp) cut to shorter cleavage fragments (311 bp and 310 bp) were indicated. Lane 1: target control; lane 2: no gRNA-HBEGF control; lane 3: original gRNA-HBEGF; lane 4: original gRNA-HBEGF, 300 μM DPBM; lanes 5–9: masked gRNA-HBEGF (200 mM, 1 h), different concentrations of DPBM; lane 10: DNA markers. The “Lanes and Bands” tool in Image Lab software version 5.1 (Bio-Rad) was used for image acquisition and differential densitometric analysis of the associated bands from the gels. Although long exposure times were necessary to visualize faint bands, the calculations of indel formation were not influenced by the extent of exposure. b The Cyan color represents the original gRNA-HBEGF group, while the Blue color represents the masked gRNA-HBEGF group. Error bars: ±SEM. Source data are provided as a Source Data file.

    Techniques Used: Nuclease Assay, Transfection, Expressing, Software

    Conditional control of RNA-guided DNA cleavage. Reactions were carried out as described in the Experimental section. All samples were tested in three biological replicates. Image of representative data is shown here. Uncleaved t-GFP1 DNA (702 bp) cut to shorter cleavage fragments (469 bp and 233 bp) were indicated. a , b The influence of chemical masking of gRNA on Cas9 cleavage of t-GFP1. The gRNA (gRNA-GFP) was synthesized by in vitro transcription with T7 RNA polymerase. c , d The influence of DPBM on Cas9 cleavage of t-GFP1. The CRISPR/Cas9 system with acylated gRNA-GFP (200 mM NAI-N 3 , 2 h) was treated with various concentrations of DPBM. Source data is available in the Source Data file.
    Figure Legend Snippet: Conditional control of RNA-guided DNA cleavage. Reactions were carried out as described in the Experimental section. All samples were tested in three biological replicates. Image of representative data is shown here. Uncleaved t-GFP1 DNA (702 bp) cut to shorter cleavage fragments (469 bp and 233 bp) were indicated. a , b The influence of chemical masking of gRNA on Cas9 cleavage of t-GFP1. The gRNA (gRNA-GFP) was synthesized by in vitro transcription with T7 RNA polymerase. c , d The influence of DPBM on Cas9 cleavage of t-GFP1. The CRISPR/Cas9 system with acylated gRNA-GFP (200 mM NAI-N 3 , 2 h) was treated with various concentrations of DPBM. Source data is available in the Source Data file.

    Techniques Used: Synthesized, In Vitro, CRISPR

    2) Product Images from "AutoRELACS: Automated Generation And Analysis Of Ultra-parallel ChIP-seq"

    Article Title: AutoRELACS: Automated Generation And Analysis Of Ultra-parallel ChIP-seq

    Journal: bioRxiv

    doi: 10.1101/2020.03.30.016287

    AutoRELACS workflow ensures comprehensive integration of RELACS barcodes a) Overview of AutoRELACS protocol. 1-M) Nuclei of formaldehyde-fixed cells are extracted manually using adjusted ultrasound ( 14 ). The nuclear envelope is permeabilized, and the chromatin digested in situ using a 4-cutter restriction enzyme (RE). 2-A) Digested chromatin from each sample is automatically barcoded. Upon completion, the liquid handler pools all barcoded samples into a unique tube (Biomek i7 program: “RELACS_Barcoding”). 3-M) Pooled samples are collected by the user and nuclei are lysed using focused sonication. 4-A) The barcoded chromatin is aliquoted according to the number of required immunoprecipitation (IP) reactions into corresponding ChIP reaction mixes. The ChIP reactions are carried out overnight in parallel at room temperature on the Biomek i7 workstation. Upon completion, the ChIP-ped chromatin is sequestrated using beads and automatically washed 4 times at increasing stringency conditions and finally eluted in the elution buffer (Biomek program: “RELACS_ChIP_Elution”). 5-A) Subsequently, the eluted chromatin is decrosslinked and the DNA is purified. DNA is amplified via PCR using primers carrying Illumina dual indexes. Optionally, the liquid handler performs multiple rounds of purification and size selection using Ampure XP beads (Biomek program: “RELACS_Decrosslink_FinalLibraries”). A: Automated; M: Manual. 6-A) Libraries are sequenced on Illumina’s sequencing devices. Upon completion of the sequencing run, bcl2 files are automatically converted to fastq format and input into the fully automated ChIP-seq workflow available as part of the snakePipes suite ( 13 ). SnakePipes’ ChIP-seq workflow performs demultiplexing of reads on RELACS custom barcodes, quality controls, mapping and filtering of duplicate reads using unique molecular identifiers (UMI), and further downstream analysis like generation of input-normalized coverage tracks and peak calling. b) Distribution of RELACS barcodes in two independent input chromatin pools. 60 barcodes are integrated into the digested chromatin of two independent batches of S2 cells. Sequencing of the input chromatin pool for replicate 1 (upper panel) and replicate 2 (lower panel), reveals the percentage of input reads for each barcode used (y-axis). The ideal uniform distribution (100/60) is represented as a dotted line. The shaded gray area shows one standard deviation from the mean of the observed distribution.
    Figure Legend Snippet: AutoRELACS workflow ensures comprehensive integration of RELACS barcodes a) Overview of AutoRELACS protocol. 1-M) Nuclei of formaldehyde-fixed cells are extracted manually using adjusted ultrasound ( 14 ). The nuclear envelope is permeabilized, and the chromatin digested in situ using a 4-cutter restriction enzyme (RE). 2-A) Digested chromatin from each sample is automatically barcoded. Upon completion, the liquid handler pools all barcoded samples into a unique tube (Biomek i7 program: “RELACS_Barcoding”). 3-M) Pooled samples are collected by the user and nuclei are lysed using focused sonication. 4-A) The barcoded chromatin is aliquoted according to the number of required immunoprecipitation (IP) reactions into corresponding ChIP reaction mixes. The ChIP reactions are carried out overnight in parallel at room temperature on the Biomek i7 workstation. Upon completion, the ChIP-ped chromatin is sequestrated using beads and automatically washed 4 times at increasing stringency conditions and finally eluted in the elution buffer (Biomek program: “RELACS_ChIP_Elution”). 5-A) Subsequently, the eluted chromatin is decrosslinked and the DNA is purified. DNA is amplified via PCR using primers carrying Illumina dual indexes. Optionally, the liquid handler performs multiple rounds of purification and size selection using Ampure XP beads (Biomek program: “RELACS_Decrosslink_FinalLibraries”). A: Automated; M: Manual. 6-A) Libraries are sequenced on Illumina’s sequencing devices. Upon completion of the sequencing run, bcl2 files are automatically converted to fastq format and input into the fully automated ChIP-seq workflow available as part of the snakePipes suite ( 13 ). SnakePipes’ ChIP-seq workflow performs demultiplexing of reads on RELACS custom barcodes, quality controls, mapping and filtering of duplicate reads using unique molecular identifiers (UMI), and further downstream analysis like generation of input-normalized coverage tracks and peak calling. b) Distribution of RELACS barcodes in two independent input chromatin pools. 60 barcodes are integrated into the digested chromatin of two independent batches of S2 cells. Sequencing of the input chromatin pool for replicate 1 (upper panel) and replicate 2 (lower panel), reveals the percentage of input reads for each barcode used (y-axis). The ideal uniform distribution (100/60) is represented as a dotted line. The shaded gray area shows one standard deviation from the mean of the observed distribution.

    Techniques Used: In Situ, Sonication, Immunoprecipitation, Chromatin Immunoprecipitation, Purification, Amplification, Polymerase Chain Reaction, Selection, Sequencing, Standard Deviation

    Related Articles

    Countercurrent Chromatography:

    Article Title: T cell-specific inactivation of mouse CD2 by CRISPR/Cas9
    Article Snippet: .. Either PCR product or annealed oligos (PCR primer: T7 CD2.0 F: 5′-taa tac gac tca cta tag ggg act agg ctg gag aag gac c-3′, T7 CD2.0 R: 5′-gca gcg gct aaa aac gga-3′; oligos: T7 promoter F: 5′-taa tac gac tca cta tag gg-3′, CD2.1 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa aca aga cac ccc aga tgg tct ccc cta tag tga gtc gta tta-3′, CD2.2 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa acg aac atc ccc aac ttt caa acc cta tag tga gtc gta tta-3′, CD2.3 R: 5′- aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa act cgc acc tca tca ata tca tcc cta tag tga gtc gta tta-3′) were used to transcribe RNA with MEGAshortscript T7 Transcription Kit (ThermoFisher Scientific) and purified with MEGAclear Transcription Clean-Up Kit (ThermoFisher Scientific). gRNA and Cas9 Nuclease, S pyogenes (NEB) were preincubated for 10 min at room temperature. .. After adding the CD2 PCR product the mix was incubated for either 1 h or 1.5 h at 37 °C and finally analyzed on an agarose gel.

    Transfection:

    Article Title: Monoclonal Cell Line Generation and CRISPR/Cas9 Manipulation via Single-Cell Electroporation
    Article Snippet: .. These cells were grown on patterned substrates as described above in “Cell culture and microstamping for cell colony control.” Colonies of 10 to 20 cells were transfected using the NFP-E with a solution containing Cas9 nuclease (NEB) and a guide RNA (targeting sequence: GGGCGAGGAGCUGUUCACCG; Synthego) both at 1 × 10−6 M final in DPBS. .. This gRNA has been shown to efficiently knock-out the green fluorescent protein gene.

    In Vitro:

    Article Title: Whole exome sequencing of ENU-induced thrombosis modifier mutations in the mouse
    Article Snippet: .. In vitro digestion of target DNA was carried out by complexes of synthetic sgRNA and S . pyogenes Cas9 Nuclease (New England BioLabs) according to manufacturer's recommendations. .. Agarose gel electrophoresis of the reaction products was used to identify sgRNA molecules that mediated template cleavage by Cas9 protein ( ).

    Article Title: Antibody discovery and engineering by enhanced CRISPR-Cas9 integration of variable gene cassette libraries in mammalian cells
    Article Snippet: .. In order to test if PnP-lin donor plasmids were recognized and successfully linearized by the Cas9 nuclease, an in vitro digestion assay was set up in a total reaction volume of 30 μl as follows: 16 μl of nuclease-free water (Thermo, AM9937) were mixed with 3 μl of NEBuffer 3.1 (NEB, B7203), 6 μl of 300 nM crRNA-J/tracr RNA complex (final concentration of 60 nM) and 2 μl of 1 μM Cas9 nuclease (NEB, M0386; final concentration of 60 nM) and the mixture was incubated for 10 min at 25°C in order to prepare the RNP complex. .. 3 μl of 30 nM plasmid DNA were added (final concentration of 3 nM) and samples were incubated for 60 min at 37°C.

    Polymerase Chain Reaction:

    Article Title: T cell-specific inactivation of mouse CD2 by CRISPR/Cas9
    Article Snippet: .. Either PCR product or annealed oligos (PCR primer: T7 CD2.0 F: 5′-taa tac gac tca cta tag ggg act agg ctg gag aag gac c-3′, T7 CD2.0 R: 5′-gca gcg gct aaa aac gga-3′; oligos: T7 promoter F: 5′-taa tac gac tca cta tag gg-3′, CD2.1 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa aca aga cac ccc aga tgg tct ccc cta tag tga gtc gta tta-3′, CD2.2 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa acg aac atc ccc aac ttt caa acc cta tag tga gtc gta tta-3′, CD2.3 R: 5′- aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa act cgc acc tca tca ata tca tcc cta tag tga gtc gta tta-3′) were used to transcribe RNA with MEGAshortscript T7 Transcription Kit (ThermoFisher Scientific) and purified with MEGAclear Transcription Clean-Up Kit (ThermoFisher Scientific). gRNA and Cas9 Nuclease, S pyogenes (NEB) were preincubated for 10 min at room temperature. .. After adding the CD2 PCR product the mix was incubated for either 1 h or 1.5 h at 37 °C and finally analyzed on an agarose gel.

    CTG Assay:

    Article Title: T cell-specific inactivation of mouse CD2 by CRISPR/Cas9
    Article Snippet: .. Either PCR product or annealed oligos (PCR primer: T7 CD2.0 F: 5′-taa tac gac tca cta tag ggg act agg ctg gag aag gac c-3′, T7 CD2.0 R: 5′-gca gcg gct aaa aac gga-3′; oligos: T7 promoter F: 5′-taa tac gac tca cta tag gg-3′, CD2.1 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa aca aga cac ccc aga tgg tct ccc cta tag tga gtc gta tta-3′, CD2.2 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa acg aac atc ccc aac ttt caa acc cta tag tga gtc gta tta-3′, CD2.3 R: 5′- aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa act cgc acc tca tca ata tca tcc cta tag tga gtc gta tta-3′) were used to transcribe RNA with MEGAshortscript T7 Transcription Kit (ThermoFisher Scientific) and purified with MEGAclear Transcription Clean-Up Kit (ThermoFisher Scientific). gRNA and Cas9 Nuclease, S pyogenes (NEB) were preincubated for 10 min at room temperature. .. After adding the CD2 PCR product the mix was incubated for either 1 h or 1.5 h at 37 °C and finally analyzed on an agarose gel.

    Cell Culture:

    Article Title: Monoclonal Cell Line Generation and CRISPR/Cas9 Manipulation via Single-Cell Electroporation
    Article Snippet: .. These cells were grown on patterned substrates as described above in “Cell culture and microstamping for cell colony control.” Colonies of 10 to 20 cells were transfected using the NFP-E with a solution containing Cas9 nuclease (NEB) and a guide RNA (targeting sequence: GGGCGAGGAGCUGUUCACCG; Synthego) both at 1 × 10−6 M final in DPBS. .. This gRNA has been shown to efficiently knock-out the green fluorescent protein gene.

    Purification:

    Article Title: T cell-specific inactivation of mouse CD2 by CRISPR/Cas9
    Article Snippet: .. Either PCR product or annealed oligos (PCR primer: T7 CD2.0 F: 5′-taa tac gac tca cta tag ggg act agg ctg gag aag gac c-3′, T7 CD2.0 R: 5′-gca gcg gct aaa aac gga-3′; oligos: T7 promoter F: 5′-taa tac gac tca cta tag gg-3′, CD2.1 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa aca aga cac ccc aga tgg tct ccc cta tag tga gtc gta tta-3′, CD2.2 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa acg aac atc ccc aac ttt caa acc cta tag tga gtc gta tta-3′, CD2.3 R: 5′- aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa act cgc acc tca tca ata tca tcc cta tag tga gtc gta tta-3′) were used to transcribe RNA with MEGAshortscript T7 Transcription Kit (ThermoFisher Scientific) and purified with MEGAclear Transcription Clean-Up Kit (ThermoFisher Scientific). gRNA and Cas9 Nuclease, S pyogenes (NEB) were preincubated for 10 min at room temperature. .. After adding the CD2 PCR product the mix was incubated for either 1 h or 1.5 h at 37 °C and finally analyzed on an agarose gel.

    Concentration Assay:

    Article Title: Antibody discovery and engineering by enhanced CRISPR-Cas9 integration of variable gene cassette libraries in mammalian cells
    Article Snippet: .. In order to test if PnP-lin donor plasmids were recognized and successfully linearized by the Cas9 nuclease, an in vitro digestion assay was set up in a total reaction volume of 30 μl as follows: 16 μl of nuclease-free water (Thermo, AM9937) were mixed with 3 μl of NEBuffer 3.1 (NEB, B7203), 6 μl of 300 nM crRNA-J/tracr RNA complex (final concentration of 60 nM) and 2 μl of 1 μM Cas9 nuclease (NEB, M0386; final concentration of 60 nM) and the mixture was incubated for 10 min at 25°C in order to prepare the RNP complex. .. 3 μl of 30 nM plasmid DNA were added (final concentration of 3 nM) and samples were incubated for 60 min at 37°C.

    Incubation:

    Article Title: Antibody discovery and engineering by enhanced CRISPR-Cas9 integration of variable gene cassette libraries in mammalian cells
    Article Snippet: .. In order to test if PnP-lin donor plasmids were recognized and successfully linearized by the Cas9 nuclease, an in vitro digestion assay was set up in a total reaction volume of 30 μl as follows: 16 μl of nuclease-free water (Thermo, AM9937) were mixed with 3 μl of NEBuffer 3.1 (NEB, B7203), 6 μl of 300 nM crRNA-J/tracr RNA complex (final concentration of 60 nM) and 2 μl of 1 μM Cas9 nuclease (NEB, M0386; final concentration of 60 nM) and the mixture was incubated for 10 min at 25°C in order to prepare the RNP complex. .. 3 μl of 30 nM plasmid DNA were added (final concentration of 3 nM) and samples were incubated for 60 min at 37°C.

    other:

    Article Title: CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method
    Article Snippet: The results indicated that the HPV16 and HPV18 L1 genes could be specifically targeted by their corresponding sgRNA and cut by the guided Cas9 nuclease (Fig. ).

    Article Title: Chromatin-remodeling factor SMARCD2 regulates transcriptional networks controlling differentiation of neutrophil granulocytes
    Article Snippet: Individual sgRNAs (50–200 ng/µl) mixed with 20 µM Cas9 nuclease (New England BioLabs) at a 1:1 ratio were microinjected (500–1,000 pg) into the cytoplasm of one-cell-stage Tg( mpx : EGFP ) embryos.

    Sequencing:

    Article Title: Monoclonal Cell Line Generation and CRISPR/Cas9 Manipulation via Single-Cell Electroporation
    Article Snippet: .. These cells were grown on patterned substrates as described above in “Cell culture and microstamping for cell colony control.” Colonies of 10 to 20 cells were transfected using the NFP-E with a solution containing Cas9 nuclease (NEB) and a guide RNA (targeting sequence: GGGCGAGGAGCUGUUCACCG; Synthego) both at 1 × 10−6 M final in DPBS. .. This gRNA has been shown to efficiently knock-out the green fluorescent protein gene.

    Activated Clotting Time Assay:

    Article Title: T cell-specific inactivation of mouse CD2 by CRISPR/Cas9
    Article Snippet: .. Either PCR product or annealed oligos (PCR primer: T7 CD2.0 F: 5′-taa tac gac tca cta tag ggg act agg ctg gag aag gac c-3′, T7 CD2.0 R: 5′-gca gcg gct aaa aac gga-3′; oligos: T7 promoter F: 5′-taa tac gac tca cta tag gg-3′, CD2.1 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa aca aga cac ccc aga tgg tct ccc cta tag tga gtc gta tta-3′, CD2.2 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa acg aac atc ccc aac ttt caa acc cta tag tga gtc gta tta-3′, CD2.3 R: 5′- aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa act cgc acc tca tca ata tca tcc cta tag tga gtc gta tta-3′) were used to transcribe RNA with MEGAshortscript T7 Transcription Kit (ThermoFisher Scientific) and purified with MEGAclear Transcription Clean-Up Kit (ThermoFisher Scientific). gRNA and Cas9 Nuclease, S pyogenes (NEB) were preincubated for 10 min at room temperature. .. After adding the CD2 PCR product the mix was incubated for either 1 h or 1.5 h at 37 °C and finally analyzed on an agarose gel.

    Cellular Antioxidant Activity Assay:

    Article Title: T cell-specific inactivation of mouse CD2 by CRISPR/Cas9
    Article Snippet: .. Either PCR product or annealed oligos (PCR primer: T7 CD2.0 F: 5′-taa tac gac tca cta tag ggg act agg ctg gag aag gac c-3′, T7 CD2.0 R: 5′-gca gcg gct aaa aac gga-3′; oligos: T7 promoter F: 5′-taa tac gac tca cta tag gg-3′, CD2.1 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa aca aga cac ccc aga tgg tct ccc cta tag tga gtc gta tta-3′, CD2.2 R: 5′-aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa acg aac atc ccc aac ttt caa acc cta tag tga gtc gta tta-3′, CD2.3 R: 5′- aaa agc acc gac tcg gtg cca ctt ttt caa gtt gat aac gga cta gcc tta ttt taa ctt gct att tct agc tct aaa act cgc acc tca tca ata tca tcc cta tag tga gtc gta tta-3′) were used to transcribe RNA with MEGAshortscript T7 Transcription Kit (ThermoFisher Scientific) and purified with MEGAclear Transcription Clean-Up Kit (ThermoFisher Scientific). gRNA and Cas9 Nuclease, S pyogenes (NEB) were preincubated for 10 min at room temperature. .. After adding the CD2 PCR product the mix was incubated for either 1 h or 1.5 h at 37 °C and finally analyzed on an agarose gel.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    New England Biolabs sfc i
    Sfc I, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sfc i/product/New England Biolabs
    Average 94 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    sfc i - by Bioz Stars, 2020-07
    94/100 stars
      Buy from Supplier

    Image Search Results