mluci  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    MluCI
    Description:
    MluCI 5 000 units
    Catalog Number:
    R0538L
    Price:
    269
    Category:
    Restriction Enzymes
    Size:
    5 000 units
    Buy from Supplier


    Structured Review

    New England Biolabs mluci
    MluCI
    MluCI 5 000 units
    https://www.bioz.com/result/mluci/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mluci - by Bioz Stars, 2021-06
    99/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: First detection of the kdr mutation (L1014F) in the plague vector Xenopsylla cheopis (Siphonaptera: Pulicidae)
    Article Snippet: The PCR mixture (25 μl) contained 2× EZ4SuperHiFi mix 12.5 μl; each primer 5 μM, 75–150 ng DNA template, and ddH2 O. PCR conditions were as follows: 95 °C for 3 min, followed by 42 cycles of 94 °C for 25 s; 55 °C for 25 s and 68 °C for 30 s, and a final extension at 68 °C for 10 min. .. The digestion reactions contained 0.5 U of MluCI (New England Biolabs, Beijing, China), 2 μl of cutsmart buffer, 8 μl of PCR product, and ddH2 O up to 20 μl. .. The digestion mixture was incubated at 37 °C for 3 h, and the digested products were run on 3% gel and visualized under UV.

    Article Title: Species associations and distributions of soil entomopathogenic fungi Metarhizium spp. in Japan
    Article Snippet: PCR amplifications of the rDNA IGS region were also performed in the same manner except that IGS28S4 and IGS18S4 ( ) were used as primers and the PCR conditions were 38 cycles for 10 s at 98°C, 30 s at 63°C, and 90–120 s at 68°C. .. The PCR products of 5′-EF1-α were digested with Mlu CI or Tsp509I (NEB, Japan). .. The PCR products of rDNA IGS were digested with Hae III (NEB, Japan).

    Article Title: The plant hormone ethylene restricts Arabidopsis growth via the epidermis
    Article Snippet: The mutant ctr1-1 background of pLRC1::EBF2 , pML1::EBF2 , and pA14::EBF2 T2 plants was confirmed by genotyping according to the method described by Binder et al. ( ). .. Genotyping was performed by restriction digestion of genomic PCR with MluCI (New England Biolabs) for which the mutation introduces a new restriction site. ..

    Article Title: Postnatal epigenetic reprogramming in the germline of a marsupial, the tammar wallaby
    Article Snippet: After the bisulphite treatment for the genomic DNA, 30 to 38 cycles of PCR with the genomic DNA templates corresponding to 100 to 5,000 cells were carried out using the following primer pairs. .. PEG10 DMR Forward: 5′- CCTCCCATTAACTTTAAAATCACC -3′ PEG10 DMR Reverse: 5′- ATTGTAGTAATGGGGTAGGTTATG -3′ H19 DMR Forward: 5′- GAATGGGTTAGATGAGGGTAGTATAG -3′ H19 DMR Reverse: 5′- TATCAAACACCAAAACCACAAATAA -3′ H19 COBRA Forward: 5′- TTATTTTGGAGAAAATTTGAAGATAAGTAG -3′ H19 COBRA Reverse: 5′- TATCCTAAAACATCAAAACCTAAATTAAAC -3′ KERV-1 LTR Forward: 5′- TAAACTCAATTCCATATAAACAATCTC -3′ KERV-1 LTR Reverse: 5′- TTTTTGTTTTGTAAGGGTTTTTTAG -3′ LINE1 Forward: 5′- GGAGATTTTTGTTTTAGAGAGATTTGTAAA -3′ LINE1 Reverse: 5′- TATAAAAACACCCCACTCCCCTCTC -3′ The PCR products for COBRA (combined bisulphite and restriction analysis) were digested with 1 to 10 units of MluCI, AciI, TaqI (New England Biolabs) or HinfI (TaKaRa) restriction enzymes for 2-3 h at 37°C or 65°C for TaqI. .. The intensity of the cut and uncut bands was quantified by ATTO CS Analyzer 3 software (ATTO).

    Mutagenesis:

    Article Title: The plant hormone ethylene restricts Arabidopsis growth via the epidermis
    Article Snippet: The mutant ctr1-1 background of pLRC1::EBF2 , pML1::EBF2 , and pA14::EBF2 T2 plants was confirmed by genotyping according to the method described by Binder et al. ( ). .. Genotyping was performed by restriction digestion of genomic PCR with MluCI (New England Biolabs) for which the mutation introduces a new restriction site. ..

    Combined Bisulfite Restriction Analysis Assay:

    Article Title: Postnatal epigenetic reprogramming in the germline of a marsupial, the tammar wallaby
    Article Snippet: After the bisulphite treatment for the genomic DNA, 30 to 38 cycles of PCR with the genomic DNA templates corresponding to 100 to 5,000 cells were carried out using the following primer pairs. .. PEG10 DMR Forward: 5′- CCTCCCATTAACTTTAAAATCACC -3′ PEG10 DMR Reverse: 5′- ATTGTAGTAATGGGGTAGGTTATG -3′ H19 DMR Forward: 5′- GAATGGGTTAGATGAGGGTAGTATAG -3′ H19 DMR Reverse: 5′- TATCAAACACCAAAACCACAAATAA -3′ H19 COBRA Forward: 5′- TTATTTTGGAGAAAATTTGAAGATAAGTAG -3′ H19 COBRA Reverse: 5′- TATCCTAAAACATCAAAACCTAAATTAAAC -3′ KERV-1 LTR Forward: 5′- TAAACTCAATTCCATATAAACAATCTC -3′ KERV-1 LTR Reverse: 5′- TTTTTGTTTTGTAAGGGTTTTTTAG -3′ LINE1 Forward: 5′- GGAGATTTTTGTTTTAGAGAGATTTGTAAA -3′ LINE1 Reverse: 5′- TATAAAAACACCCCACTCCCCTCTC -3′ The PCR products for COBRA (combined bisulphite and restriction analysis) were digested with 1 to 10 units of MluCI, AciI, TaqI (New England Biolabs) or HinfI (TaKaRa) restriction enzymes for 2-3 h at 37°C or 65°C for TaqI. .. The intensity of the cut and uncut bands was quantified by ATTO CS Analyzer 3 software (ATTO).

    Laser Capture Microdissection:

    Article Title: Hybrid Adeno-Associated Viral Vectors Utilizing Transposase-Mediated Somatic Integration for Stable Transgene Expression in Human Cells
    Article Snippet: The generation of Sleeping Beauty transposase-mediated integration site libraries via LAM-PCR in combination with an Illumina Genome Analyzer platform was performed as described previously [ , , ]. .. Briefly, three enzymes NlaIII (NEB), MluCI (NEB), FspBI (Fermentas) were used to prepare independent reactions for LAM-PCR. .. Bioinformatic analysis of integration sites Sequences were blasted against the human genomic sequence database from NCBI ( http://www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgi?taxid=9606 ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs mlu ci
    <t>PCR–RFLP</t> profiles of Metarhizium spp. (amplicons of 5′-EF1-α digested with <t>Mlu</t> CI). The size marker consists of 17 fragments between 50 and 1200 bp (every 50 bp up to 500 bp, every 100 bp from 500 bp to 1000 bp, 1200 bp, and 1500 bp). The characters in parentheses after the strain name indicate the genotypes of PCR–RFLP. The names of Metarhizium spp. are abbreviated as follows: Ma, M. anisopliae; Mb, M. brunneum; Mpe, M. pemphigi; Mg, M. guizhouense; Ml, M. lepidiotae; Mm, M. majus; Mpi, M. pingshaense; Mr, M. robertsii .
    Mlu Ci, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mlu ci/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mlu ci - by Bioz Stars, 2021-06
    95/100 stars
      Buy from Supplier

    Image Search Results


    PCR–RFLP profiles of Metarhizium spp. (amplicons of 5′-EF1-α digested with Mlu CI). The size marker consists of 17 fragments between 50 and 1200 bp (every 50 bp up to 500 bp, every 100 bp from 500 bp to 1000 bp, 1200 bp, and 1500 bp). The characters in parentheses after the strain name indicate the genotypes of PCR–RFLP. The names of Metarhizium spp. are abbreviated as follows: Ma, M. anisopliae; Mb, M. brunneum; Mpe, M. pemphigi; Mg, M. guizhouense; Ml, M. lepidiotae; Mm, M. majus; Mpi, M. pingshaense; Mr, M. robertsii .

    Journal: Mycology

    Article Title: Species associations and distributions of soil entomopathogenic fungi Metarhizium spp. in Japan

    doi: 10.1080/21501203.2017.1386244

    Figure Lengend Snippet: PCR–RFLP profiles of Metarhizium spp. (amplicons of 5′-EF1-α digested with Mlu CI). The size marker consists of 17 fragments between 50 and 1200 bp (every 50 bp up to 500 bp, every 100 bp from 500 bp to 1000 bp, 1200 bp, and 1500 bp). The characters in parentheses after the strain name indicate the genotypes of PCR–RFLP. The names of Metarhizium spp. are abbreviated as follows: Ma, M. anisopliae; Mb, M. brunneum; Mpe, M. pemphigi; Mg, M. guizhouense; Ml, M. lepidiotae; Mm, M. majus; Mpi, M. pingshaense; Mr, M. robertsii .

    Article Snippet: The PCR products of 5′-EF1-α were digested with Mlu CI or Tsp509I (NEB, Japan).

    Techniques: Polymerase Chain Reaction, Marker