acii  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
    Name:
    AciI
    Description:
    AciI 1 000 units
    Catalog Number:
    R0551L
    Price:
    282
    Category:
    Restriction Enzymes
    Size:
    1 000 units
    		Buy from Supplier

    Structured Review

    New England Biolabs acii
    AciI
    AciI 1 000 units
    https://www.bioz.com/result/acii/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    acii - by Bioz Stars, 2021-04
    95/100 stars

    Images

    1) Product Images from "The 2HA line of Medicago truncatula has characteristics of an epigenetic mutant that is weakly ethylene insensitive"

    Article Title: The 2HA line of Medicago truncatula has characteristics of an epigenetic mutant that is weakly ethylene insensitive

    Journal: BMC Plant Biology

    doi: 10.1186/1471-2229-14-174

    Analysis of DNA methylation. (a) Amplified methylation polymorphism (AMP) profiling. DNA from two biological replicates (lanes) was used for AMP before (on the left) or after (right) digestion with HpaII. Arrows point to the differences in methylation between 2HA and Jemalong. (b, c) Analysis of MtEIL1 methylation. (b) The MtEIL1 gene and promoter. Vertical bars depict positions of AciI cut sites, and bisulphate sequenced regions also indicated. After digestion of genomic DNA by AciI, qPCR was performed with primers F2/R2 and F4/R4 separately. (c) qPCR results show amount of undigested DNA due to methylation of digestion sites. Results are mean ± SE of 4 repeats.
    Figure Legend Snippet: Analysis of DNA methylation. (a) Amplified methylation polymorphism (AMP) profiling. DNA from two biological replicates (lanes) was used for AMP before (on the left) or after (right) digestion with HpaII. Arrows point to the differences in methylation between 2HA and Jemalong. (b, c) Analysis of MtEIL1 methylation. (b) The MtEIL1 gene and promoter. Vertical bars depict positions of AciI cut sites, and bisulphate sequenced regions also indicated. After digestion of genomic DNA by AciI, qPCR was performed with primers F2/R2 and F4/R4 separately. (c) qPCR results show amount of undigested DNA due to methylation of digestion sites. Results are mean ± SE of 4 repeats.

    Techniques Used: DNA Methylation Assay, Amplification, Methylation, Real-time Polymerase Chain Reaction

    2) Product Images from "Bisulfite-independent analysis of CpG island methylation enables genome-scale stratification of single cells"

    Article Title: Bisulfite-independent analysis of CpG island methylation enables genome-scale stratification of single cells

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkx026

    Schematic representation of CGI-seq. TEST: single cell being studied. Methylation control (MC): cells that are used to define the detectable CGIs or any other accessible methylated regions (AMRs), sharing the same genome as the TEST. For CGI-seq analysis, the genomic DNA is classified into three classes of sequences: Me-CGIs (representing methylated CGIs, and more generally, Me-AMRs) indicated as a red line, Um-CGIs (unmethylated CGIs, and generally Um-AMRs) indicated as a blue line and undetectable regions indicated as a black line. Green lines are amplified sequences. Solid dot: Me-CpG sites. Hollow dot: Um-CpG sites. The intact gDNA is released from cell (step 1) and digested with RE1 (TEST) or no digestion (MC) (step 2), followed by MDA amplification (step 3). The amplification product is then digested by RE2 (step 4), in which the short fragments are converted t‘o a library and subjected to massive sequencing (step 5). The reads are aligned to the genome (step 6) and the methylation status of the AMRs (particularly CGIs) is determined (‘Materials and Methods’ section). The AMRs detected in both the TEST and the MC are called Me-CGIs (or Me-AMRs). The AMRs uniquely detected in the MC but not in the TEST are called Um-CGIs (or Um-AMRs) of the TEST. RE1 (four MREs in combination: Cfr42I (SacII), PdiI (NaeI), Eco52I (EagI) and PteI(BssHII), FastDigest enzyme from Thermal Scientific Inc.) distinguishes Me-CGIs (Me-AMRs) from Um-CGIs (Um-AMRs). MDA selectively depletes Um-CGIs (Um-AMRs) of the TEST and amplifies Me-CGIs (Me-AMRs). RE2 (either BstUI alone, or a combination of 3 separate REs (ABH: AciI, BstUI and Hinp1I from NEB)) generates fragments specifically enriching CGI sequences (and other CG-rich regions) from non-CGI sequences.
    Figure Legend Snippet: Schematic representation of CGI-seq. TEST: single cell being studied. Methylation control (MC): cells that are used to define the detectable CGIs or any other accessible methylated regions (AMRs), sharing the same genome as the TEST. For CGI-seq analysis, the genomic DNA is classified into three classes of sequences: Me-CGIs (representing methylated CGIs, and more generally, Me-AMRs) indicated as a red line, Um-CGIs (unmethylated CGIs, and generally Um-AMRs) indicated as a blue line and undetectable regions indicated as a black line. Green lines are amplified sequences. Solid dot: Me-CpG sites. Hollow dot: Um-CpG sites. The intact gDNA is released from cell (step 1) and digested with RE1 (TEST) or no digestion (MC) (step 2), followed by MDA amplification (step 3). The amplification product is then digested by RE2 (step 4), in which the short fragments are converted t‘o a library and subjected to massive sequencing (step 5). The reads are aligned to the genome (step 6) and the methylation status of the AMRs (particularly CGIs) is determined (‘Materials and Methods’ section). The AMRs detected in both the TEST and the MC are called Me-CGIs (or Me-AMRs). The AMRs uniquely detected in the MC but not in the TEST are called Um-CGIs (or Um-AMRs) of the TEST. RE1 (four MREs in combination: Cfr42I (SacII), PdiI (NaeI), Eco52I (EagI) and PteI(BssHII), FastDigest enzyme from Thermal Scientific Inc.) distinguishes Me-CGIs (Me-AMRs) from Um-CGIs (Um-AMRs). MDA selectively depletes Um-CGIs (Um-AMRs) of the TEST and amplifies Me-CGIs (Me-AMRs). RE2 (either BstUI alone, or a combination of 3 separate REs (ABH: AciI, BstUI and Hinp1I from NEB)) generates fragments specifically enriching CGI sequences (and other CG-rich regions) from non-CGI sequences.

    Techniques Used: Methylation, Amplification, Multiple Displacement Amplification, Sequencing

    3) Product Images from "Hose in Hose, an S locus-linked mutant of Primula vulgaris, is caused by an unstable mutation at the Globosa locus"

    Article Title: Hose in Hose, an S locus-linked mutant of Primula vulgaris, is caused by an unstable mutation at the Globosa locus

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.0910955107

    Retrotransposon excision is associated with demethylation of the PvGlo locus. ( A ) Organization of wild-type, transposon, and revertant alleles of PvGlo showing location of upstream methylation-sensitive AciI restriction enzyme sites. The PvGlo -specific primers (F1, R1, R3) and transposon-specific PCR primers (R2, F2) are indicated. The retrotransposon insertion site is shown (-723); LTRs are shown in gray. ( B ) Methylation-sensitive PCR analysis of the wild-type, transposon, and revertant alleles of PvGlo using allele-specific primer combinations as indicated. Primer specificity is demonstrated on DNA from leaves of wild-type (wt) and homozygous Hose in Hose (HH) plants. DNA samples from whorl-1 tissue or combined whorl-2, -3, and -4 tissue from revertant (R), semirevertant (SR), and Hose in Hose (H) flowers from the same plant were either digested with Aci1 or uncut as indicated before PCR amplification using allele-specific primer combinations as shown before fractionation by agarose gel electrophoresis. The different alleles amplified by each primer combination are indicated and the excision allele-specific PCR product is highlighted (*). PCR products generated from uncut genomic DNA that are absent after predigestion with AciI reveal unmethylated sites.
    Figure Legend Snippet: Retrotransposon excision is associated with demethylation of the PvGlo locus. ( A ) Organization of wild-type, transposon, and revertant alleles of PvGlo showing location of upstream methylation-sensitive AciI restriction enzyme sites. The PvGlo -specific primers (F1, R1, R3) and transposon-specific PCR primers (R2, F2) are indicated. The retrotransposon insertion site is shown (-723); LTRs are shown in gray. ( B ) Methylation-sensitive PCR analysis of the wild-type, transposon, and revertant alleles of PvGlo using allele-specific primer combinations as indicated. Primer specificity is demonstrated on DNA from leaves of wild-type (wt) and homozygous Hose in Hose (HH) plants. DNA samples from whorl-1 tissue or combined whorl-2, -3, and -4 tissue from revertant (R), semirevertant (SR), and Hose in Hose (H) flowers from the same plant were either digested with Aci1 or uncut as indicated before PCR amplification using allele-specific primer combinations as shown before fractionation by agarose gel electrophoresis. The different alleles amplified by each primer combination are indicated and the excision allele-specific PCR product is highlighted (*). PCR products generated from uncut genomic DNA that are absent after predigestion with AciI reveal unmethylated sites.

    Techniques Used: Methylation, Polymerase Chain Reaction, Amplification, Fractionation, Agarose Gel Electrophoresis, Generated

    4) Product Images from "Epigenetic regulation of matrix metalloproteinase expression in ameloblastoma"

    Article Title: Epigenetic regulation of matrix metalloproteinase expression in ameloblastoma

    Journal: BMC Clinical Pathology

    doi: 10.1186/1472-6890-12-11

    Representative figure of the methylation analysis. A : Methylation status of MMP-2 in ameloblastoma. M: PCR products when amplified by methylated primers (205 bp); U: PCR products when amplified by unmethylated primers (206 bp); +M: positive control for methylated reaction; +U: positive control for unmethylated reaction. -M and -U: negative controls without DNA. Lines 1 to 3 represent DNA from ameloblastoma samples. B : Methylation status of MMP-9 in ameloblastoma. DNA samples were digested by the AciI restriction enzyme followed by PCR, flanking the restriction sites. Absent band indicates unmethylated profile (U) due to DNA cleavage by the restriction enzyme. Presence of the PCR band represents methylated profile (M) of the MMP-9 gene. +M: methylated positive control; +U: unmethylated positive control; - : negative control without DNA.
    Figure Legend Snippet: Representative figure of the methylation analysis. A : Methylation status of MMP-2 in ameloblastoma. M: PCR products when amplified by methylated primers (205 bp); U: PCR products when amplified by unmethylated primers (206 bp); +M: positive control for methylated reaction; +U: positive control for unmethylated reaction. -M and -U: negative controls without DNA. Lines 1 to 3 represent DNA from ameloblastoma samples. B : Methylation status of MMP-9 in ameloblastoma. DNA samples were digested by the AciI restriction enzyme followed by PCR, flanking the restriction sites. Absent band indicates unmethylated profile (U) due to DNA cleavage by the restriction enzyme. Presence of the PCR band represents methylated profile (M) of the MMP-9 gene. +M: methylated positive control; +U: unmethylated positive control; - : negative control without DNA.

    Techniques Used: Methylation, Polymerase Chain Reaction, Amplification, Positive Control, Negative Control

    5) Product Images from "How to Isolate a Plant's Hypomethylome in One Shot"

    Article Title: How to Isolate a Plant's Hypomethylome in One Shot

    Journal: BioMed Research International

    doi: 10.1155/2015/570568

    Complementary identification of genomic regions in rice due to restriction site locations. A detailed representation of the mapping results is shown for both enzymes, AciI and HpaII. The identified regions around the displayed gene differ due to the lack of recognition sites for the other enzyme. On the right, an example for overlapping but expanded regions is given.
    Figure Legend Snippet: Complementary identification of genomic regions in rice due to restriction site locations. A detailed representation of the mapping results is shown for both enzymes, AciI and HpaII. The identified regions around the displayed gene differ due to the lack of recognition sites for the other enzyme. On the right, an example for overlapping but expanded regions is given.

    Techniques Used:

    Length distribution of genomic regions identified for AciI, HpaII, and the combined dataset in rice. The length distribution of hypomethylated regions identified with the three datasets up to the maximal length is shown as well as a closer view to the region between 0 and 2.000 bp, where an increase in length is visible for the combined dataset. Additionally, the amount of regions, the average and maximum length, and the average reads per region are given.
    Figure Legend Snippet: Length distribution of genomic regions identified for AciI, HpaII, and the combined dataset in rice. The length distribution of hypomethylated regions identified with the three datasets up to the maximal length is shown as well as a closer view to the region between 0 and 2.000 bp, where an increase in length is visible for the combined dataset. Additionally, the amount of regions, the average and maximum length, and the average reads per region are given.

    Techniques Used:

    Genes and transposable elements identified in the rice genome with the methyl filtration technique. The regions comprised of at least five reads (left), and all regions (middle) show a clear depletion of transposable elements for AciI, Bsh1236I, and HpaII. On the right a representation of genes and transposable elements is given showing potential methylation sites within their gene space. All values are shown in percent based on the annotated 39.954 genes and 15.847 transposable elements.
    Figure Legend Snippet: Genes and transposable elements identified in the rice genome with the methyl filtration technique. The regions comprised of at least five reads (left), and all regions (middle) show a clear depletion of transposable elements for AciI, Bsh1236I, and HpaII. On the right a representation of genes and transposable elements is given showing potential methylation sites within their gene space. All values are shown in percent based on the annotated 39.954 genes and 15.847 transposable elements.

    Techniques Used: Filtration, Methylation

    6) Product Images from "Selective amplification of hypermethylated DNA from diverse tumor types via MSRE-PCR"

    Article Title: Selective amplification of hypermethylated DNA from diverse tumor types via MSRE-PCR

    Journal: Oncotarget

    doi: 10.18632/oncotarget.27825

    Methylation sensitive restriction sites in target cDMRs. Five MSREs are considered here: HhaI, HpaII, HpyCH4IV, AciI and BstUI. ( A ) Histogram of the number of MSRE sites in the target regions. ( B ) Scatterplot of the number of MSRE sites versus the number of CpGs in the target regions showing a linear relationship (R 2 = 0.89, p
    Figure Legend Snippet: Methylation sensitive restriction sites in target cDMRs. Five MSREs are considered here: HhaI, HpaII, HpyCH4IV, AciI and BstUI. ( A ) Histogram of the number of MSRE sites in the target regions. ( B ) Scatterplot of the number of MSRE sites versus the number of CpGs in the target regions showing a linear relationship (R 2 = 0.89, p

    Techniques Used: Methylation

    7) Product Images from "Allele-specific DNA methylation of disease susceptibility genes in Japanese patients with inflammatory bowel disease"

    Article Title: Allele-specific DNA methylation of disease susceptibility genes in Japanese patients with inflammatory bowel disease

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0194036

    Schema of methylation-sensitive SNP array. If allele-specific DNA methylation (ASM) around heterozygous SNP A/C exists (which is hypermethylated around A allele and hypomethylated around C allele), SNP is called A/C in micro array before digestion and A/A after digestion by MSREs. Thus, the probes heterozygous in uncut genomic DNA and homozygous in MSREs-digested DNA indicate ASM around SNP. Because we expect methylation skew between two alleles, all heterozygous SNPs which the ratio of signal intensities given two alleles changed after digestion should be extracted. SNP, single-nucleotide polymorphisms; MSREs, methylation-sensitive restriction enzymes, which contain HpaII ( 5′-CˆCGG-3′ ), HhaI ( 5′-GCGˆC-3′ ), and AciI ( 5′-CˆCGC-3′ ).
    Figure Legend Snippet: Schema of methylation-sensitive SNP array. If allele-specific DNA methylation (ASM) around heterozygous SNP A/C exists (which is hypermethylated around A allele and hypomethylated around C allele), SNP is called A/C in micro array before digestion and A/A after digestion by MSREs. Thus, the probes heterozygous in uncut genomic DNA and homozygous in MSREs-digested DNA indicate ASM around SNP. Because we expect methylation skew between two alleles, all heterozygous SNPs which the ratio of signal intensities given two alleles changed after digestion should be extracted. SNP, single-nucleotide polymorphisms; MSREs, methylation-sensitive restriction enzymes, which contain HpaII ( 5′-CˆCGG-3′ ), HhaI ( 5′-GCGˆC-3′ ), and AciI ( 5′-CˆCGC-3′ ).

    Techniques Used: Methylation, DNA Methylation Assay, Microarray

    8) Product Images from "Genetic and Physical Mapping of DNA Replication Origins in Haloferax volcanii"

    Article Title: Genetic and Physical Mapping of DNA Replication Origins in Haloferax volcanii

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.0030077

    DNA Replication Origin on Contig 454 Is on Chromosomes pHV1 and pHV4 (A) Sequence features of the ARS element isolated from genomic libraries of WR340 DNA. Coordinates of plasmid inserts generated by HpaII and AciI digestion are shown (including insert in pTA194), in addition to the minimal ARS element determined by AciI digestion (in pTA250) or PCR amplification (in pCN12). Numbering refers to TIGR contig 454 (pHV1). (B) Sequence of repeats found at the intergenic region of the pHV1/4 replication origin (correspond to numbered arrows in Figure 1 A). Orientation is indicated by arrows (righthand side) and conserved sequences are shaded. Six of the 13 repeats feature a complete ORB element (boxed), while a core mini-ORB element is conserved in all repeats. The sequence motif found in repeats surrounding the DUE is indicated by the dashed box. (C) Southern blot of PFG of intact DNA from strains H53 and H230, probed with HpaII ARS insert from pTA194, or intergenic region replaced by trpA in pTA266 (see Figure 1 D). (D) Intergenic region of ori-pHV1/4 was replaced by trpA marker by using the deletion construct pTA266. H. volcanii H53 was transformed with pTA266 to generate H220, which was used to derive the pHV1/4 origin deletion strain H230. Predicted fragment sizes of StuI digest are indicated. (E) StuI digest of genomic DNA from strains H53, H220, and H230, probed with DNA flanking the intergenic region. The band indicated * represents episomal DNA carrying the pHV1/4 origin, resulting from excision of the integrated plasmid.
    Figure Legend Snippet: DNA Replication Origin on Contig 454 Is on Chromosomes pHV1 and pHV4 (A) Sequence features of the ARS element isolated from genomic libraries of WR340 DNA. Coordinates of plasmid inserts generated by HpaII and AciI digestion are shown (including insert in pTA194), in addition to the minimal ARS element determined by AciI digestion (in pTA250) or PCR amplification (in pCN12). Numbering refers to TIGR contig 454 (pHV1). (B) Sequence of repeats found at the intergenic region of the pHV1/4 replication origin (correspond to numbered arrows in Figure 1 A). Orientation is indicated by arrows (righthand side) and conserved sequences are shaded. Six of the 13 repeats feature a complete ORB element (boxed), while a core mini-ORB element is conserved in all repeats. The sequence motif found in repeats surrounding the DUE is indicated by the dashed box. (C) Southern blot of PFG of intact DNA from strains H53 and H230, probed with HpaII ARS insert from pTA194, or intergenic region replaced by trpA in pTA266 (see Figure 1 D). (D) Intergenic region of ori-pHV1/4 was replaced by trpA marker by using the deletion construct pTA266. H. volcanii H53 was transformed with pTA266 to generate H220, which was used to derive the pHV1/4 origin deletion strain H230. Predicted fragment sizes of StuI digest are indicated. (E) StuI digest of genomic DNA from strains H53, H220, and H230, probed with DNA flanking the intergenic region. The band indicated * represents episomal DNA carrying the pHV1/4 origin, resulting from excision of the integrated plasmid.

    Techniques Used: Sequencing, Isolation, Plasmid Preparation, Generated, Polymerase Chain Reaction, Amplification, Southern Blot, Marker, Construct, Transformation Assay

    DNA Replication Origin on the Main Chromosome: oriC1 (A) Sequence features of the ARS element isolated from genomic libraries of H230 DNA, including selected genes (see text for details). Coordinates of plasmid inserts generated by AciI digestion are shown (including insert in pTA313), in addition to the minimal ARS element in pTA441 and pCN11. See Figure 1 A for key. Numbering refers to TIGR contig number 455. Main chromosome, Chr. (B) Above the line are sequences of repeats found at the intergenic region of the H. volcanii chromosomal replication origin (correspond to numbered arrows in Figure 2 A). Below the line are sequences of repeats found at other (presumed) archaeal origins. The species and relevant cdc6/orc1 genes are H. marismortui cdc6–4 (Hmar-1–2), Halobacterium sp. NRC-1 orc7 (NRC1-1-2), Natronomonas pharaonis cdc6–1 (Npha-1–2), S. solfataricus cdc6–1 (Sso-1–2), and P. abyssi cdc6 (Pab-1–4). The orientation is indicated by arrows and conserved positions are shaded. Among halophilic archaea, repeats surrounding the primary DUE feature a longer consensus sequence (Halo-ORB, boxed), which contains the core mini-ORB and “G-string” elements also found in other archaea, plus a halophile-specific “G-string.” (C) Southern blot of PFG of DNA from strain H53, probed with the AciI ARS insert from pTA313.
    Figure Legend Snippet: DNA Replication Origin on the Main Chromosome: oriC1 (A) Sequence features of the ARS element isolated from genomic libraries of H230 DNA, including selected genes (see text for details). Coordinates of plasmid inserts generated by AciI digestion are shown (including insert in pTA313), in addition to the minimal ARS element in pTA441 and pCN11. See Figure 1 A for key. Numbering refers to TIGR contig number 455. Main chromosome, Chr. (B) Above the line are sequences of repeats found at the intergenic region of the H. volcanii chromosomal replication origin (correspond to numbered arrows in Figure 2 A). Below the line are sequences of repeats found at other (presumed) archaeal origins. The species and relevant cdc6/orc1 genes are H. marismortui cdc6–4 (Hmar-1–2), Halobacterium sp. NRC-1 orc7 (NRC1-1-2), Natronomonas pharaonis cdc6–1 (Npha-1–2), S. solfataricus cdc6–1 (Sso-1–2), and P. abyssi cdc6 (Pab-1–4). The orientation is indicated by arrows and conserved positions are shaded. Among halophilic archaea, repeats surrounding the primary DUE feature a longer consensus sequence (Halo-ORB, boxed), which contains the core mini-ORB and “G-string” elements also found in other archaea, plus a halophile-specific “G-string.” (C) Southern blot of PFG of DNA from strain H53, probed with the AciI ARS insert from pTA313.

    Techniques Used: Sequencing, Isolation, Plasmid Preparation, Generated, Southern Blot

    9) Product Images from "Allele-specific DNA methylation of disease susceptibility genes in Japanese patients with inflammatory bowel disease"

    Article Title: Allele-specific DNA methylation of disease susceptibility genes in Japanese patients with inflammatory bowel disease

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0194036

    Schema of methylation-sensitive SNP array. If allele-specific DNA methylation (ASM) around heterozygous SNP A/C exists (which is hypermethylated around A allele and hypomethylated around C allele), SNP is called A/C in micro array before digestion and A/A after digestion by MSREs. Thus, the probes heterozygous in uncut genomic DNA and homozygous in MSREs-digested DNA indicate ASM around SNP. Because we expect methylation skew between two alleles, all heterozygous SNPs which the ratio of signal intensities given two alleles changed after digestion should be extracted. SNP, single-nucleotide polymorphisms; MSREs, methylation-sensitive restriction enzymes, which contain HpaII ( 5′-CˆCGG-3′ ), HhaI ( 5′-GCGˆC-3′ ), and AciI ( 5′-CˆCGC-3′ ).
    Figure Legend Snippet: Schema of methylation-sensitive SNP array. If allele-specific DNA methylation (ASM) around heterozygous SNP A/C exists (which is hypermethylated around A allele and hypomethylated around C allele), SNP is called A/C in micro array before digestion and A/A after digestion by MSREs. Thus, the probes heterozygous in uncut genomic DNA and homozygous in MSREs-digested DNA indicate ASM around SNP. Because we expect methylation skew between two alleles, all heterozygous SNPs which the ratio of signal intensities given two alleles changed after digestion should be extracted. SNP, single-nucleotide polymorphisms; MSREs, methylation-sensitive restriction enzymes, which contain HpaII ( 5′-CˆCGG-3′ ), HhaI ( 5′-GCGˆC-3′ ), and AciI ( 5′-CˆCGC-3′ ).

    Techniques Used: Methylation, DNA Methylation Assay, Microarray

    10) Product Images from "Molecular Identification of Mucor and Lichtheimia Species in Pure Cultures of Zygomycetes"

    Article Title: Molecular Identification of Mucor and Lichtheimia Species in Pure Cultures of Zygomycetes

    Journal: Jundishapur Journal of Microbiology

    doi: 10.5812/jjm.35237

    Agarose Gel Electrophoresis of 18sS rRNA PCR Products of Different Mucorals After Restriction Digestion With XmnI and AcII Lanes 12, 11, 10, 9, 8, 2 and 13, M. circinelloides , M. racemosus , M. ramosissimus or M. plumbeus ; Lanes 3, 1, 7, 6, 5, 4, and 14, L. corymbifera or L. blakesleeana ; N, negative control; M, 100 bp molecular size marker.
    Figure Legend Snippet: Agarose Gel Electrophoresis of 18sS rRNA PCR Products of Different Mucorals After Restriction Digestion With XmnI and AcII Lanes 12, 11, 10, 9, 8, 2 and 13, M. circinelloides , M. racemosus , M. ramosissimus or M. plumbeus ; Lanes 3, 1, 7, 6, 5, 4, and 14, L. corymbifera or L. blakesleeana ; N, negative control; M, 100 bp molecular size marker.

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Negative Control, Marker

    11) Product Images from "Epstein-Barr Virus Rta-Mediated Accumulation of DNA Methylation Interferes with CTCF Binding in both Host and Viral Genomes"

    Article Title: Epstein-Barr Virus Rta-Mediated Accumulation of DNA Methylation Interferes with CTCF Binding in both Host and Viral Genomes

    Journal: Journal of Virology

    doi: 10.1128/JVI.00736-17

    EBV Rta expression increases DNA methylation and decreases CTCF binding in the promoter regions of MYC , CCND1 , and JUN . (A, left) Schematic diagrams of methylation-sensitive restriction enzyme sites, CTCF binding sites, and Rta binding sites in each target promoter region. These regions contain no EcoRI site, thus EcoRI served as an input control for AciI, HpaII, and HinP1I. The MYC gene body without Rta and CTCF binding sites served as a negative control (N.C.). Lengths of promoters are illustrated to scale. (Right) CpG methylation levels in the cellular promoters of 293TetLuc and 293TetER cells. Cellular DNAs of paired untreated and doxycycline (Dox)-treated (12 and 24 h) cells were extracted and subjected to restriction enzyme digestions. DNA fragments protected by each methylation-sensitive enzyme were quantified by real-time PCR. Fold changes of each restriction enzyme assessment denote the relative CpG methylation levels in the Dox-treated cells compared to their untreated counterparts. Error bars depict the means ± SD from four independent experiments. Student's t test was used to evaluate the significant difference between the indicated data set. ***, P
    Figure Legend Snippet: EBV Rta expression increases DNA methylation and decreases CTCF binding in the promoter regions of MYC , CCND1 , and JUN . (A, left) Schematic diagrams of methylation-sensitive restriction enzyme sites, CTCF binding sites, and Rta binding sites in each target promoter region. These regions contain no EcoRI site, thus EcoRI served as an input control for AciI, HpaII, and HinP1I. The MYC gene body without Rta and CTCF binding sites served as a negative control (N.C.). Lengths of promoters are illustrated to scale. (Right) CpG methylation levels in the cellular promoters of 293TetLuc and 293TetER cells. Cellular DNAs of paired untreated and doxycycline (Dox)-treated (12 and 24 h) cells were extracted and subjected to restriction enzyme digestions. DNA fragments protected by each methylation-sensitive enzyme were quantified by real-time PCR. Fold changes of each restriction enzyme assessment denote the relative CpG methylation levels in the Dox-treated cells compared to their untreated counterparts. Error bars depict the means ± SD from four independent experiments. Student's t test was used to evaluate the significant difference between the indicated data set. ***, P

    Techniques Used: Expressing, DNA Methylation Assay, Binding Assay, Methylation, Negative Control, CpG Methylation Assay, Real-time Polymerase Chain Reaction

    12) Product Images from "Comparison of Bacteroides-Prevotella 16S rRNA Genetic Markers for Fecal Samples from Different Animal Species"

    Article Title: Comparison of Bacteroides-Prevotella 16S rRNA Genetic Markers for Fecal Samples from Different Animal Species

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.71.10.5999-6007.2005

    Examples of T-RFLP peaks resulting from cow and human fecal samples cut with AciI, MspI, and HaeIII.
    Figure Legend Snippet: Examples of T-RFLP peaks resulting from cow and human fecal samples cut with AciI, MspI, and HaeIII.

    Techniques Used:

    Related Articles

    Methylation:

    Article Title: The 2HA line of Medicago truncatula has characteristics of an epigenetic mutant that is weakly ethylene insensitive
    Article Snippet: The Amplified methylation polymorphism (AMP) protocol for arbitrarily detecting DNA methylation variation in genomic DNA was that described in [ ]. .. To test for differential methylation within MtEIL1 in 2HA and Jemalong e.g. [ ], DNA (10 μg) was digested overnight by AciI (New England Biolabs, http://www.neb.com ) and cleaned through a PCR clean up column (Promega, http://www.promega.com ). ..

    Article Title: Hose in Hose, an S locus-linked mutant of Primula vulgaris, is caused by an unstable mutation at the Globosa locus
    Article Snippet: PvGlo promoter sequences were obtained from wild-type and Hose in Hose homozygote and heterozygote plants using a Genome Walker Kit (Clontech). .. For PCR and methylation analysis, genomic DNA (1 μg) was digested overnight with 20 U AciI (New England Biolabs), and digested DNA was used as templates for PCR. ..

    Polymerase Chain Reaction:

    Article Title: The 2HA line of Medicago truncatula has characteristics of an epigenetic mutant that is weakly ethylene insensitive
    Article Snippet: The Amplified methylation polymorphism (AMP) protocol for arbitrarily detecting DNA methylation variation in genomic DNA was that described in [ ]. .. To test for differential methylation within MtEIL1 in 2HA and Jemalong e.g. [ ], DNA (10 μg) was digested overnight by AciI (New England Biolabs, http://www.neb.com ) and cleaned through a PCR clean up column (Promega, http://www.promega.com ). ..

    Article Title: Hose in Hose, an S locus-linked mutant of Primula vulgaris, is caused by an unstable mutation at the Globosa locus
    Article Snippet: PvGlo promoter sequences were obtained from wild-type and Hose in Hose homozygote and heterozygote plants using a Genome Walker Kit (Clontech). .. For PCR and methylation analysis, genomic DNA (1 μg) was digested overnight with 20 U AciI (New England Biolabs), and digested DNA was used as templates for PCR. ..

    Incubation:

    Article Title: Modulation of Enhancer Looping and Differential Gene Targeting by Epstein-Barr Virus Transcription Factors Directs Cellular Reprogramming
    Article Snippet: Triton X-100 was then added to the nuclei to give a final concentration of 2% and the samples incubated for 1 hr at 37°C with shaking. .. 400 U EcoR I-HF, Hind III or Aci I (New England Biolabs) were added to the nuclei and the samples incubated at 37°C overnight with shaking. .. The digestion reaction was stopped by addition of sodium dodecyl sulphate to a final concentration of 1.6% and incubation at 65°C for 25 mins with shaking.

    Article Title: Considerations When Analyzing the Methylation Status of PTEN Tumor Suppressor Gene
    Article Snippet: .. Three hundred nanograms of genomic cell line DNA was incubated with 10 units of Aci I (New England Biolabs) at 37°C for 16 hours. .. Aci I digests only unmethylated DNA at its recognition sequence (5′- C↓ CGC- 3′), leaving methylated sites intact.

    Sequencing:

    Article Title: Bisulfite-independent analysis of CpG island methylation enables genome-scale stratification of single cells
    Article Snippet: The sizes of PCR products and the sequences of primers used are the following: CGP1, 160 bp, TCACTGCAAGCTCTGCCTCT, CGGATCACGAGGTCAGAAGA; CGP2, 178 bp, CATGCCTATAACCCCAGCAC, ATTCTCCTGCCTCAGCCTCT; CGN1 (with gene C19), 185 bp, TAGACCGGGGTCGGGACAGGA, TGCCCGACAGGGCGTGTTTGA; CGN2 (with gene ACTB), 221bp, GTGGACATCTCTTGGGCACT, GACCCACCCAGCACATTTAG. .. Library construction for reduced representation sequencing To enrich the sequences for CGIs and other CpG-rich regions, 1.5 μg of amplified DNA from each sample was divided into three equal amounts and digested by one of the three RE2 reagents respectively: AciI, BstUI and Hinp1I (NEB), called ABH collectively. .. The condition of incubation is 3 h at 60°C for BstUI and at 37°C for AciI and Hinp1I.

    Amplification:

    Article Title: Bisulfite-independent analysis of CpG island methylation enables genome-scale stratification of single cells
    Article Snippet: The sizes of PCR products and the sequences of primers used are the following: CGP1, 160 bp, TCACTGCAAGCTCTGCCTCT, CGGATCACGAGGTCAGAAGA; CGP2, 178 bp, CATGCCTATAACCCCAGCAC, ATTCTCCTGCCTCAGCCTCT; CGN1 (with gene C19), 185 bp, TAGACCGGGGTCGGGACAGGA, TGCCCGACAGGGCGTGTTTGA; CGN2 (with gene ACTB), 221bp, GTGGACATCTCTTGGGCACT, GACCCACCCAGCACATTTAG. .. Library construction for reduced representation sequencing To enrich the sequences for CGIs and other CpG-rich regions, 1.5 μg of amplified DNA from each sample was divided into three equal amounts and digested by one of the three RE2 reagents respectively: AciI, BstUI and Hinp1I (NEB), called ABH collectively. .. The condition of incubation is 3 h at 60°C for BstUI and at 37°C for AciI and Hinp1I.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • acii  (New England Biolabs)
    95
    New England Biolabs acii
    Analysis of DNA methylation. (a) Amplified methylation polymorphism (AMP) profiling. DNA from two biological replicates (lanes) was used for AMP before (on the left) or after (right) digestion with HpaII. Arrows point to the differences in methylation between 2HA and <t>Jemalong.</t> (b, c) Analysis of MtEIL1 methylation. (b) The MtEIL1 gene and promoter. Vertical bars depict positions of <t>AciI</t> cut sites, and bisulphate sequenced regions also indicated. After digestion of genomic DNA by AciI, qPCR was performed with primers F2/R2 and F4/R4 separately. (c) qPCR results show amount of undigested DNA due to methylation of digestion sites. Results are mean ± SE of 4 repeats.
    Acii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/acii/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    acii - by Bioz Stars, 2021-04
    95/100 stars
    		  Buy from Supplier

    Image Search Results


    Analysis of DNA methylation. (a) Amplified methylation polymorphism (AMP) profiling. DNA from two biological replicates (lanes) was used for AMP before (on the left) or after (right) digestion with HpaII. Arrows point to the differences in methylation between 2HA and Jemalong. (b, c) Analysis of MtEIL1 methylation. (b) The MtEIL1 gene and promoter. Vertical bars depict positions of AciI cut sites, and bisulphate sequenced regions also indicated. After digestion of genomic DNA by AciI, qPCR was performed with primers F2/R2 and F4/R4 separately. (c) qPCR results show amount of undigested DNA due to methylation of digestion sites. Results are mean ± SE of 4 repeats.

    Journal: BMC Plant Biology

    Article Title: The 2HA line of Medicago truncatula has characteristics of an epigenetic mutant that is weakly ethylene insensitive

    doi: 10.1186/1471-2229-14-174

    Figure Lengend Snippet: Analysis of DNA methylation. (a) Amplified methylation polymorphism (AMP) profiling. DNA from two biological replicates (lanes) was used for AMP before (on the left) or after (right) digestion with HpaII. Arrows point to the differences in methylation between 2HA and Jemalong. (b, c) Analysis of MtEIL1 methylation. (b) The MtEIL1 gene and promoter. Vertical bars depict positions of AciI cut sites, and bisulphate sequenced regions also indicated. After digestion of genomic DNA by AciI, qPCR was performed with primers F2/R2 and F4/R4 separately. (c) qPCR results show amount of undigested DNA due to methylation of digestion sites. Results are mean ± SE of 4 repeats.

    Article Snippet: To test for differential methylation within MtEIL1 in 2HA and Jemalong e.g. [ ], DNA (10 μg) was digested overnight by AciI (New England Biolabs, http://www.neb.com ) and cleaned through a PCR clean up column (Promega, http://www.promega.com ).

    Techniques: DNA Methylation Assay, Amplification, Methylation, Real-time Polymerase Chain Reaction

    The influence of EBNA 3C on chromosome looping at the ADAM28/ADAMDEC1 locus. (A) Diagram (not to scale) showing the Hind III restriction fragments around the ADAM28 locus that encompass the promoter (P), the ADAM enhancer (E, located downstream of ADAM28 ) and two intervening control regions (con1 and con2). The arrow indicates the direction of transcription. (B) Chromosome conformation analysis of the ADAM28 locus in the pz1 control BJAB cell line (−) and the E3C-3 stable EBNA 3C expressing cell line (+) using primer pairs that amplify across promoter-enhancer or promoter-control ligation junctions. Positive controls show PCR amplification from control digestion and ligation reactions carried out using PCR-amplified DNA fragments encompassing the promoter, enhancer and control regions. (C) Diagram (not to scale) showing the Aci I restriction fragments around the ADAMDEC1 locus that encompass the promoter (P), the ADAM enhancer (E, located upstream of ADAMDEC1 ) and an intervening control region (con). The arrow indicates the direction of transcription. (D) Chromosome conformation analysis of the ADAMDEC1 locus in the pz1 control BJAB cell line (−) and the E3C-3 stable EBNA 3C expressing cell line (+) using primer pairs that amplify across promoter-enhancer or promoter-control ligation junctions. Positive controls show PCR amplification from control digestion and ligation reactions carried out using PCR-amplified DNA fragments encompassing the promoter, enhancer and control region.

    Journal: PLoS Pathogens

    Article Title: Modulation of Enhancer Looping and Differential Gene Targeting by Epstein-Barr Virus Transcription Factors Directs Cellular Reprogramming

    doi: 10.1371/journal.ppat.1003636

    Figure Lengend Snippet: The influence of EBNA 3C on chromosome looping at the ADAM28/ADAMDEC1 locus. (A) Diagram (not to scale) showing the Hind III restriction fragments around the ADAM28 locus that encompass the promoter (P), the ADAM enhancer (E, located downstream of ADAM28 ) and two intervening control regions (con1 and con2). The arrow indicates the direction of transcription. (B) Chromosome conformation analysis of the ADAM28 locus in the pz1 control BJAB cell line (−) and the E3C-3 stable EBNA 3C expressing cell line (+) using primer pairs that amplify across promoter-enhancer or promoter-control ligation junctions. Positive controls show PCR amplification from control digestion and ligation reactions carried out using PCR-amplified DNA fragments encompassing the promoter, enhancer and control regions. (C) Diagram (not to scale) showing the Aci I restriction fragments around the ADAMDEC1 locus that encompass the promoter (P), the ADAM enhancer (E, located upstream of ADAMDEC1 ) and an intervening control region (con). The arrow indicates the direction of transcription. (D) Chromosome conformation analysis of the ADAMDEC1 locus in the pz1 control BJAB cell line (−) and the E3C-3 stable EBNA 3C expressing cell line (+) using primer pairs that amplify across promoter-enhancer or promoter-control ligation junctions. Positive controls show PCR amplification from control digestion and ligation reactions carried out using PCR-amplified DNA fragments encompassing the promoter, enhancer and control region.

    Article Snippet: 400 U EcoR I-HF, Hind III or Aci I (New England Biolabs) were added to the nuclei and the samples incubated at 37°C overnight with shaking.

    Techniques: Expressing, Ligation, Polymerase Chain Reaction, Amplification

    Alignment of the PTEN gene ( lower ) and pseudogene ( upper ). The region upstream of nucleotide (−841) represents a divergent sequence. MSP primer sets I, II, and III are shown. Set IV-A, -B primers were used for MSRA to amplify the PTEN gene and pseudogene, respectively. Aci I restriction sites are indicated with triangles. Differences between the two sequences are shown with the pseudogene sequence on top for MSRA are shown. Genomic position is defined by the location relative to the translational start site of PTEN (GenBank accession number AF143312).

    Journal: The American Journal of Pathology

    Article Title: Considerations When Analyzing the Methylation Status of PTEN Tumor Suppressor Gene

    doi:

    Figure Lengend Snippet: Alignment of the PTEN gene ( lower ) and pseudogene ( upper ). The region upstream of nucleotide (−841) represents a divergent sequence. MSP primer sets I, II, and III are shown. Set IV-A, -B primers were used for MSRA to amplify the PTEN gene and pseudogene, respectively. Aci I restriction sites are indicated with triangles. Differences between the two sequences are shown with the pseudogene sequence on top for MSRA are shown. Genomic position is defined by the location relative to the translational start site of PTEN (GenBank accession number AF143312).

    Article Snippet: Three hundred nanograms of genomic cell line DNA was incubated with 10 units of Aci I (New England Biolabs) at 37°C for 16 hours.

    Techniques: Sequencing

    Methylation-specific PCR using set III PTEN specific primers ( a ) and methylation-sensitive restriction analysis ( b, c, d ) using primer set IV-A ( PTEN ) respectively for cell lines. MSP analysis, as well as MSRA using primer set IV-A ( PTEN ), show lack of methylation in cell lines ( a, b ). Results for MSRA using set IV-B and -C primers ( c, d ) show methylation positive products in the same cell lines. NL treated with Sss I methyltransferase was used as a methylated positive control. Following Aci I digestion, equal amounts of cell line DNA were used for PCR analysis. U, unmethylated; M, methylated; N, undigested DNA; D, digested DNA; NL, normal lymphocyte DNA.

    Journal: The American Journal of Pathology

    Article Title: Considerations When Analyzing the Methylation Status of PTEN Tumor Suppressor Gene

    doi:

    Figure Lengend Snippet: Methylation-specific PCR using set III PTEN specific primers ( a ) and methylation-sensitive restriction analysis ( b, c, d ) using primer set IV-A ( PTEN ) respectively for cell lines. MSP analysis, as well as MSRA using primer set IV-A ( PTEN ), show lack of methylation in cell lines ( a, b ). Results for MSRA using set IV-B and -C primers ( c, d ) show methylation positive products in the same cell lines. NL treated with Sss I methyltransferase was used as a methylated positive control. Following Aci I digestion, equal amounts of cell line DNA were used for PCR analysis. U, unmethylated; M, methylated; N, undigested DNA; D, digested DNA; NL, normal lymphocyte DNA.

    Article Snippet: Three hundred nanograms of genomic cell line DNA was incubated with 10 units of Aci I (New England Biolabs) at 37°C for 16 hours.

    Techniques: Methylation, Polymerase Chain Reaction, Positive Control

    Schematic representation of CGI-seq. TEST: single cell being studied. Methylation control (MC): cells that are used to define the detectable CGIs or any other accessible methylated regions (AMRs), sharing the same genome as the TEST. For CGI-seq analysis, the genomic DNA is classified into three classes of sequences: Me-CGIs (representing methylated CGIs, and more generally, Me-AMRs) indicated as a red line, Um-CGIs (unmethylated CGIs, and generally Um-AMRs) indicated as a blue line and undetectable regions indicated as a black line. Green lines are amplified sequences. Solid dot: Me-CpG sites. Hollow dot: Um-CpG sites. The intact gDNA is released from cell (step 1) and digested with RE1 (TEST) or no digestion (MC) (step 2), followed by MDA amplification (step 3). The amplification product is then digested by RE2 (step 4), in which the short fragments are converted t‘o a library and subjected to massive sequencing (step 5). The reads are aligned to the genome (step 6) and the methylation status of the AMRs (particularly CGIs) is determined (‘Materials and Methods’ section). The AMRs detected in both the TEST and the MC are called Me-CGIs (or Me-AMRs). The AMRs uniquely detected in the MC but not in the TEST are called Um-CGIs (or Um-AMRs) of the TEST. RE1 (four MREs in combination: Cfr42I (SacII), PdiI (NaeI), Eco52I (EagI) and PteI(BssHII), FastDigest enzyme from Thermal Scientific Inc.) distinguishes Me-CGIs (Me-AMRs) from Um-CGIs (Um-AMRs). MDA selectively depletes Um-CGIs (Um-AMRs) of the TEST and amplifies Me-CGIs (Me-AMRs). RE2 (either BstUI alone, or a combination of 3 separate REs (ABH: AciI, BstUI and Hinp1I from NEB)) generates fragments specifically enriching CGI sequences (and other CG-rich regions) from non-CGI sequences.

    Journal: Nucleic Acids Research

    Article Title: Bisulfite-independent analysis of CpG island methylation enables genome-scale stratification of single cells

    doi: 10.1093/nar/gkx026

    Figure Lengend Snippet: Schematic representation of CGI-seq. TEST: single cell being studied. Methylation control (MC): cells that are used to define the detectable CGIs or any other accessible methylated regions (AMRs), sharing the same genome as the TEST. For CGI-seq analysis, the genomic DNA is classified into three classes of sequences: Me-CGIs (representing methylated CGIs, and more generally, Me-AMRs) indicated as a red line, Um-CGIs (unmethylated CGIs, and generally Um-AMRs) indicated as a blue line and undetectable regions indicated as a black line. Green lines are amplified sequences. Solid dot: Me-CpG sites. Hollow dot: Um-CpG sites. The intact gDNA is released from cell (step 1) and digested with RE1 (TEST) or no digestion (MC) (step 2), followed by MDA amplification (step 3). The amplification product is then digested by RE2 (step 4), in which the short fragments are converted t‘o a library and subjected to massive sequencing (step 5). The reads are aligned to the genome (step 6) and the methylation status of the AMRs (particularly CGIs) is determined (‘Materials and Methods’ section). The AMRs detected in both the TEST and the MC are called Me-CGIs (or Me-AMRs). The AMRs uniquely detected in the MC but not in the TEST are called Um-CGIs (or Um-AMRs) of the TEST. RE1 (four MREs in combination: Cfr42I (SacII), PdiI (NaeI), Eco52I (EagI) and PteI(BssHII), FastDigest enzyme from Thermal Scientific Inc.) distinguishes Me-CGIs (Me-AMRs) from Um-CGIs (Um-AMRs). MDA selectively depletes Um-CGIs (Um-AMRs) of the TEST and amplifies Me-CGIs (Me-AMRs). RE2 (either BstUI alone, or a combination of 3 separate REs (ABH: AciI, BstUI and Hinp1I from NEB)) generates fragments specifically enriching CGI sequences (and other CG-rich regions) from non-CGI sequences.

    Article Snippet: Library construction for reduced representation sequencing To enrich the sequences for CGIs and other CpG-rich regions, 1.5 μg of amplified DNA from each sample was divided into three equal amounts and digested by one of the three RE2 reagents respectively: AciI, BstUI and Hinp1I (NEB), called ABH collectively.

    Techniques: Methylation, Amplification, Multiple Displacement Amplification, Sequencing