xcmi  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
    Name:
    XcmI
    Description:
    XcmI 5 000 units
    Catalog Number:
    r0533l
    Price:
    282
    Category:
    Restriction Enzymes
    Size:
    5 000 units
    		Buy from Supplier

    Structured Review

    New England Biolabs xcmi
    XcmI
    XcmI 5 000 units
    https://www.bioz.com/result/xcmi/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    xcmi - by Bioz Stars, 2021-03
    94/100 stars

    Images

    1) Product Images from "klf2ash317 Mutant Zebrafish Do Not Recapitulate Morpholino-Induced Vascular and Haematopoietic Phenotypes"

    Article Title: klf2ash317 Mutant Zebrafish Do Not Recapitulate Morpholino-Induced Vascular and Haematopoietic Phenotypes

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0141611

    Generation of a stable klf2a sh317 mutant line. (A) Schematic structure of wildtype klf2a gene with genomic sequence at the TALEN mutagenesis site. XcmI restriction site is indicated by the green line and the 19bp spacer for the TALEN structure of choice is indicated by the black line. The 14bp deletion identified in the klf2a sh317 allele is indicated by the sequence in red. (B) Schematic structure of Klf2a wildtype and Klf2a sh317 mutant proteins with amino acid (AA) lengths and predicted molecular weights in kilodaltons (kDa) Klf2a transactivation domain is in purple and transrepression domain is in yellow colour. (C) Substantial reduction of the 43kDa band representing the full-length Klf2a protein can be seen in a western blot of whole-embryo protein samples extracted from the F3 generation of klf2a sh317 mutant embryos at 5dpf, compared to wildtype embryos and heterozygous klf2a sh317 carriers. Additionally, two bands running at approximately 33kDa can be seen in the klf2a sh317 mutant, possibly representing truncated Klf2a. Asterixes indicate bands of approx. molecular weights of 38kDa and 47kDa consistent with expression of Klf4a and Biklf/Klf4b/Klf17 respectively, present in all three lanes in equal intensity. β actin was used as a loading control. (D) klf2a coding sequence was amplified from the control cDNA originating from 48hpf wildtype embryos giving an expected 1155bp PCR product. No band was detected in the sample with cDNA from unfertilised embryos (unf. cDNA) indicating the absence of maternal klf2a mRNA in unfertilised embryos. No 1674bp band was detected in unfertilised cDNA or control cDNA confirming absence of genomic DNA contamination. gapdh was used as a positive control. A band of expected size was detected in both the unfertilised eggs cDNA and control cDNA lanes indicating maternal gapdh mRNA in unfertilised zebrafish eggs. Abbreviations: -E: negative control with no reverse transcriptase added during reverse transcription (RT). -RNA: negative control with no RNA added during RT. B: blank, no template added to the PCR reaction. Abbreviations: L: Hyperladder II (NEB).
    Figure Legend Snippet: Generation of a stable klf2a sh317 mutant line. (A) Schematic structure of wildtype klf2a gene with genomic sequence at the TALEN mutagenesis site. XcmI restriction site is indicated by the green line and the 19bp spacer for the TALEN structure of choice is indicated by the black line. The 14bp deletion identified in the klf2a sh317 allele is indicated by the sequence in red. (B) Schematic structure of Klf2a wildtype and Klf2a sh317 mutant proteins with amino acid (AA) lengths and predicted molecular weights in kilodaltons (kDa) Klf2a transactivation domain is in purple and transrepression domain is in yellow colour. (C) Substantial reduction of the 43kDa band representing the full-length Klf2a protein can be seen in a western blot of whole-embryo protein samples extracted from the F3 generation of klf2a sh317 mutant embryos at 5dpf, compared to wildtype embryos and heterozygous klf2a sh317 carriers. Additionally, two bands running at approximately 33kDa can be seen in the klf2a sh317 mutant, possibly representing truncated Klf2a. Asterixes indicate bands of approx. molecular weights of 38kDa and 47kDa consistent with expression of Klf4a and Biklf/Klf4b/Klf17 respectively, present in all three lanes in equal intensity. β actin was used as a loading control. (D) klf2a coding sequence was amplified from the control cDNA originating from 48hpf wildtype embryos giving an expected 1155bp PCR product. No band was detected in the sample with cDNA from unfertilised embryos (unf. cDNA) indicating the absence of maternal klf2a mRNA in unfertilised embryos. No 1674bp band was detected in unfertilised cDNA or control cDNA confirming absence of genomic DNA contamination. gapdh was used as a positive control. A band of expected size was detected in both the unfertilised eggs cDNA and control cDNA lanes indicating maternal gapdh mRNA in unfertilised zebrafish eggs. Abbreviations: -E: negative control with no reverse transcriptase added during reverse transcription (RT). -RNA: negative control with no RNA added during RT. B: blank, no template added to the PCR reaction. Abbreviations: L: Hyperladder II (NEB).

    Techniques Used: Mutagenesis, Sequencing, Western Blot, Expressing, Amplification, Polymerase Chain Reaction, Positive Control, Negative Control

    2) Product Images from "A Series of TA-Based and Zero-Background Vectors for Plant Functional Genomics"

    Article Title: A Series of TA-Based and Zero-Background Vectors for Plant Functional Genomics

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0059576

    Construction of the TA-based expression vectors. A, workflow for the direct cloning of PCR products using the TA-based expression vector system. TA-based expression vectors were digested by XcmI to produce 3′-T-overhangs. The PCR products were ligated with the XcmI-digested vector by T4 ligase. B, Left: Self-ligation of the XcmI-digested vector by T4 ligase. Right: Ligation of the PCR product of the GFP gene with the XcmI-digested vector by T4 ligase, followed by transformation into DH5α strains. C, Samples of restriction digestion analyses of randomly selected colonies from the ligation of the XcmI-digested pGreen vector with the product of the GFP gene using T4 ligase.
    Figure Legend Snippet: Construction of the TA-based expression vectors. A, workflow for the direct cloning of PCR products using the TA-based expression vector system. TA-based expression vectors were digested by XcmI to produce 3′-T-overhangs. The PCR products were ligated with the XcmI-digested vector by T4 ligase. B, Left: Self-ligation of the XcmI-digested vector by T4 ligase. Right: Ligation of the PCR product of the GFP gene with the XcmI-digested vector by T4 ligase, followed by transformation into DH5α strains. C, Samples of restriction digestion analyses of randomly selected colonies from the ligation of the XcmI-digested pGreen vector with the product of the GFP gene using T4 ligase.

    Techniques Used: Expressing, Clone Assay, Polymerase Chain Reaction, Plasmid Preparation, Ligation, Transformation Assay

    Related Articles

    Sequencing:

    Article Title: klf2ash317 Mutant Zebrafish Do Not Recapitulate Morpholino-Induced Vascular and Haematopoietic Phenotypes
    Article Snippet: klf2a TALEN Mutagenesis We followed a published protocol for targeted TALEN mutagenesis [ ]. klf2a genomic sequence was submitted to the Old TALEN Targeter software at https://tale-nt.cac.cornell.edu/node/add/talen-old . .. A target site at the 5`end of exon 2 5`TCAACCCATCACCACCTCCACCG/AT[ACACCACCAGCCTACTGGC]AGAGCTTCTGCAGTCTG 3`(19bp spacer sequence between target sequences for L and R TALEN subunits is annotated with square brackets) containing the XcmI (NEB) restriction enzyme site 5`CCANNNNNNNNNTGG 3`was chosen for the mutagenesis. .. Primers flanking the target site were designed amplifying a 281bp PCR product; klf2a TAL XcmI F 5`CAGGCGACTACAGAATGCAA 3`and klf2a TAL XcmI R 5`GCCCTCTTGTTTGACTTTGG 3`.

    Mutagenesis:

    Article Title: klf2ash317 Mutant Zebrafish Do Not Recapitulate Morpholino-Induced Vascular and Haematopoietic Phenotypes
    Article Snippet: klf2a TALEN Mutagenesis We followed a published protocol for targeted TALEN mutagenesis [ ]. klf2a genomic sequence was submitted to the Old TALEN Targeter software at https://tale-nt.cac.cornell.edu/node/add/talen-old . .. A target site at the 5`end of exon 2 5`TCAACCCATCACCACCTCCACCG/AT[ACACCACCAGCCTACTGGC]AGAGCTTCTGCAGTCTG 3`(19bp spacer sequence between target sequences for L and R TALEN subunits is annotated with square brackets) containing the XcmI (NEB) restriction enzyme site 5`CCANNNNNNNNNTGG 3`was chosen for the mutagenesis. .. Primers flanking the target site were designed amplifying a 281bp PCR product; klf2a TAL XcmI F 5`CAGGCGACTACAGAATGCAA 3`and klf2a TAL XcmI R 5`GCCCTCTTGTTTGACTTTGG 3`.

    Agarose Gel Electrophoresis:

    Article Title: Attenuated Recombinant Influenza A Virus Expressing HPV16 E6 and E7 as a Novel Therapeutic Vaccine Approach
    Article Snippet: To enhance transgene expression, the splice donor site was mutagenized according to [ ], and pHW-delNS1-16E6E7FL or pHW-delNS1-16E6E7mFL plasmids were used as templates for PCR-directed mutagenesis, using primers: (forward) 5'-TGT GTC AAG CTT TCA GGT ATT TGC CGC AAT-3', (reverse) 5’-CTG TGT TAT CAT TCC ATT CAA GTC C-3’ (VBC Biotech) and Phusion™ proofreading polymerase (Finnzymes). .. Amplicons were analyzed by agarose gel electrophoresis, gel-extracted by Qiaquick kit (Qiagen) and blunt-end cloned into pCR2.1 by TOPO cloning procedure (Invitrogen), resulting in constructs pCR2.1-16E6E7FLsp and pCR2.1-16E6E7mFLsp. These were Xcm I (New England Biolabs) and Hind III (Roche) digested. .. Gel-purified digestion products were re-ligated using T4 DNA ligase (Roche).

    Clone Assay:

    Article Title: Attenuated Recombinant Influenza A Virus Expressing HPV16 E6 and E7 as a Novel Therapeutic Vaccine Approach
    Article Snippet: To enhance transgene expression, the splice donor site was mutagenized according to [ ], and pHW-delNS1-16E6E7FL or pHW-delNS1-16E6E7mFL plasmids were used as templates for PCR-directed mutagenesis, using primers: (forward) 5'-TGT GTC AAG CTT TCA GGT ATT TGC CGC AAT-3', (reverse) 5’-CTG TGT TAT CAT TCC ATT CAA GTC C-3’ (VBC Biotech) and Phusion™ proofreading polymerase (Finnzymes). .. Amplicons were analyzed by agarose gel electrophoresis, gel-extracted by Qiaquick kit (Qiagen) and blunt-end cloned into pCR2.1 by TOPO cloning procedure (Invitrogen), resulting in constructs pCR2.1-16E6E7FLsp and pCR2.1-16E6E7mFLsp. These were Xcm I (New England Biolabs) and Hind III (Roche) digested. .. Gel-purified digestion products were re-ligated using T4 DNA ligase (Roche).

    Article Title: Molecular barcoding of viral vectors enables mapping and optimization of mRNA trans-splicing
    Article Snippet: Fragmented DNA was end-repaired and dA-tailed using NEBNext end-repair and dA-tailing module (NEB). .. The zero-background cloning vector was digested with XcmI (NEB) restriction enzyme prior to the ligation ( ). .. XcmI digestion separates the ccdB gene from the backbone and leaves T-overhangs on the backbone suitable for dA/dT ligation.

    Construct:

    Article Title: Attenuated Recombinant Influenza A Virus Expressing HPV16 E6 and E7 as a Novel Therapeutic Vaccine Approach
    Article Snippet: To enhance transgene expression, the splice donor site was mutagenized according to [ ], and pHW-delNS1-16E6E7FL or pHW-delNS1-16E6E7mFL plasmids were used as templates for PCR-directed mutagenesis, using primers: (forward) 5'-TGT GTC AAG CTT TCA GGT ATT TGC CGC AAT-3', (reverse) 5’-CTG TGT TAT CAT TCC ATT CAA GTC C-3’ (VBC Biotech) and Phusion™ proofreading polymerase (Finnzymes). .. Amplicons were analyzed by agarose gel electrophoresis, gel-extracted by Qiaquick kit (Qiagen) and blunt-end cloned into pCR2.1 by TOPO cloning procedure (Invitrogen), resulting in constructs pCR2.1-16E6E7FLsp and pCR2.1-16E6E7mFLsp. These were Xcm I (New England Biolabs) and Hind III (Roche) digested. .. Gel-purified digestion products were re-ligated using T4 DNA ligase (Roche).

    Article Title: A Small Secreted Virulence-Related Protein Is Essential for the Necrotrophic Interactions of Sclerotinia sclerotiorum with Its Host Plants
    Article Snippet: .. [ ] were adopted to construct the S . sclerotiorum RNAi vectors: a 320 bp fragment from SsSSVP1 was amplified with the primers RNAi-SsSSVP1 F/R from the S . sclerotiorum cDNA library and (i) directly ligated into the digested pCXDPH vector at the Xcm I (New England Biolabs, Beverly, MA, USA) site to produce pRNAi-1 vector ( ) or (ii) digested with suitable enzymes and subsequently ligated into pCIT [ ] between PtrpC, the intron and TtrpC in the opposite orientation via intermediate vectors. .. Subsequently, the PtrpC-intron-TtrpC fragment containing the two S . sclerotiorum gene fragments in the opposite orientation was digested with Sac I and Xho I and subsequently ligated into pCH to produce pRNAi-2 vector ( ).

    Plasmid Preparation:

    Article Title: Molecular barcoding of viral vectors enables mapping and optimization of mRNA trans-splicing
    Article Snippet: Fragmented DNA was end-repaired and dA-tailed using NEBNext end-repair and dA-tailing module (NEB). .. The zero-background cloning vector was digested with XcmI (NEB) restriction enzyme prior to the ligation ( ). .. XcmI digestion separates the ccdB gene from the backbone and leaves T-overhangs on the backbone suitable for dA/dT ligation.

    Article Title: A Small Secreted Virulence-Related Protein Is Essential for the Necrotrophic Interactions of Sclerotinia sclerotiorum with Its Host Plants
    Article Snippet: .. [ ] were adopted to construct the S . sclerotiorum RNAi vectors: a 320 bp fragment from SsSSVP1 was amplified with the primers RNAi-SsSSVP1 F/R from the S . sclerotiorum cDNA library and (i) directly ligated into the digested pCXDPH vector at the Xcm I (New England Biolabs, Beverly, MA, USA) site to produce pRNAi-1 vector ( ) or (ii) digested with suitable enzymes and subsequently ligated into pCIT [ ] between PtrpC, the intron and TtrpC in the opposite orientation via intermediate vectors. .. Subsequently, the PtrpC-intron-TtrpC fragment containing the two S . sclerotiorum gene fragments in the opposite orientation was digested with Sac I and Xho I and subsequently ligated into pCH to produce pRNAi-2 vector ( ).

    Ligation:

    Article Title: Molecular barcoding of viral vectors enables mapping and optimization of mRNA trans-splicing
    Article Snippet: Fragmented DNA was end-repaired and dA-tailed using NEBNext end-repair and dA-tailing module (NEB). .. The zero-background cloning vector was digested with XcmI (NEB) restriction enzyme prior to the ligation ( ). .. XcmI digestion separates the ccdB gene from the backbone and leaves T-overhangs on the backbone suitable for dA/dT ligation.

    TA Cloning:

    Article Title: A Series of TA-Based and Zero-Background Vectors for Plant Functional Genomics
    Article Snippet: Finally, the Mini35S-XVE-Nos fragment was amplified from the pLB12 vector and inserted into the XhoI/KpnI site of pGreen to form the vector pGreen-XVE-B/K. .. TA Cloning Using Modified pGreen Vectors TA-based modified pGreen vectors were digested with XcmI (New England Biolabs). .. PCR products were amplified using the proofreading pfu DNA polymerase (Takara, Japan), followed by the A-addition procedure previously described.

    Modification:

    Article Title: A Series of TA-Based and Zero-Background Vectors for Plant Functional Genomics
    Article Snippet: Finally, the Mini35S-XVE-Nos fragment was amplified from the pLB12 vector and inserted into the XhoI/KpnI site of pGreen to form the vector pGreen-XVE-B/K. .. TA Cloning Using Modified pGreen Vectors TA-based modified pGreen vectors were digested with XcmI (New England Biolabs). .. PCR products were amplified using the proofreading pfu DNA polymerase (Takara, Japan), followed by the A-addition procedure previously described.

    Amplification:

    Article Title: A Small Secreted Virulence-Related Protein Is Essential for the Necrotrophic Interactions of Sclerotinia sclerotiorum with Its Host Plants
    Article Snippet: .. [ ] were adopted to construct the S . sclerotiorum RNAi vectors: a 320 bp fragment from SsSSVP1 was amplified with the primers RNAi-SsSSVP1 F/R from the S . sclerotiorum cDNA library and (i) directly ligated into the digested pCXDPH vector at the Xcm I (New England Biolabs, Beverly, MA, USA) site to produce pRNAi-1 vector ( ) or (ii) digested with suitable enzymes and subsequently ligated into pCIT [ ] between PtrpC, the intron and TtrpC in the opposite orientation via intermediate vectors. .. Subsequently, the PtrpC-intron-TtrpC fragment containing the two S . sclerotiorum gene fragments in the opposite orientation was digested with Sac I and Xho I and subsequently ligated into pCH to produce pRNAi-2 vector ( ).

    cDNA Library Assay:

    Article Title: A Small Secreted Virulence-Related Protein Is Essential for the Necrotrophic Interactions of Sclerotinia sclerotiorum with Its Host Plants
    Article Snippet: .. [ ] were adopted to construct the S . sclerotiorum RNAi vectors: a 320 bp fragment from SsSSVP1 was amplified with the primers RNAi-SsSSVP1 F/R from the S . sclerotiorum cDNA library and (i) directly ligated into the digested pCXDPH vector at the Xcm I (New England Biolabs, Beverly, MA, USA) site to produce pRNAi-1 vector ( ) or (ii) digested with suitable enzymes and subsequently ligated into pCIT [ ] between PtrpC, the intron and TtrpC in the opposite orientation via intermediate vectors. .. Subsequently, the PtrpC-intron-TtrpC fragment containing the two S . sclerotiorum gene fragments in the opposite orientation was digested with Sac I and Xho I and subsequently ligated into pCH to produce pRNAi-2 vector ( ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • xcm i  (New England Biolabs)
    94
    New England Biolabs xcm i
    Site-specific mutagenesis of the maize ubiqutin-1 promoter (A) and the backbone of the binary vector pCAMBIA1300 (B) in which three <t>Xcm</t> I recognition sites were deleted. The nucleotides represented in lowercase italic letters are the positions where deletions
    Xcm I, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xcm i/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    xcm i - by Bioz Stars, 2021-03
    94/100 stars
    		  Buy from Supplier

    Image Search Results


    Site-specific mutagenesis of the maize ubiqutin-1 promoter (A) and the backbone of the binary vector pCAMBIA1300 (B) in which three Xcm I recognition sites were deleted. The nucleotides represented in lowercase italic letters are the positions where deletions

    Journal: Plant Physiology

    Article Title: A Versatile Zero Background T-Vector System for Gene Cloning and Functional Genomics 1A Versatile Zero Background T-Vector System for Gene Cloning and Functional Genomics 1 [C]A Versatile Zero Background T-Vector System for Gene Cloning and Functional Genomics 1 [C] [W]A Versatile Zero Background T-Vector System for Gene Cloning and Functional Genomics 1 [C] [W] [OA]

    doi: 10.1104/pp.109.137125

    Figure Lengend Snippet: Site-specific mutagenesis of the maize ubiqutin-1 promoter (A) and the backbone of the binary vector pCAMBIA1300 (B) in which three Xcm I recognition sites were deleted. The nucleotides represented in lowercase italic letters are the positions where deletions

    Article Snippet: The ZeBaTA vectors were digested with Xcm I (New England Biolabs).

    Techniques: Mutagenesis, Plasmid Preparation

    ZeBaTA-based expression vectors for gene overexpression/silencing, protein tagging, protein subcellular localization, and promoter analysis in plants. A, Schematic structures of the transient expression vectors generated by Xcm I digestion. B, Schematic

    Journal: Plant Physiology

    Article Title: A Versatile Zero Background T-Vector System for Gene Cloning and Functional Genomics 1A Versatile Zero Background T-Vector System for Gene Cloning and Functional Genomics 1 [C]A Versatile Zero Background T-Vector System for Gene Cloning and Functional Genomics 1 [C] [W]A Versatile Zero Background T-Vector System for Gene Cloning and Functional Genomics 1 [C] [W] [OA]

    doi: 10.1104/pp.109.137125

    Figure Lengend Snippet: ZeBaTA-based expression vectors for gene overexpression/silencing, protein tagging, protein subcellular localization, and promoter analysis in plants. A, Schematic structures of the transient expression vectors generated by Xcm I digestion. B, Schematic

    Article Snippet: The ZeBaTA vectors were digested with Xcm I (New England Biolabs).

    Techniques: Expressing, Over Expression, Generated

    Construction of the ZeBaTA system. A, Schematic representation of direct cloning of PCR product using the ZeBaTA vector system. The linker of the vector (in gray) is removed after Xcm I digestion yielding a linearized T-vector. B, TA cloning tests of the

    Journal: Plant Physiology

    Article Title: A Versatile Zero Background T-Vector System for Gene Cloning and Functional Genomics 1A Versatile Zero Background T-Vector System for Gene Cloning and Functional Genomics 1 [C]A Versatile Zero Background T-Vector System for Gene Cloning and Functional Genomics 1 [C] [W]A Versatile Zero Background T-Vector System for Gene Cloning and Functional Genomics 1 [C] [W] [OA]

    doi: 10.1104/pp.109.137125

    Figure Lengend Snippet: Construction of the ZeBaTA system. A, Schematic representation of direct cloning of PCR product using the ZeBaTA vector system. The linker of the vector (in gray) is removed after Xcm I digestion yielding a linearized T-vector. B, TA cloning tests of the

    Article Snippet: The ZeBaTA vectors were digested with Xcm I (New England Biolabs).

    Techniques: Clone Assay, Polymerase Chain Reaction, Plasmid Preparation, TA Cloning

    Generation of a stable klf2a sh317 mutant line. (A) Schematic structure of wildtype klf2a gene with genomic sequence at the TALEN mutagenesis site. XcmI restriction site is indicated by the green line and the 19bp spacer for the TALEN structure of choice is indicated by the black line. The 14bp deletion identified in the klf2a sh317 allele is indicated by the sequence in red. (B) Schematic structure of Klf2a wildtype and Klf2a sh317 mutant proteins with amino acid (AA) lengths and predicted molecular weights in kilodaltons (kDa) Klf2a transactivation domain is in purple and transrepression domain is in yellow colour. (C) Substantial reduction of the 43kDa band representing the full-length Klf2a protein can be seen in a western blot of whole-embryo protein samples extracted from the F3 generation of klf2a sh317 mutant embryos at 5dpf, compared to wildtype embryos and heterozygous klf2a sh317 carriers. Additionally, two bands running at approximately 33kDa can be seen in the klf2a sh317 mutant, possibly representing truncated Klf2a. Asterixes indicate bands of approx. molecular weights of 38kDa and 47kDa consistent with expression of Klf4a and Biklf/Klf4b/Klf17 respectively, present in all three lanes in equal intensity. β actin was used as a loading control. (D) klf2a coding sequence was amplified from the control cDNA originating from 48hpf wildtype embryos giving an expected 1155bp PCR product. No band was detected in the sample with cDNA from unfertilised embryos (unf. cDNA) indicating the absence of maternal klf2a mRNA in unfertilised embryos. No 1674bp band was detected in unfertilised cDNA or control cDNA confirming absence of genomic DNA contamination. gapdh was used as a positive control. A band of expected size was detected in both the unfertilised eggs cDNA and control cDNA lanes indicating maternal gapdh mRNA in unfertilised zebrafish eggs. Abbreviations: -E: negative control with no reverse transcriptase added during reverse transcription (RT). -RNA: negative control with no RNA added during RT. B: blank, no template added to the PCR reaction. Abbreviations: L: Hyperladder II (NEB).

    Journal: PLoS ONE

    Article Title: klf2ash317 Mutant Zebrafish Do Not Recapitulate Morpholino-Induced Vascular and Haematopoietic Phenotypes

    doi: 10.1371/journal.pone.0141611

    Figure Lengend Snippet: Generation of a stable klf2a sh317 mutant line. (A) Schematic structure of wildtype klf2a gene with genomic sequence at the TALEN mutagenesis site. XcmI restriction site is indicated by the green line and the 19bp spacer for the TALEN structure of choice is indicated by the black line. The 14bp deletion identified in the klf2a sh317 allele is indicated by the sequence in red. (B) Schematic structure of Klf2a wildtype and Klf2a sh317 mutant proteins with amino acid (AA) lengths and predicted molecular weights in kilodaltons (kDa) Klf2a transactivation domain is in purple and transrepression domain is in yellow colour. (C) Substantial reduction of the 43kDa band representing the full-length Klf2a protein can be seen in a western blot of whole-embryo protein samples extracted from the F3 generation of klf2a sh317 mutant embryos at 5dpf, compared to wildtype embryos and heterozygous klf2a sh317 carriers. Additionally, two bands running at approximately 33kDa can be seen in the klf2a sh317 mutant, possibly representing truncated Klf2a. Asterixes indicate bands of approx. molecular weights of 38kDa and 47kDa consistent with expression of Klf4a and Biklf/Klf4b/Klf17 respectively, present in all three lanes in equal intensity. β actin was used as a loading control. (D) klf2a coding sequence was amplified from the control cDNA originating from 48hpf wildtype embryos giving an expected 1155bp PCR product. No band was detected in the sample with cDNA from unfertilised embryos (unf. cDNA) indicating the absence of maternal klf2a mRNA in unfertilised embryos. No 1674bp band was detected in unfertilised cDNA or control cDNA confirming absence of genomic DNA contamination. gapdh was used as a positive control. A band of expected size was detected in both the unfertilised eggs cDNA and control cDNA lanes indicating maternal gapdh mRNA in unfertilised zebrafish eggs. Abbreviations: -E: negative control with no reverse transcriptase added during reverse transcription (RT). -RNA: negative control with no RNA added during RT. B: blank, no template added to the PCR reaction. Abbreviations: L: Hyperladder II (NEB).

    Article Snippet: A target site at the 5`end of exon 2 5`TCAACCCATCACCACCTCCACCG/AT[ACACCACCAGCCTACTGGC]AGAGCTTCTGCAGTCTG 3`(19bp spacer sequence between target sequences for L and R TALEN subunits is annotated with square brackets) containing the XcmI (NEB) restriction enzyme site 5`CCANNNNNNNNNTGG 3`was chosen for the mutagenesis.

    Techniques: Mutagenesis, Sequencing, Western Blot, Expressing, Amplification, Polymerase Chain Reaction, Positive Control, Negative Control

    Construction of the TA-based expression vectors. A, workflow for the direct cloning of PCR products using the TA-based expression vector system. TA-based expression vectors were digested by XcmI to produce 3′-T-overhangs. The PCR products were ligated with the XcmI-digested vector by T4 ligase. B, Left: Self-ligation of the XcmI-digested vector by T4 ligase. Right: Ligation of the PCR product of the GFP gene with the XcmI-digested vector by T4 ligase, followed by transformation into DH5α strains. C, Samples of restriction digestion analyses of randomly selected colonies from the ligation of the XcmI-digested pGreen vector with the product of the GFP gene using T4 ligase.

    Journal: PLoS ONE

    Article Title: A Series of TA-Based and Zero-Background Vectors for Plant Functional Genomics

    doi: 10.1371/journal.pone.0059576

    Figure Lengend Snippet: Construction of the TA-based expression vectors. A, workflow for the direct cloning of PCR products using the TA-based expression vector system. TA-based expression vectors were digested by XcmI to produce 3′-T-overhangs. The PCR products were ligated with the XcmI-digested vector by T4 ligase. B, Left: Self-ligation of the XcmI-digested vector by T4 ligase. Right: Ligation of the PCR product of the GFP gene with the XcmI-digested vector by T4 ligase, followed by transformation into DH5α strains. C, Samples of restriction digestion analyses of randomly selected colonies from the ligation of the XcmI-digested pGreen vector with the product of the GFP gene using T4 ligase.

    Article Snippet: TA Cloning Using Modified pGreen Vectors TA-based modified pGreen vectors were digested with XcmI (New England Biolabs).

    Techniques: Expressing, Clone Assay, Polymerase Chain Reaction, Plasmid Preparation, Ligation, Transformation Assay