agei  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    AgeI
    Description:

    Catalog Number:
    R0552
    Price:
    304
    Category:
    Restriction Enzymes
    Applications:
    DNA Manipulation
    Size:
    1500 units
    Buy from Supplier


    Structured Review

    New England Biolabs agei
    AgeI

    https://www.bioz.com/result/agei/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    agei - by Bioz Stars, 2021-07
    95/100 stars

    Images

    1) Product Images from "Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System"

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System

    Journal: Journal of Virology

    doi: 10.1128/JVI.02956-12

    Schematic overview of the construction of the C92/P98 chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + AgeI-F; P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + AgeI-R. (B) Construction of N-terminal
    Figure Legend Snippet: Schematic overview of the construction of the C92/P98 chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + AgeI-F; P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + AgeI-R. (B) Construction of N-terminal

    Techniques Used:

    2) Product Images from "Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System"

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System

    Journal: Journal of Virology

    doi: 10.1128/JVI.02956-12

    Schematic overview of the construction of the C92/P98 chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + AgeI-F; P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + AgeI-R. (B) Construction of N-terminal
    Figure Legend Snippet: Schematic overview of the construction of the C92/P98 chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + AgeI-F; P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + AgeI-R. (B) Construction of N-terminal

    Techniques Used:

    Related Articles

    Incubation:

    Article Title: Sequence saturation mutagenesis (SeSaM): a novel method for directed evolution
    Article Snippet: Two micrograms of purified PCR product (Step 4) was digested with 30 U EcoRI (New England Biolabs) for 3 h at 37°C. .. Next, 20 U of AgeI (New England Biolabs) was added to the digest and incubated for an additional 3 h at 37°C. .. The digested product was purified using the NucleoSpin Extract kit (Machery-Nagel).

    Article Title: The RNA ligase RtcB reverses MazF-induced ribosome heterogeneity in Escherichia coli
    Article Snippet: The RT-PCR product was analyzed on 10% PAA gels in TBE buffer, and purified using ‘PCR clean up kit’ (Qiagen, Hilden, Germany). .. For AgeI restriction analysis the isolated RT-PCR product was incubated with 4 units of AgeI-HF (New England Biolabs) for 30 min at 37°C. .. The restriction fragments were determined using PAA gel-electrophoresis and visualized by EtBr-staining.

    Isolation:

    Article Title: The RNA ligase RtcB reverses MazF-induced ribosome heterogeneity in Escherichia coli
    Article Snippet: The RT-PCR product was analyzed on 10% PAA gels in TBE buffer, and purified using ‘PCR clean up kit’ (Qiagen, Hilden, Germany). .. For AgeI restriction analysis the isolated RT-PCR product was incubated with 4 units of AgeI-HF (New England Biolabs) for 30 min at 37°C. .. The restriction fragments were determined using PAA gel-electrophoresis and visualized by EtBr-staining.

    Article Title: Investigating TNS4 in the Colorectal Tumour Microenvironment Using 3D Spheroid Models of Invasion
    Article Snippet: The shRNA oligos ( ) were annealed at 95°C for 4 min in a PCR thermal cycler and slowly cooled down overnight. .. The annealed oligos were phosphorylated, ligated into pLKO.1-TRC, transformed in chemocompetent E.coli (New England Biolabs), isolated by miniprep and double-digested with restriction enzymes AgeI and EcoRI (both New England Biolabs). .. Correctly inserted oligos were confirmed by restriction enzyme double-digestion with EcoRI and NcoI of the resulting vectors and sequencing.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: The RNA ligase RtcB reverses MazF-induced ribosome heterogeneity in Escherichia coli
    Article Snippet: The RT-PCR product was analyzed on 10% PAA gels in TBE buffer, and purified using ‘PCR clean up kit’ (Qiagen, Hilden, Germany). .. For AgeI restriction analysis the isolated RT-PCR product was incubated with 4 units of AgeI-HF (New England Biolabs) for 30 min at 37°C. .. The restriction fragments were determined using PAA gel-electrophoresis and visualized by EtBr-staining.

    Ligation:

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: The endonuclease reaction mixtures were purified, and the C92 and P98 amplicons were ligated to each other using T4 DNA ligase (NEB). .. The ligation reaction mixture was then digested with AgeI (NEB) and ligated to the AgeI-digested del-C92-TOPO “subclone” ( ). .. The ligation reaction mixture was transformed into E. coli , and the transformants were screened via colony PCR using the Topo-seq-F and Topo-seq-R primers ( ).

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: The endonuclease reaction mixtures were purified, and the C92 and P98 amplicons were ligated to each other using T4 DNA ligase (NEB). .. The ligation reaction mixture was digested with AgeI (NEB) and ligated to AgeI-digested del-C92-TOPO “subclone” ( ). .. The ligation reaction mixture was transformed into E. coli , and colonies were screened by colony PCR using the Topo-seq-F and Topo-seq-R primers ( ).

    Polymerase Chain Reaction:

    Article Title: Novel in vitro booster vaccination to rapidly generate antigen-specific human monoclonal antibodies
    Article Snippet: Each round of PCR was performed for 40 cycles at 94°C for 30 s, 58°C (IgH/Igκ) or 60°C (Igλ) for 30 s, 72°C for 55 s (first PCR) or 45 s (second PCR). .. IgH, Igλ, and Igκ PCR products were purified using Qia-Quick 96 PCR Purification kit (QIAGEN) and digested with the respective restriction enzymes AgeI, SalI, and XhoI (all from New England Biolabs, Inc.). .. Digested PCR products were purified and ligated into human Igγ1, Igκ, and Igλ expression vectors.

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: The primers were designed to introduce a unique AgeI restriction endonuclease site in place of the C92 gene. .. The resulting linear PCR product was purified with the QIAquick PCR purification kit (Qiagen, Germantown, MD), digested with AgeI (NEB), heated to inactivate the enzyme, and purified a second time by excision of the appropriate band from an agarose gel. .. The construct was ligated back to a circular form using T4 DNA ligase (NEB).

    Purification:

    Article Title: Novel in vitro booster vaccination to rapidly generate antigen-specific human monoclonal antibodies
    Article Snippet: Each round of PCR was performed for 40 cycles at 94°C for 30 s, 58°C (IgH/Igκ) or 60°C (Igλ) for 30 s, 72°C for 55 s (first PCR) or 45 s (second PCR). .. IgH, Igλ, and Igκ PCR products were purified using Qia-Quick 96 PCR Purification kit (QIAGEN) and digested with the respective restriction enzymes AgeI, SalI, and XhoI (all from New England Biolabs, Inc.). .. Digested PCR products were purified and ligated into human Igγ1, Igκ, and Igλ expression vectors.

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: The primers were designed to introduce a unique AgeI restriction endonuclease site in place of the C92 gene. .. The resulting linear PCR product was purified with the QIAquick PCR purification kit (Qiagen, Germantown, MD), digested with AgeI (NEB), heated to inactivate the enzyme, and purified a second time by excision of the appropriate band from an agarose gel. .. The construct was ligated back to a circular form using T4 DNA ligase (NEB).

    Transformation Assay:

    Article Title: Investigating TNS4 in the Colorectal Tumour Microenvironment Using 3D Spheroid Models of Invasion
    Article Snippet: The shRNA oligos ( ) were annealed at 95°C for 4 min in a PCR thermal cycler and slowly cooled down overnight. .. The annealed oligos were phosphorylated, ligated into pLKO.1-TRC, transformed in chemocompetent E.coli (New England Biolabs), isolated by miniprep and double-digested with restriction enzymes AgeI and EcoRI (both New England Biolabs). .. Correctly inserted oligos were confirmed by restriction enzyme double-digestion with EcoRI and NcoI of the resulting vectors and sequencing.

    Generated:

    Article Title: Systems biology analysis identifies TCF7L1 as a key regulator of metastasis in Ewing sarcoma
    Article Snippet: The HMG-Box binding site was deleted by fusing two PCR products (Product 1, final Tm 57 °C): forward: 5’-ATTAACCGGTGCCACCATGCCCCAGCTCG-3’; reverse: 5’-CTTACCATAGTTGTCGGGCTTCTTTTCCTCCT-3’; Product 2 (final Tm 64 °C): forward: 5’-GAGGAAAAGAAGCCCGACAACTATGGTAAGAAAAAGAAGAGGA-3’; reverse: 5’-TAATGCGGCCGCTTAAGCGTAATCTGGAACATCGTAGTGGGCAGACTTGGTGACC −3’) using an overhang-extension PCR protocol (overhang-extension PCR (final Tm 65 °C): forward: 5’-ATTAACCGGTGCCACCATGCCCCAGCTCG-3’; reverse: 5’-TAATGCGGCCGCTTAAGCGTAATCTGGAACATCGTAGTGGGCAGACTTGGTGACC −3’). .. The generated inserts were double restriction-digested with AgeI and NotI (NEB) and ligated into the pTP backbone using T4 ligase (NEB). .. Positive clones were identified by colony PCR and cultured in 100 ml of LB Broth containing 100 µg/ml Ampicillin.

    Agarose Gel Electrophoresis:

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: The primers were designed to introduce a unique AgeI restriction endonuclease site in place of the C92 gene. .. The resulting linear PCR product was purified with the QIAquick PCR purification kit (Qiagen, Germantown, MD), digested with AgeI (NEB), heated to inactivate the enzyme, and purified a second time by excision of the appropriate band from an agarose gel. .. The construct was ligated back to a circular form using T4 DNA ligase (NEB).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs agei restriction analysis
    RtcB re-ligates RNA43 to purified 70S Δ43 ribosomes in vitro . ( A ) Schematic showing the in vitro ribosome repair assay (see text for details). ( B ) RNA43 <t>AgeI</t> used in the assay. Nucleotides changed in helix 45 and the binding site for primers Y12 (gray) and H17 (green) are indicated. ( C ) <t>RT-PCR</t> performed on RNA purified from 70S Δ43 ribosomes incubated in the absence of RtcB and RNA43 AgeI (lane 1), in the presence of either RNA43 AgeI (lane 2) or RtcB (lane 3), or both (lane 4) employing primer pairs specific for the central region of 16S rRNA (S7/X15; panel a), the 3΄end of 16S rRNA (S7/Y12; panel b), and specific for the AU nucleotide change present in 16S AgeI rRNA upon successful ligation (S7/H17; panel c). ( D ) AgeI restriction analysis and ( E ), sequencing of the RT-PCR product obtained with primer pair S7/H17 (shown in C, panel c, lane 4). Sequencing analyses from position 1509–1517 of the 16S rRNA of (a) rrsB , and (b) the RT-PCR product are shown. Nucleotides changed in RNA43 AgeI are underlined.
    Agei Restriction Analysis, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/agei restriction analysis/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    agei restriction analysis - by Bioz Stars, 2021-07
    95/100 stars
      Buy from Supplier

    Image Search Results


    RtcB re-ligates RNA43 to purified 70S Δ43 ribosomes in vitro . ( A ) Schematic showing the in vitro ribosome repair assay (see text for details). ( B ) RNA43 AgeI used in the assay. Nucleotides changed in helix 45 and the binding site for primers Y12 (gray) and H17 (green) are indicated. ( C ) RT-PCR performed on RNA purified from 70S Δ43 ribosomes incubated in the absence of RtcB and RNA43 AgeI (lane 1), in the presence of either RNA43 AgeI (lane 2) or RtcB (lane 3), or both (lane 4) employing primer pairs specific for the central region of 16S rRNA (S7/X15; panel a), the 3΄end of 16S rRNA (S7/Y12; panel b), and specific for the AU nucleotide change present in 16S AgeI rRNA upon successful ligation (S7/H17; panel c). ( D ) AgeI restriction analysis and ( E ), sequencing of the RT-PCR product obtained with primer pair S7/H17 (shown in C, panel c, lane 4). Sequencing analyses from position 1509–1517 of the 16S rRNA of (a) rrsB , and (b) the RT-PCR product are shown. Nucleotides changed in RNA43 AgeI are underlined.

    Journal: Nucleic Acids Research

    Article Title: The RNA ligase RtcB reverses MazF-induced ribosome heterogeneity in Escherichia coli

    doi: 10.1093/nar/gkw1018

    Figure Lengend Snippet: RtcB re-ligates RNA43 to purified 70S Δ43 ribosomes in vitro . ( A ) Schematic showing the in vitro ribosome repair assay (see text for details). ( B ) RNA43 AgeI used in the assay. Nucleotides changed in helix 45 and the binding site for primers Y12 (gray) and H17 (green) are indicated. ( C ) RT-PCR performed on RNA purified from 70S Δ43 ribosomes incubated in the absence of RtcB and RNA43 AgeI (lane 1), in the presence of either RNA43 AgeI (lane 2) or RtcB (lane 3), or both (lane 4) employing primer pairs specific for the central region of 16S rRNA (S7/X15; panel a), the 3΄end of 16S rRNA (S7/Y12; panel b), and specific for the AU nucleotide change present in 16S AgeI rRNA upon successful ligation (S7/H17; panel c). ( D ) AgeI restriction analysis and ( E ), sequencing of the RT-PCR product obtained with primer pair S7/H17 (shown in C, panel c, lane 4). Sequencing analyses from position 1509–1517 of the 16S rRNA of (a) rrsB , and (b) the RT-PCR product are shown. Nucleotides changed in RNA43 AgeI are underlined.

    Article Snippet: For AgeI restriction analysis the isolated RT-PCR product was incubated with 4 units of AgeI-HF (New England Biolabs) for 30 min at 37°C.

    Techniques: Purification, In Vitro, Binding Assay, Reverse Transcription Polymerase Chain Reaction, Incubation, Ligation, Sequencing

    Schematic overview of the construction of the C92/P98 chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + AgeI-F; P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + AgeI-R. (B) Construction of N-terminal

    Journal: Journal of Virology

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System

    doi: 10.1128/JVI.02956-12

    Figure Lengend Snippet: Schematic overview of the construction of the C92/P98 chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + AgeI-F; P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + AgeI-R. (B) Construction of N-terminal

    Article Snippet: The ligation reaction mixture was digested with AgeI (NEB) and ligated to AgeI-digested del-C92-TOPO “subclone” ( ).

    Techniques: