pbs u6 vector  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Name:
    BbsI
    Description:
    BbsI 1 500 units
    Catalog Number:
    r0539l
    Price:
    282
    Size:
    1 500 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs pbs u6 vector
    BbsI
    BbsI 1 500 units
    https://www.bioz.com/result/pbs u6 vector/product/New England Biolabs
    Average 93 stars, based on 3671 article reviews
    Price from $9.99 to $1999.99
    pbs u6 vector - by Bioz Stars, 2020-04
    93/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: IN SILICO AND IN VIVO MODELS FOR QATARI SPECIFIC CLASSICAL HOMOCYSTINURIA AS BASIS FOR DEVELOPMENT OF NOVEL THERAPIES
    Article Snippet: Paragraph title: Designing and cloning of CBS sgRNA in the plasmid PX459 ... The vector was cut with BbsI (New England BioLabs) and loaded on 1% agarose gel, and the corresponding band was purified using the illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare).

    Article Title: A CRISPR Resource for Individual, Combinatorial, or Multiplexed Gene Knockout
    Article Snippet: These molecules were amplified by PCR (forward primer (FP): TTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG, reverse primer (RP): GGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC) and cloned by Gibson assembly into a 3rd generation lentiviral vector harboring a U6 promoter, an sgRNA backbone, and a ZsGreen-P2A-PuromycrinR transcript driven by a spleen focus-forming virus promoter (pCRoatan-singleSgRNA). .. The amplicon was digested with BbsI (NEB) and ligated into a 3rd generation lentiviral vector (pCRoatan-dualSgRNA) previously digested with BsmBI (ThermoFischer).

    Article Title: Efficient Genome Editing Using CRISPR/Cas9 Technology in Chicory
    Article Snippet: The C. intybus U6-1 promoter (CiU6-1p) and the sgRNA scaffold were synthesized (IDT, Leuven, Belgium) ( ) and cloned into commercial plasmid pUCIDT-Kan resulting in the vector pKanCiU6-1p-sgRNAscaffold. .. To insert the target inside pKanCiU6-1p-sgRNAscaffold, 1.5 µL of cutsmart buffer (NEB, Ipswich, MA, USA), 100 ng of pKanCiU6-1p-sgRNAscaffold, 4.2 ng of target preparation, 10 U of BbsI (NEB, Ipswich, MA, USA), 40 U of T4 DNA ligase (NEB, Ipswich, MA, USA), and deionized water up to 15 µL were mixed and the digestion/ligation reaction was performed in a thermocycler using the following parameters: 3 cycles including 37 °C for 10 min, 10 °C for 5 min and 20 °C for 5 min and then 10 cycles including 37 °C for 10 min, 10 °C for 5 min, 20 °C for 10 min. Then Escherichia coli TOP 10 thermo-competent bacteria (In Vitrogen, Waltham, MA, USA) were transformed with 5 µL of the digestion/ligation product, and selected on LB agar plate containing 25 µg/mL kanamycin and 1 mM IPTG overnight at 37 °C.

    Article Title: Versatile single-step-assembly CRISPR/Cas9 vectors for dual gRNA expression
    Article Snippet: Paragraph title: One step cloning for the generation of customized dual-gRNA plasmid ... Pairs of oligonucleotide duplexes were ligated into the empty vectors in a one-step digestion ligation reaction by mixing the diluted duplex oligonucleotide pairs (1 μL each) with 100 ng empty vector, 100 μmol of DTT, 10 μmol of ATP, 1 μL of BbsI (NEB), 0.5 μL of T4 ligase (NEB) and NEB-2 buffer in 20 μL of reaction.

    Article Title: Preparation of Group I Introns for Biochemical Studies and Crystallization Assays by Native Affinity Purification
    Article Snippet: .. Cloning procedure and transformation The PCR amplified products were purified using the QIAquick PCR purification kit (Qiagen #28104), and digested using the appropriate restriction enzymes (EcoRI, New England Biolabs (NEB) #R0101L; and NcoI, NEB #R0193L—incomplete digestion products were typically obtained using BbsI, NEB #R0539L, which made us avoid using this enzyme). .. The digested products were then purified by agarose gel electrophoresis, and eluted in a final volume of 30 µL using the QIAquick gel extraction kit (Qiagen #28706).

    Amplification:

    Article Title: A CRISPR Resource for Individual, Combinatorial, or Multiplexed Gene Knockout
    Article Snippet: .. The amplicon was digested with BbsI (NEB) and ligated into a 3rd generation lentiviral vector (pCRoatan-dualSgRNA) previously digested with BsmBI (ThermoFischer). ..

    Article Title: Preparation of Group I Introns for Biochemical Studies and Crystallization Assays by Native Affinity Purification
    Article Snippet: .. Cloning procedure and transformation The PCR amplified products were purified using the QIAquick PCR purification kit (Qiagen #28104), and digested using the appropriate restriction enzymes (EcoRI, New England Biolabs (NEB) #R0101L; and NcoI, NEB #R0193L—incomplete digestion products were typically obtained using BbsI, NEB #R0539L, which made us avoid using this enzyme). .. The digested products were then purified by agarose gel electrophoresis, and eluted in a final volume of 30 µL using the QIAquick gel extraction kit (Qiagen #28706).

    DNA Synthesis:

    Article Title: Efficient assembly of very short oligonucleotides using T4 DNA Ligase
    Article Snippet: Paragraph title: DNA synthesis using phosphorylated octamer precursors ... BbsI digestion was performed by resuspending the bead solutions to 25 units BbsI (NEB), 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2 , and 1 mM Dithiothreitol (pH 7.9 @ 25°C).

    Synthesized:

    Article Title: Efficient Genome Editing Using CRISPR/Cas9 Technology in Chicory
    Article Snippet: The C. intybus U6-1 promoter (CiU6-1p) and the sgRNA scaffold were synthesized (IDT, Leuven, Belgium) ( ) and cloned into commercial plasmid pUCIDT-Kan resulting in the vector pKanCiU6-1p-sgRNAscaffold. .. To insert the target inside pKanCiU6-1p-sgRNAscaffold, 1.5 µL of cutsmart buffer (NEB, Ipswich, MA, USA), 100 ng of pKanCiU6-1p-sgRNAscaffold, 4.2 ng of target preparation, 10 U of BbsI (NEB, Ipswich, MA, USA), 40 U of T4 DNA ligase (NEB, Ipswich, MA, USA), and deionized water up to 15 µL were mixed and the digestion/ligation reaction was performed in a thermocycler using the following parameters: 3 cycles including 37 °C for 10 min, 10 °C for 5 min and 20 °C for 5 min and then 10 cycles including 37 °C for 10 min, 10 °C for 5 min, 20 °C for 10 min. Then Escherichia coli TOP 10 thermo-competent bacteria (In Vitrogen, Waltham, MA, USA) were transformed with 5 µL of the digestion/ligation product, and selected on LB agar plate containing 25 µg/mL kanamycin and 1 mM IPTG overnight at 37 °C.

    Electrophoresis:

    Article Title: 90-Kilodalton Heat Shock Protein, Hsp90, as a Target for Genotyping Cryptosporidium spp. Known To Infect Humans ▿ spp. Known To Infect Humans ▿ †
    Article Snippet: .. Ten microliters of the secondary PCR products of the Hsp90 gene was digested with StyI, HphI, or BbsI (New England BioLabs, Ipswich, MA) under the conditions suggested by the manufacturer, and the products were visualized by electrophoresis through a 2% agarose gel. ..

    Incubation:

    Article Title: IN SILICO AND IN VIVO MODELS FOR QATARI SPECIFIC CLASSICAL HOMOCYSTINURIA AS BASIS FOR DEVELOPMENT OF NOVEL THERAPIES
    Article Snippet: The vector was cut with BbsI (New England BioLabs) and loaded on 1% agarose gel, and the corresponding band was purified using the illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare). .. Forward and reverse sgRNA oligonucleotides were aligned through incubation at 95°C for 5 min and subsequent spontaneous heat reduction until reverse transcription.

    Article Title: Versatile single-step-assembly CRISPR/Cas9 vectors for dual gRNA expression
    Article Snippet: One step cloning for the generation of customized dual-gRNA plasmid Forward and reverse oligonucleotides containing the guide sequences for Sox1A, Sox1B, Sox3A and Sox3B with appropriate overhangs ( ) were phosphorylated and annealed by mixing 100 pmol of each pair and 0.5 μL T4 PNK (NEB) then incubated at 37°C for 30 minutes, 95°C for 5 minutes and slowly ramped to RT. .. Pairs of oligonucleotide duplexes were ligated into the empty vectors in a one-step digestion ligation reaction by mixing the diluted duplex oligonucleotide pairs (1 μL each) with 100 ng empty vector, 100 μmol of DTT, 10 μmol of ATP, 1 μL of BbsI (NEB), 0.5 μL of T4 ligase (NEB) and NEB-2 buffer in 20 μL of reaction.

    Activity Assay:

    Article Title: Bacillus SEVA siblings: A Golden Gate-based toolbox to create personalized integrative vectors for Bacillus subtilis
    Article Snippet: BsaI, BbsI, BsmBI and BtgZI were purchased from NEB, AarI from Thermo ScientificTM . .. BsaI, BbsI, BsmBI and BtgZI were purchased from NEB, AarI from Thermo ScientificTM .

    Expressing:

    Article Title: Efficient Genome Editing Using CRISPR/Cas9 Technology in Chicory
    Article Snippet: Vector Construction This protocol is adapted from [ ] and binary vector pYLCRISPR/Cas9P35S -B (Addgene plasmid #66190, Cambridge, MA, USA) was used as expression vector. .. To insert the target inside pKanCiU6-1p-sgRNAscaffold, 1.5 µL of cutsmart buffer (NEB, Ipswich, MA, USA), 100 ng of pKanCiU6-1p-sgRNAscaffold, 4.2 ng of target preparation, 10 U of BbsI (NEB, Ipswich, MA, USA), 40 U of T4 DNA ligase (NEB, Ipswich, MA, USA), and deionized water up to 15 µL were mixed and the digestion/ligation reaction was performed in a thermocycler using the following parameters: 3 cycles including 37 °C for 10 min, 10 °C for 5 min and 20 °C for 5 min and then 10 cycles including 37 °C for 10 min, 10 °C for 5 min, 20 °C for 10 min. Then Escherichia coli TOP 10 thermo-competent bacteria (In Vitrogen, Waltham, MA, USA) were transformed with 5 µL of the digestion/ligation product, and selected on LB agar plate containing 25 µg/mL kanamycin and 1 mM IPTG overnight at 37 °C.

    Transformation Assay:

    Article Title: Efficient Genome Editing Using CRISPR/Cas9 Technology in Chicory
    Article Snippet: .. To insert the target inside pKanCiU6-1p-sgRNAscaffold, 1.5 µL of cutsmart buffer (NEB, Ipswich, MA, USA), 100 ng of pKanCiU6-1p-sgRNAscaffold, 4.2 ng of target preparation, 10 U of BbsI (NEB, Ipswich, MA, USA), 40 U of T4 DNA ligase (NEB, Ipswich, MA, USA), and deionized water up to 15 µL were mixed and the digestion/ligation reaction was performed in a thermocycler using the following parameters: 3 cycles including 37 °C for 10 min, 10 °C for 5 min and 20 °C for 5 min and then 10 cycles including 37 °C for 10 min, 10 °C for 5 min, 20 °C for 10 min. Then Escherichia coli TOP 10 thermo-competent bacteria (In Vitrogen, Waltham, MA, USA) were transformed with 5 µL of the digestion/ligation product, and selected on LB agar plate containing 25 µg/mL kanamycin and 1 mM IPTG overnight at 37 °C. ..

    Article Title: Preparation of Group I Introns for Biochemical Studies and Crystallization Assays by Native Affinity Purification
    Article Snippet: .. Cloning procedure and transformation The PCR amplified products were purified using the QIAquick PCR purification kit (Qiagen #28104), and digested using the appropriate restriction enzymes (EcoRI, New England Biolabs (NEB) #R0101L; and NcoI, NEB #R0193L—incomplete digestion products were typically obtained using BbsI, NEB #R0539L, which made us avoid using this enzyme). .. The digested products were then purified by agarose gel electrophoresis, and eluted in a final volume of 30 µL using the QIAquick gel extraction kit (Qiagen #28706).

    Transfection:

    Article Title: IN SILICO AND IN VIVO MODELS FOR QATARI SPECIFIC CLASSICAL HOMOCYSTINURIA AS BASIS FOR DEVELOPMENT OF NOVEL THERAPIES
    Article Snippet: This vector contains the cloning site for sgRNA sequence under U6 promoter, Cas9 sequence that can be activated by CBh promoter, and a Puromicine gene that allows successful selection of transfected cells. .. The vector was cut with BbsI (New England BioLabs) and loaded on 1% agarose gel, and the corresponding band was purified using the illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare).

    Electroporation Bacterial Transformation:

    Article Title: Versatile single-step-assembly CRISPR/Cas9 vectors for dual gRNA expression
    Article Snippet: Pairs of oligonucleotide duplexes were ligated into the empty vectors in a one-step digestion ligation reaction by mixing the diluted duplex oligonucleotide pairs (1 μL each) with 100 ng empty vector, 100 μmol of DTT, 10 μmol of ATP, 1 μL of BbsI (NEB), 0.5 μL of T4 ligase (NEB) and NEB-2 buffer in 20 μL of reaction. .. The mixture was placed in a thermocycler and cycled 6 times at 37°C for 5 minutes and 16°C for 5 minutes before bacterial transformation.

    Ligation:

    Article Title: A CRISPR Resource for Individual, Combinatorial, or Multiplexed Gene Knockout
    Article Snippet: The amplicon was digested with BbsI (NEB) and ligated into a 3rd generation lentiviral vector (pCRoatan-dualSgRNA) previously digested with BsmBI (ThermoFischer). .. The amplicons were first cloned by ligation into an intermediate cloning vector (pCR-BluntII TOPO based) using SpeI (NEB) and ApaI (NEB).

    Article Title: Versatile single-step-assembly CRISPR/Cas9 vectors for dual gRNA expression
    Article Snippet: .. Pairs of oligonucleotide duplexes were ligated into the empty vectors in a one-step digestion ligation reaction by mixing the diluted duplex oligonucleotide pairs (1 μL each) with 100 ng empty vector, 100 μmol of DTT, 10 μmol of ATP, 1 μL of BbsI (NEB), 0.5 μL of T4 ligase (NEB) and NEB-2 buffer in 20 μL of reaction. .. The mixture was placed in a thermocycler and cycled 6 times at 37°C for 5 minutes and 16°C for 5 minutes before bacterial transformation.

    Article Title: Efficient assembly of very short oligonucleotides using T4 DNA Ligase
    Article Snippet: DNA synthesis using phosphorylated octamer precursors Pooled ligation reactions consisted of 1.5 μM immobilized dsDNA on beads, 66.7 μM of each octamer, 1× T4 DNA ligase buffer (50 mM Tris-HCl, 10 mM MgCl2 , 1 mM ATP, 10 mM Dithiothreitol, pH 7.5 @ 25°C) and 0.5 units/μL of T4 DNA Ligase. .. BbsI digestion was performed by resuspending the bead solutions to 25 units BbsI (NEB), 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2 , and 1 mM Dithiothreitol (pH 7.9 @ 25°C).

    Article Title: Preparation of Group I Introns for Biochemical Studies and Crystallization Assays by Native Affinity Purification
    Article Snippet: Cloning procedure and transformation The PCR amplified products were purified using the QIAquick PCR purification kit (Qiagen #28104), and digested using the appropriate restriction enzymes (EcoRI, New England Biolabs (NEB) #R0101L; and NcoI, NEB #R0193L—incomplete digestion products were typically obtained using BbsI, NEB #R0539L, which made us avoid using this enzyme). .. Ligation occurred for 35 min at room temperature (∼23–25°C) in a solution containing: 0.2 µg/µL pRAV12 vector ; 50–100 ng/µL PCR product; 400 U T4 DNA ligase (NEB #M0202S); 1X reaction buffer supplied by the manufacturer.

    other:

    Article Title: Glucosylceramide synthase maintains influenza virus entry and infection
    Article Snippet: BbsI was purchased from New England Biolabs (Cat# R0539S).

    Sequencing:

    Article Title: IN SILICO AND IN VIVO MODELS FOR QATARI SPECIFIC CLASSICAL HOMOCYSTINURIA AS BASIS FOR DEVELOPMENT OF NOVEL THERAPIES
    Article Snippet: This vector contains the cloning site for sgRNA sequence under U6 promoter, Cas9 sequence that can be activated by CBh promoter, and a Puromicine gene that allows successful selection of transfected cells. .. The vector was cut with BbsI (New England BioLabs) and loaded on 1% agarose gel, and the corresponding band was purified using the illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare).

    Article Title: Segmental duplications and evolutionary acquisition of UV damage response in the SPATA31 gene family of primates and humans
    Article Snippet: CRISPR/Cas targeting vector preparation 10 μg of pX260 or pX330 were digested with BbsI (NEB) for 3 h at 37 ° C. Digested pX260 or pX330 vectors were purified by QIAEXII Extraction Kit (Qiagen) according to manufacturers recommendation. .. Targeting guide RNA sequence specific to exon1 of SPATA31 genes was designed by using the CRISPR design tool (crispr.mit.edu).

    Article Title: Versatile single-step-assembly CRISPR/Cas9 vectors for dual gRNA expression
    Article Snippet: Pairs of oligonucleotide duplexes were ligated into the empty vectors in a one-step digestion ligation reaction by mixing the diluted duplex oligonucleotide pairs (1 μL each) with 100 ng empty vector, 100 μmol of DTT, 10 μmol of ATP, 1 μL of BbsI (NEB), 0.5 μL of T4 ligase (NEB) and NEB-2 buffer in 20 μL of reaction. .. Correct insertion of oligonucleotide duplexes into the vectors was confirmed by Sanger sequencing using the following primers: GGTTTCGCCACCTCTGACTTG (first insert) and TGCATCGCATTGTCTGAGTAGG (second insert).

    Article Title: Efficient assembly of very short oligonucleotides using T4 DNA Ligase
    Article Snippet: In selected bead sets, this process was performed twice using the same conditions but with the octamers split into two groups to avoid a region of repeated sequence. .. BbsI digestion was performed by resuspending the bead solutions to 25 units BbsI (NEB), 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2 , and 1 mM Dithiothreitol (pH 7.9 @ 25°C).

    Isolation:

    Article Title: Efficient assembly of very short oligonucleotides using T4 DNA Ligase
    Article Snippet: BbsI digestion was performed by resuspending the bead solutions to 25 units BbsI (NEB), 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2 , and 1 mM Dithiothreitol (pH 7.9 @ 25°C). .. Released DNA fragments were isolated by immediate aspiration from the hot digest mixture while a magnet was applied.

    Purification:

    Article Title: IN SILICO AND IN VIVO MODELS FOR QATARI SPECIFIC CLASSICAL HOMOCYSTINURIA AS BASIS FOR DEVELOPMENT OF NOVEL THERAPIES
    Article Snippet: .. The vector was cut with BbsI (New England BioLabs) and loaded on 1% agarose gel, and the corresponding band was purified using the illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare). .. Top and bottom oligonucleotides of the sgRNA targeting the sequence of CBS were designed using Benchling design software.

    Article Title: Efficient Genome Editing Using CRISPR/Cas9 Technology in Chicory
    Article Snippet: To insert the target inside pKanCiU6-1p-sgRNAscaffold, 1.5 µL of cutsmart buffer (NEB, Ipswich, MA, USA), 100 ng of pKanCiU6-1p-sgRNAscaffold, 4.2 ng of target preparation, 10 U of BbsI (NEB, Ipswich, MA, USA), 40 U of T4 DNA ligase (NEB, Ipswich, MA, USA), and deionized water up to 15 µL were mixed and the digestion/ligation reaction was performed in a thermocycler using the following parameters: 3 cycles including 37 °C for 10 min, 10 °C for 5 min and 20 °C for 5 min and then 10 cycles including 37 °C for 10 min, 10 °C for 5 min, 20 °C for 10 min. Then Escherichia coli TOP 10 thermo-competent bacteria (In Vitrogen, Waltham, MA, USA) were transformed with 5 µL of the digestion/ligation product, and selected on LB agar plate containing 25 µg/mL kanamycin and 1 mM IPTG overnight at 37 °C. .. Plasmid was purified with the nucleospin plasmid purification kit (Macherey-Nagel, Düren, Germany).

    Article Title: Segmental duplications and evolutionary acquisition of UV damage response in the SPATA31 gene family of primates and humans
    Article Snippet: .. CRISPR/Cas targeting vector preparation 10 μg of pX260 or pX330 were digested with BbsI (NEB) for 3 h at 37 ° C. Digested pX260 or pX330 vectors were purified by QIAEXII Extraction Kit (Qiagen) according to manufacturers recommendation. .. Targeting guide RNA sequence specific to exon1 of SPATA31 genes was designed by using the CRISPR design tool (crispr.mit.edu).

    Article Title: Preparation of Group I Introns for Biochemical Studies and Crystallization Assays by Native Affinity Purification
    Article Snippet: .. Cloning procedure and transformation The PCR amplified products were purified using the QIAquick PCR purification kit (Qiagen #28104), and digested using the appropriate restriction enzymes (EcoRI, New England Biolabs (NEB) #R0101L; and NcoI, NEB #R0193L—incomplete digestion products were typically obtained using BbsI, NEB #R0539L, which made us avoid using this enzyme). .. The digested products were then purified by agarose gel electrophoresis, and eluted in a final volume of 30 µL using the QIAquick gel extraction kit (Qiagen #28706).

    Polymerase Chain Reaction:

    Article Title: IN SILICO AND IN VIVO MODELS FOR QATARI SPECIFIC CLASSICAL HOMOCYSTINURIA AS BASIS FOR DEVELOPMENT OF NOVEL THERAPIES
    Article Snippet: .. The vector was cut with BbsI (New England BioLabs) and loaded on 1% agarose gel, and the corresponding band was purified using the illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare). .. Top and bottom oligonucleotides of the sgRNA targeting the sequence of CBS were designed using Benchling design software.

    Article Title: A CRISPR Resource for Individual, Combinatorial, or Multiplexed Gene Knockout
    Article Snippet: These molecules were amplified by PCR (forward primer (FP): TTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG, reverse primer (RP): GGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC) and cloned by Gibson assembly into a 3rd generation lentiviral vector harboring a U6 promoter, an sgRNA backbone, and a ZsGreen-P2A-PuromycrinR transcript driven by a spleen focus-forming virus promoter (pCRoatan-singleSgRNA). .. The amplicon was digested with BbsI (NEB) and ligated into a 3rd generation lentiviral vector (pCRoatan-dualSgRNA) previously digested with BsmBI (ThermoFischer).

    Article Title: 90-Kilodalton Heat Shock Protein, Hsp90, as a Target for Genotyping Cryptosporidium spp. Known To Infect Humans ▿ spp. Known To Infect Humans ▿ †
    Article Snippet: .. Ten microliters of the secondary PCR products of the Hsp90 gene was digested with StyI, HphI, or BbsI (New England BioLabs, Ipswich, MA) under the conditions suggested by the manufacturer, and the products were visualized by electrophoresis through a 2% agarose gel. ..

    Article Title: Preparation of Group I Introns for Biochemical Studies and Crystallization Assays by Native Affinity Purification
    Article Snippet: .. Cloning procedure and transformation The PCR amplified products were purified using the QIAquick PCR purification kit (Qiagen #28104), and digested using the appropriate restriction enzymes (EcoRI, New England Biolabs (NEB) #R0101L; and NcoI, NEB #R0193L—incomplete digestion products were typically obtained using BbsI, NEB #R0539L, which made us avoid using this enzyme). .. The digested products were then purified by agarose gel electrophoresis, and eluted in a final volume of 30 µL using the QIAquick gel extraction kit (Qiagen #28706).

    CRISPR:

    Article Title: Segmental duplications and evolutionary acquisition of UV damage response in the SPATA31 gene family of primates and humans
    Article Snippet: .. CRISPR/Cas targeting vector preparation 10 μg of pX260 or pX330 were digested with BbsI (NEB) for 3 h at 37 ° C. Digested pX260 or pX330 vectors were purified by QIAEXII Extraction Kit (Qiagen) according to manufacturers recommendation. .. Targeting guide RNA sequence specific to exon1 of SPATA31 genes was designed by using the CRISPR design tool (crispr.mit.edu).

    Plasmid Preparation:

    Article Title: IN SILICO AND IN VIVO MODELS FOR QATARI SPECIFIC CLASSICAL HOMOCYSTINURIA AS BASIS FOR DEVELOPMENT OF NOVEL THERAPIES
    Article Snippet: .. The vector was cut with BbsI (New England BioLabs) and loaded on 1% agarose gel, and the corresponding band was purified using the illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare). .. Top and bottom oligonucleotides of the sgRNA targeting the sequence of CBS were designed using Benchling design software.

    Article Title: A CRISPR Resource for Individual, Combinatorial, or Multiplexed Gene Knockout
    Article Snippet: .. The amplicon was digested with BbsI (NEB) and ligated into a 3rd generation lentiviral vector (pCRoatan-dualSgRNA) previously digested with BsmBI (ThermoFischer). ..

    Article Title: Efficient Genome Editing Using CRISPR/Cas9 Technology in Chicory
    Article Snippet: Paragraph title: 4.3. Vector Construction ... To insert the target inside pKanCiU6-1p-sgRNAscaffold, 1.5 µL of cutsmart buffer (NEB, Ipswich, MA, USA), 100 ng of pKanCiU6-1p-sgRNAscaffold, 4.2 ng of target preparation, 10 U of BbsI (NEB, Ipswich, MA, USA), 40 U of T4 DNA ligase (NEB, Ipswich, MA, USA), and deionized water up to 15 µL were mixed and the digestion/ligation reaction was performed in a thermocycler using the following parameters: 3 cycles including 37 °C for 10 min, 10 °C for 5 min and 20 °C for 5 min and then 10 cycles including 37 °C for 10 min, 10 °C for 5 min, 20 °C for 10 min. Then Escherichia coli TOP 10 thermo-competent bacteria (In Vitrogen, Waltham, MA, USA) were transformed with 5 µL of the digestion/ligation product, and selected on LB agar plate containing 25 µg/mL kanamycin and 1 mM IPTG overnight at 37 °C.

    Article Title: Segmental duplications and evolutionary acquisition of UV damage response in the SPATA31 gene family of primates and humans
    Article Snippet: .. CRISPR/Cas targeting vector preparation 10 μg of pX260 or pX330 were digested with BbsI (NEB) for 3 h at 37 ° C. Digested pX260 or pX330 vectors were purified by QIAEXII Extraction Kit (Qiagen) according to manufacturers recommendation. .. Targeting guide RNA sequence specific to exon1 of SPATA31 genes was designed by using the CRISPR design tool (crispr.mit.edu).

    Article Title: Versatile single-step-assembly CRISPR/Cas9 vectors for dual gRNA expression
    Article Snippet: .. Pairs of oligonucleotide duplexes were ligated into the empty vectors in a one-step digestion ligation reaction by mixing the diluted duplex oligonucleotide pairs (1 μL each) with 100 ng empty vector, 100 μmol of DTT, 10 μmol of ATP, 1 μL of BbsI (NEB), 0.5 μL of T4 ligase (NEB) and NEB-2 buffer in 20 μL of reaction. .. The mixture was placed in a thermocycler and cycled 6 times at 37°C for 5 minutes and 16°C for 5 minutes before bacterial transformation.

    Article Title: Preparation of Group I Introns for Biochemical Studies and Crystallization Assays by Native Affinity Purification
    Article Snippet: Cloning procedure and transformation The PCR amplified products were purified using the QIAquick PCR purification kit (Qiagen #28104), and digested using the appropriate restriction enzymes (EcoRI, New England Biolabs (NEB) #R0101L; and NcoI, NEB #R0193L—incomplete digestion products were typically obtained using BbsI, NEB #R0539L, which made us avoid using this enzyme). .. Ligation occurred for 35 min at room temperature (∼23–25°C) in a solution containing: 0.2 µg/µL pRAV12 vector ; 50–100 ng/µL PCR product; 400 U T4 DNA ligase (NEB #M0202S); 1X reaction buffer supplied by the manufacturer.

    Software:

    Article Title: IN SILICO AND IN VIVO MODELS FOR QATARI SPECIFIC CLASSICAL HOMOCYSTINURIA AS BASIS FOR DEVELOPMENT OF NOVEL THERAPIES
    Article Snippet: The vector was cut with BbsI (New England BioLabs) and loaded on 1% agarose gel, and the corresponding band was purified using the illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare). .. Top and bottom oligonucleotides of the sgRNA targeting the sequence of CBS were designed using Benchling design software.

    Article Title: 90-Kilodalton Heat Shock Protein, Hsp90, as a Target for Genotyping Cryptosporidium spp. Known To Infect Humans ▿ spp. Known To Infect Humans ▿ †
    Article Snippet: To develop an RFLP method for the rapid differentiation of Cryptosporidium species and genotypes, the Hsp90 gene sequences were examined using the software BioEdit ( ) for restriction enzyme sites. .. Ten microliters of the secondary PCR products of the Hsp90 gene was digested with StyI, HphI, or BbsI (New England BioLabs, Ipswich, MA) under the conditions suggested by the manufacturer, and the products were visualized by electrophoresis through a 2% agarose gel.

    Selection:

    Article Title: IN SILICO AND IN VIVO MODELS FOR QATARI SPECIFIC CLASSICAL HOMOCYSTINURIA AS BASIS FOR DEVELOPMENT OF NOVEL THERAPIES
    Article Snippet: This vector contains the cloning site for sgRNA sequence under U6 promoter, Cas9 sequence that can be activated by CBh promoter, and a Puromicine gene that allows successful selection of transfected cells. .. The vector was cut with BbsI (New England BioLabs) and loaded on 1% agarose gel, and the corresponding band was purified using the illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare).

    Agarose Gel Electrophoresis:

    Article Title: IN SILICO AND IN VIVO MODELS FOR QATARI SPECIFIC CLASSICAL HOMOCYSTINURIA AS BASIS FOR DEVELOPMENT OF NOVEL THERAPIES
    Article Snippet: .. The vector was cut with BbsI (New England BioLabs) and loaded on 1% agarose gel, and the corresponding band was purified using the illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare). .. Top and bottom oligonucleotides of the sgRNA targeting the sequence of CBS were designed using Benchling design software.

    Article Title: 90-Kilodalton Heat Shock Protein, Hsp90, as a Target for Genotyping Cryptosporidium spp. Known To Infect Humans ▿ spp. Known To Infect Humans ▿ †
    Article Snippet: .. Ten microliters of the secondary PCR products of the Hsp90 gene was digested with StyI, HphI, or BbsI (New England BioLabs, Ipswich, MA) under the conditions suggested by the manufacturer, and the products were visualized by electrophoresis through a 2% agarose gel. ..

    Article Title: Preparation of Group I Introns for Biochemical Studies and Crystallization Assays by Native Affinity Purification
    Article Snippet: Cloning procedure and transformation The PCR amplified products were purified using the QIAquick PCR purification kit (Qiagen #28104), and digested using the appropriate restriction enzymes (EcoRI, New England Biolabs (NEB) #R0101L; and NcoI, NEB #R0193L—incomplete digestion products were typically obtained using BbsI, NEB #R0539L, which made us avoid using this enzyme). .. The digested products were then purified by agarose gel electrophoresis, and eluted in a final volume of 30 µL using the QIAquick gel extraction kit (Qiagen #28706).

    Gel Extraction:

    Article Title: Preparation of Group I Introns for Biochemical Studies and Crystallization Assays by Native Affinity Purification
    Article Snippet: Cloning procedure and transformation The PCR amplified products were purified using the QIAquick PCR purification kit (Qiagen #28104), and digested using the appropriate restriction enzymes (EcoRI, New England Biolabs (NEB) #R0101L; and NcoI, NEB #R0193L—incomplete digestion products were typically obtained using BbsI, NEB #R0539L, which made us avoid using this enzyme). .. The digested products were then purified by agarose gel electrophoresis, and eluted in a final volume of 30 µL using the QIAquick gel extraction kit (Qiagen #28706).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs bbsi
    Bbsi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 38 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bbsi/product/New England Biolabs
    Average 99 stars, based on 38 article reviews
    Price from $9.99 to $1999.99
    bbsi - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results