eari  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Name:
    EarI
    Description:
    EarI 2 500 units
    Catalog Number:
    R0528L
    Price:
    269
    Category:
    Restriction Enzymes
    Size:
    2 500 units
    Buy from Supplier


    Structured Review

    New England Biolabs eari
    EarI
    EarI 2 500 units
    https://www.bioz.com/result/eari/product/New England Biolabs
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    eari - by Bioz Stars, 2021-05
    92/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: The importance of a potential phosphorylation site in enamelin on enamel formation
    Article Snippet: A genotyping PCR was performed on tail lysates using primers 5′-TTACGCCTGTGTTGGGTCTT-3′ and 5′-TGGTTTGGCACTAGCTCCTT-3′. .. The genotypes were determined by restriction digestion on the 715 bp PCR products with EarI (New England Biolabs, MA, USA). .. The reverse complementary chains of the WT allele were cleaved into 575 bp and a 140 bp fragments, while those of the mutant allele were not cleaved because the mutation had eliminated the EarI restriction site.

    Article Title: Postsynaptic CaV1.1-driven calcium signaling coordinates presynaptic differentiation at the developing neuromuscular junction
    Article Snippet: The following primers were used (purchased from Eurofins ): Cav 1.1−/− mice, forward: GGCATGCAGATGTTCGGGAAGATC, reverse: GCAGCTTTCCACTCAGGAGGGATCCAGTGT. .. PCR product (270 bp) was cut with EarI (New England Biolab, R05285). .. The wildtype allele yielded 100 bp and 170 bp fragments, the knockout allele yielded a 270 bp fragment.

    Article Title: Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism, et al. Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism
    Article Snippet: .. Probe sequences were synthesized on a single microarray as 150mers by CustomArray, Inc. smMIPS probes were PCR amplified from the resulting pool, using externally directed primers “mipPrep1F” and “mipPrep1R” (5′‐GGTAGCAAAGTGCAGATGTGCTCTTC‐3′, and 5′‐TGAACTCACACTGCTCTGAACTCTTC‐3′), digested overnight with EarI (NEB) to remove flanking amplification primers, purified with one volume SPRI beads supplemented with five volumes isopropanol, and eluted in Tris‐EDTA pH 8. .. For smMIPS captures, approximately 3 ng smMIPS probes were combined with 125 ng genomic DNA, in a reaction mixture including Ampligase DNA Ligase Buffer 1X (Epicentre), 0.4 μM dNTPs (NEB), 3.2U HemoKlentaq (NEB) and 1U Ampligase (Epicentre).

    Article Title: Distinct transcriptomic changes in E14.5 mouse skeletal muscle lacking RYR1 or Cav1.1 converge at E18.5
    Article Snippet: For genotyping the RYR1 line (Ryr1 gene), primers forward: 5’- GGACTGGCAAGAGGACCGGAGC -3’ and reverse: 5’-GGAAGCCAGGGCTGCAGGTGAGC-3’ were used for detection of the WT (+) allele; and primers forward: 5’- GGACTGGCAAGAGGACCGGAGC -3’ and reverse: 5’-CCTGAAGAACGAGATCAGCAGCCTCTGTCCC-3’ –for the detection of the mutant (-) allele. .. Primers forward: 5’-GCTTTGCAGATGTTCGGGAAGATCGCCATGG-3’ and reverse: 5’-GCAGCTTTCCACTCAGGAGGGATCCAGTGT-3’ were used for genotyping the Cav 1.1 line (Cacna1s gene), the resulting PCR products being subsequently subjected to a restriction analyses via Ear I (NEB, Cat. #R0528S). .. Ear I digests only the PCR product from the WT Ca v 1 .1 allele but not the mutant allele.

    Article Title: A New Lineage of Cryptococcus gattii (VGV) Discovered in the Central Zambezian Miombo Woodlands
    Article Snippet: .. Three microliters of URA5 PCR products was digested with StuI (10 U/μl) or EarI (20 U/μl) (New England BioLabs Inc.) at 37°C for 4 h, and restriction fragments were separated by electrophoresis in 3% agarose Tris-acetate-EDTA (TAE) gels at 80 V for 5 h. Standard reference strains for molecular typing were used as controls. .. The virulence of four VGV isolates, two from clade A and two from clade B, was assessed using 7-to-8-week-old female C57BL/6 mice (Taconic Farms).

    Article Title: Association of TUSC1 and DPF3 gene polymorphisms with male infertility
    Article Snippet: DNA from each subject was amplified using EmeraldAmp MAX PCR Master Mix (TaKaRa Bio Inc., Otsu, Japan) under the following PCR cycling parameters: initial denaturation at 94 °C for 3 min; 30 cycles of 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min; and final extension for 3 min at 72 °C. .. The resulting PCR products were then digested at 37 °C for 3 h using the following restriction enzymes: EarI (rs12376894), HpyCH4IV (rs10129954), PvuII (rs12348), and Hpy166II (rs2772579); all of which were sourced from New England Biolabs Japan Inc., Tokyo, Japan. ..

    Synthesized:

    Article Title: Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism, et al. Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism
    Article Snippet: .. Probe sequences were synthesized on a single microarray as 150mers by CustomArray, Inc. smMIPS probes were PCR amplified from the resulting pool, using externally directed primers “mipPrep1F” and “mipPrep1R” (5′‐GGTAGCAAAGTGCAGATGTGCTCTTC‐3′, and 5′‐TGAACTCACACTGCTCTGAACTCTTC‐3′), digested overnight with EarI (NEB) to remove flanking amplification primers, purified with one volume SPRI beads supplemented with five volumes isopropanol, and eluted in Tris‐EDTA pH 8. .. For smMIPS captures, approximately 3 ng smMIPS probes were combined with 125 ng genomic DNA, in a reaction mixture including Ampligase DNA Ligase Buffer 1X (Epicentre), 0.4 μM dNTPs (NEB), 3.2U HemoKlentaq (NEB) and 1U Ampligase (Epicentre).

    Microarray:

    Article Title: Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism, et al. Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism
    Article Snippet: .. Probe sequences were synthesized on a single microarray as 150mers by CustomArray, Inc. smMIPS probes were PCR amplified from the resulting pool, using externally directed primers “mipPrep1F” and “mipPrep1R” (5′‐GGTAGCAAAGTGCAGATGTGCTCTTC‐3′, and 5′‐TGAACTCACACTGCTCTGAACTCTTC‐3′), digested overnight with EarI (NEB) to remove flanking amplification primers, purified with one volume SPRI beads supplemented with five volumes isopropanol, and eluted in Tris‐EDTA pH 8. .. For smMIPS captures, approximately 3 ng smMIPS probes were combined with 125 ng genomic DNA, in a reaction mixture including Ampligase DNA Ligase Buffer 1X (Epicentre), 0.4 μM dNTPs (NEB), 3.2U HemoKlentaq (NEB) and 1U Ampligase (Epicentre).

    Amplification:

    Article Title: Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism, et al. Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism
    Article Snippet: .. Probe sequences were synthesized on a single microarray as 150mers by CustomArray, Inc. smMIPS probes were PCR amplified from the resulting pool, using externally directed primers “mipPrep1F” and “mipPrep1R” (5′‐GGTAGCAAAGTGCAGATGTGCTCTTC‐3′, and 5′‐TGAACTCACACTGCTCTGAACTCTTC‐3′), digested overnight with EarI (NEB) to remove flanking amplification primers, purified with one volume SPRI beads supplemented with five volumes isopropanol, and eluted in Tris‐EDTA pH 8. .. For smMIPS captures, approximately 3 ng smMIPS probes were combined with 125 ng genomic DNA, in a reaction mixture including Ampligase DNA Ligase Buffer 1X (Epicentre), 0.4 μM dNTPs (NEB), 3.2U HemoKlentaq (NEB) and 1U Ampligase (Epicentre).

    Purification:

    Article Title: Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism, et al. Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism
    Article Snippet: .. Probe sequences were synthesized on a single microarray as 150mers by CustomArray, Inc. smMIPS probes were PCR amplified from the resulting pool, using externally directed primers “mipPrep1F” and “mipPrep1R” (5′‐GGTAGCAAAGTGCAGATGTGCTCTTC‐3′, and 5′‐TGAACTCACACTGCTCTGAACTCTTC‐3′), digested overnight with EarI (NEB) to remove flanking amplification primers, purified with one volume SPRI beads supplemented with five volumes isopropanol, and eluted in Tris‐EDTA pH 8. .. For smMIPS captures, approximately 3 ng smMIPS probes were combined with 125 ng genomic DNA, in a reaction mixture including Ampligase DNA Ligase Buffer 1X (Epicentre), 0.4 μM dNTPs (NEB), 3.2U HemoKlentaq (NEB) and 1U Ampligase (Epicentre).

    Article Title: ‘Shotgun DNA synthesis’ for the high-throughput construction of large DNA molecules
    Article Snippet: For the construction of 11 ∼1 kb DNA fragments, gel purified error-free fragments were pooled together based on the use of restriction enzyme types ( Supplementary Table S1 ). .. For each pool, restriction enzyme digestion was carried out by incubating 2 µl EarI (or EcoP15I), 5 µl NEB buffer 1, 0.5 µl 100× BSA and 10 µl water with 30 µl of purified (and pooled) shotgun synthesis fragments at 37°C for 3 h. For EcoP15I (NEB, Ipswich, MA, USA) restriction enzyme digestion, we used NEB buffer 3 and added 10× ATP. ..

    Electrophoresis:

    Article Title: A New Lineage of Cryptococcus gattii (VGV) Discovered in the Central Zambezian Miombo Woodlands
    Article Snippet: .. Three microliters of URA5 PCR products was digested with StuI (10 U/μl) or EarI (20 U/μl) (New England BioLabs Inc.) at 37°C for 4 h, and restriction fragments were separated by electrophoresis in 3% agarose Tris-acetate-EDTA (TAE) gels at 80 V for 5 h. Standard reference strains for molecular typing were used as controls. .. The virulence of four VGV isolates, two from clade A and two from clade B, was assessed using 7-to-8-week-old female C57BL/6 mice (Taconic Farms).

    Modification:

    Article Title: Development of a high-dynamic range, GFP-based FRET probe sensitive to oxidative microenvironments
    Article Snippet: .. Enzymes for the modification of DNA and pCR2.1 TOPO TA cloning kit were from Invitrogen (Carlsbad, CA, USA) and EarI from NEB (Ipswich, MA, USA). ..

    TA Cloning:

    Article Title: Development of a high-dynamic range, GFP-based FRET probe sensitive to oxidative microenvironments
    Article Snippet: .. Enzymes for the modification of DNA and pCR2.1 TOPO TA cloning kit were from Invitrogen (Carlsbad, CA, USA) and EarI from NEB (Ipswich, MA, USA). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    New England Biolabs eari
    Eari, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/eari/product/New England Biolabs
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    eari - by Bioz Stars, 2021-05
    92/100 stars
      Buy from Supplier

    Image Search Results