eari  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Name:
    EarI
    Description:
    EarI 2 500 units
    Catalog Number:
    r0528l
    Price:
    269
    Size:
    2 500 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs eari
    EarI
    EarI 2 500 units
    https://www.bioz.com/result/eari/product/New England Biolabs
    Average 94 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    eari - by Bioz Stars, 2020-09
    94/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism, et al. Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism
    Article Snippet: .. Probe sequences were synthesized on a single microarray as 150mers by CustomArray, Inc. smMIPS probes were PCR amplified from the resulting pool, using externally directed primers “mipPrep1F” and “mipPrep1R” (5′‐GGTAGCAAAGTGCAGATGTGCTCTTC‐3′, and 5′‐TGAACTCACACTGCTCTGAACTCTTC‐3′), digested overnight with EarI (NEB) to remove flanking amplification primers, purified with one volume SPRI beads supplemented with five volumes isopropanol, and eluted in Tris‐EDTA pH 8. .. For smMIPS captures, approximately 3 ng smMIPS probes were combined with 125 ng genomic DNA, in a reaction mixture including Ampligase DNA Ligase Buffer 1X (Epicentre), 0.4 μM dNTPs (NEB), 3.2U HemoKlentaq (NEB) and 1U Ampligase (Epicentre).

    Synthesized:

    Article Title: Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism, et al. Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism
    Article Snippet: .. Probe sequences were synthesized on a single microarray as 150mers by CustomArray, Inc. smMIPS probes were PCR amplified from the resulting pool, using externally directed primers “mipPrep1F” and “mipPrep1R” (5′‐GGTAGCAAAGTGCAGATGTGCTCTTC‐3′, and 5′‐TGAACTCACACTGCTCTGAACTCTTC‐3′), digested overnight with EarI (NEB) to remove flanking amplification primers, purified with one volume SPRI beads supplemented with five volumes isopropanol, and eluted in Tris‐EDTA pH 8. .. For smMIPS captures, approximately 3 ng smMIPS probes were combined with 125 ng genomic DNA, in a reaction mixture including Ampligase DNA Ligase Buffer 1X (Epicentre), 0.4 μM dNTPs (NEB), 3.2U HemoKlentaq (NEB) and 1U Ampligase (Epicentre).

    Purification:

    Article Title: Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism, et al. Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism
    Article Snippet: .. Probe sequences were synthesized on a single microarray as 150mers by CustomArray, Inc. smMIPS probes were PCR amplified from the resulting pool, using externally directed primers “mipPrep1F” and “mipPrep1R” (5′‐GGTAGCAAAGTGCAGATGTGCTCTTC‐3′, and 5′‐TGAACTCACACTGCTCTGAACTCTTC‐3′), digested overnight with EarI (NEB) to remove flanking amplification primers, purified with one volume SPRI beads supplemented with five volumes isopropanol, and eluted in Tris‐EDTA pH 8. .. For smMIPS captures, approximately 3 ng smMIPS probes were combined with 125 ng genomic DNA, in a reaction mixture including Ampligase DNA Ligase Buffer 1X (Epicentre), 0.4 μM dNTPs (NEB), 3.2U HemoKlentaq (NEB) and 1U Ampligase (Epicentre).

    Electrophoresis:

    Article Title: A New Lineage of Cryptococcus gattii (VGV) Discovered in the Central Zambezian Miombo Woodlands
    Article Snippet: .. Three microliters of URA5 PCR products was digested with StuI (10 U/μl) or EarI (20 U/μl) (New England BioLabs Inc.) at 37°C for 4 h, and restriction fragments were separated by electrophoresis in 3% agarose Tris-acetate-EDTA (TAE) gels at 80 V for 5 h. Standard reference strains for molecular typing were used as controls. .. The virulence of four VGV isolates, two from clade A and two from clade B, was assessed using 7-to-8-week-old female C57BL/6 mice (Taconic Farms).

    Microarray:

    Article Title: Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism, et al. Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism
    Article Snippet: .. Probe sequences were synthesized on a single microarray as 150mers by CustomArray, Inc. smMIPS probes were PCR amplified from the resulting pool, using externally directed primers “mipPrep1F” and “mipPrep1R” (5′‐GGTAGCAAAGTGCAGATGTGCTCTTC‐3′, and 5′‐TGAACTCACACTGCTCTGAACTCTTC‐3′), digested overnight with EarI (NEB) to remove flanking amplification primers, purified with one volume SPRI beads supplemented with five volumes isopropanol, and eluted in Tris‐EDTA pH 8. .. For smMIPS captures, approximately 3 ng smMIPS probes were combined with 125 ng genomic DNA, in a reaction mixture including Ampligase DNA Ligase Buffer 1X (Epicentre), 0.4 μM dNTPs (NEB), 3.2U HemoKlentaq (NEB) and 1U Ampligase (Epicentre).

    Incubation:

    Article Title: DNA-rescuable allosteric inhibition of aptamer II ligand affinity by aptamer I element in the shortened Vibrio cholerae glycine riboswitch
    Article Snippet: .. Riboswitch plasmids were linearized by incubated with EarI (New England Biolabs) at 0.2 U/µg of plasmid in the supplied NEB buffer 4 at 37°C overnight. .. RNAs were transcribed in 1 ml reaction mixture containing 40 mM Tris-HCl (pH 7.9), 2 mM spermidine-3HCl, 10 mM DTT, 25 mM MgCl2 , 5 mM each of the nucleotide triphosphates, 50 µg/ml linearized plasmid, 0.01 U/µl 5 PRIME™ stop “RNase inhibitor RX (5 PRIME life science), 8 mU/µl thermostable inorganic pyrophosphatase (New England Biolabs), and 45 µg/ml T7 RNA polymerase (expressed and purified in-house) for 4 h to overnight at 37°C.

    Polymerase Chain Reaction:

    Article Title: A New Lineage of Cryptococcus gattii (VGV) Discovered in the Central Zambezian Miombo Woodlands
    Article Snippet: .. Three microliters of URA5 PCR products was digested with StuI (10 U/μl) or EarI (20 U/μl) (New England BioLabs Inc.) at 37°C for 4 h, and restriction fragments were separated by electrophoresis in 3% agarose Tris-acetate-EDTA (TAE) gels at 80 V for 5 h. Standard reference strains for molecular typing were used as controls. .. The virulence of four VGV isolates, two from clade A and two from clade B, was assessed using 7-to-8-week-old female C57BL/6 mice (Taconic Farms).

    Article Title: Association of TUSC1 and DPF3 gene polymorphisms with male infertility
    Article Snippet: .. The resulting PCR products were then digested at 37 °C for 3 h using the following restriction enzymes: EarI (rs12376894), HpyCH4IV (rs10129954), PvuII (rs12348), and Hpy166II (rs2772579); all of which were sourced from New England Biolabs Japan Inc., Tokyo, Japan. ..

    Article Title: Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism, et al. Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism
    Article Snippet: .. Probe sequences were synthesized on a single microarray as 150mers by CustomArray, Inc. smMIPS probes were PCR amplified from the resulting pool, using externally directed primers “mipPrep1F” and “mipPrep1R” (5′‐GGTAGCAAAGTGCAGATGTGCTCTTC‐3′, and 5′‐TGAACTCACACTGCTCTGAACTCTTC‐3′), digested overnight with EarI (NEB) to remove flanking amplification primers, purified with one volume SPRI beads supplemented with five volumes isopropanol, and eluted in Tris‐EDTA pH 8. .. For smMIPS captures, approximately 3 ng smMIPS probes were combined with 125 ng genomic DNA, in a reaction mixture including Ampligase DNA Ligase Buffer 1X (Epicentre), 0.4 μM dNTPs (NEB), 3.2U HemoKlentaq (NEB) and 1U Ampligase (Epicentre).

    Article Title: Postsynaptic CaV1.1-driven calcium signaling coordinates presynaptic differentiation at the developing neuromuscular junction
    Article Snippet: .. PCR product (270 bp) was cut with EarI (New England Biolab, R05285). .. The wildtype allele yielded 100 bp and 170 bp fragments, the knockout allele yielded a 270 bp fragment.

    Article Title: Distinct transcriptomic changes in E14.5 mouse skeletal muscle lacking RYR1 or Cav1.1 converge at E18.5
    Article Snippet: .. Primers forward: 5’-GCTTTGCAGATGTTCGGGAAGATCGCCATGG-3’ and reverse: 5’-GCAGCTTTCCACTCAGGAGGGATCCAGTGT-3’ were used for genotyping the Cav 1.1 line (Cacna1s gene), the resulting PCR products being subsequently subjected to a restriction analyses via Ear I (NEB, Cat. #R0528S). .. Ear I digests only the PCR product from the WT Ca v 1 .1 allele but not the mutant allele.

    Article Title: Distinct transcriptomic changes in E14.5 mouse skeletal muscle lacking RYR1 or Cav1.1 converge at E18.5
    Article Snippet: .. Primers forward: 5’-GCTTTGCAGATGTTCGGGAAGATCGCCATGG-3’ and reverse: 5’-GCAGCTTTCCACTCAGGAGGGATCCAGTGT-3’ were used for genotyping the Cav 1.1 line ( Cacna1s gene), the resulting PCR products being subsequently subjected to a restriction analyses via Ear I (NEB, Cat. #R0528S). ..

    Plasmid Preparation:

    Article Title: DNA-rescuable allosteric inhibition of aptamer II ligand affinity by aptamer I element in the shortened Vibrio cholerae glycine riboswitch
    Article Snippet: .. Riboswitch plasmids were linearized by incubated with EarI (New England Biolabs) at 0.2 U/µg of plasmid in the supplied NEB buffer 4 at 37°C overnight. .. RNAs were transcribed in 1 ml reaction mixture containing 40 mM Tris-HCl (pH 7.9), 2 mM spermidine-3HCl, 10 mM DTT, 25 mM MgCl2 , 5 mM each of the nucleotide triphosphates, 50 µg/ml linearized plasmid, 0.01 U/µl 5 PRIME™ stop “RNase inhibitor RX (5 PRIME life science), 8 mU/µl thermostable inorganic pyrophosphatase (New England Biolabs), and 45 µg/ml T7 RNA polymerase (expressed and purified in-house) for 4 h to overnight at 37°C.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    New England Biolabs eari
    Eari, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/eari/product/New England Biolabs
    Average 94 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    eari - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    Image Search Results