restriction endonuclease bsphi  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    New England Biolabs restriction endonuclease bsphi
    Restriction Endonuclease Bsphi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction endonuclease bsphi/product/New England Biolabs
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    restriction endonuclease bsphi - by Bioz Stars, 2020-04
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence
    Article Snippet: Bacterial strains, media and reagents Escherichia coli (E. coli ) DH11S {mcrA Δ[mrr -hsdRMS (rK- , mK+ )-mcrBC ] Δ(lac-proAB ) Δ(recA1398 ) deoR, rpsL, srl-thi, supE /F' proAB + lacIQ Z ΔM15 } (Life Technologies, Gaithersburg, MD, USA) was used as cloning host and for DNA propagation. .. Bst DNA Polymerase large fragment exo-, pUC19 DNA, BsaI, NcoI and BspHI, T4 DNA ligase REase were from New England Biolabs (Ipswich, MA, USA).

    Article Title: Role of pleiotropy during adaptation of TEM-1 β-lactamase to two novel antibiotics
    Article Snippet: The primers P3 (TCATCCGGCTCGTATAATGTGTGGA) and P4 (ACTCTCTTCCGGGCGCTATCAT) flank the multiple cloning site of pACSE3 and were used for PCR amplification with pACTEM1 as a template. .. The cycling program consisted of the following: denaturation at 95°C for 2 min, 30 cycles of denaturation (30 s at 95°C), annealing (30 s at 60°C), and extension (75 s at 72°C), followed by a final step at 72°C for 10 min. Amplicons were digested with BspHI and SacI restriction enzymes, followed by DpnI (to remove template), ligated into pACSE3 using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), and electroporated into DH5α E. Cells were allowed to recover in SOC medium (20 g tryptone and 5 g yeast extract/liter supplied with 10 mm NaCl, 2.5 mm KCl, 10 mm MgSO4 , 10 mm MgCl2 , and 20 mm glucose) at 37°C for 60 min.

    Article Title: The three-dimensional crystal structure of the PrpF protein of Shewanella oneidensis complexed with trans-aconitate: Insights into its biological function
    Article Snippet: Restriction endonucleases NheI and NcoI were purchased from Promega, and BspHI was purchased from New England Biolabs. .. All cloning was done in Escherichia coli strain DH5α/F′ (New England Biolabs) unless otherwise stated.

    Article Title: Structural Characterization of the Xi Class Glutathione Transferase From the Haloalkaliphilic Archaeon Natrialba magadii
    Article Snippet: Paragraph title: Cloning Strategy ... Then, the inserted fragment was digested with BspHI and BamHI (New England BioLabs) from pCR2.1 TOPO vector and inserted into the PciI and BamHI sites of pTA963 expression vector.

    Amplification:

    Article Title: TNFα G308A polymorphism is associated with resilience to sleep deprivation-induced psychomotor vigilance performance impairment in healthy young adults
    Article Snippet: .. Amplified products were digested with another restriction enzyme, BspHI (New England Biolabs, Inc., Ipwsich, MA), which recognized a restriction site on the A allele. .. Digestion of the PCR fragments yielded products of 117 bp (G allele) and 97 bp and 20 bp (A allele).

    Article Title: Foamy virus-mediated gene transfer to canine repopulating cells
    Article Snippet: Integration site analysis by linear amplification-mediated–polymerase chain reaction (LAM-PCR) was performed on canine DNA isolated from peripheral blood leukocytes. .. Msp I or both Bsp HI and Pci I restriction enzymes (NEB, Beverly, MA) were used to digest DNA after creating double-stranded DNA.

    Article Title: Role of pleiotropy during adaptation of TEM-1 β-lactamase to two novel antibiotics
    Article Snippet: The mutagenesis conditions were tuned to induce ∼2 mutations per amplicon by adding 1130 ng of plasmid template (Salverda et al. ). .. The cycling program consisted of the following: denaturation at 95°C for 2 min, 30 cycles of denaturation (30 s at 95°C), annealing (30 s at 60°C), and extension (75 s at 72°C), followed by a final step at 72°C for 10 min. Amplicons were digested with BspHI and SacI restriction enzymes, followed by DpnI (to remove template), ligated into pACSE3 using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), and electroporated into DH5α E. Cells were allowed to recover in SOC medium (20 g tryptone and 5 g yeast extract/liter supplied with 10 mm NaCl, 2.5 mm KCl, 10 mm MgSO4 , 10 mm MgCl2 , and 20 mm glucose) at 37°C for 60 min.

    Article Title: The three-dimensional crystal structure of the PrpF protein of Shewanella oneidensis complexed with trans-aconitate: Insights into its biological function
    Article Snippet: Restriction endonucleases NheI and NcoI were purchased from Promega, and BspHI was purchased from New England Biolabs. .. The S. oneidensis prpF gene was amplified from plasmid pPRP153 ( S. oneidensis prpF+ ) ( ).

    Article Title: Structural Characterization of the Xi Class Glutathione Transferase From the Haloalkaliphilic Archaeon Natrialba magadii
    Article Snippet: Successful amplification was confirmed by agarose gel electrophoresis and the PCR product was first subcloned into pCR2.1-TOPO vector (TOPO TA Cloning Kit, Thermo Fisher Scientific) according to the manufacturer’s protocol and further sequencing to confirm a correct amplification. .. Then, the inserted fragment was digested with BspHI and BamHI (New England BioLabs) from pCR2.1 TOPO vector and inserted into the PciI and BamHI sites of pTA963 expression vector.

    Positive Control:

    Article Title: Meiotic association between Spo11 regulated by Rec102, Rec104 and Rec114
    Article Snippet: At the GAL2 locus, the purified genomic DNA was treated with AccI, BspHI, HhaI and Nt.AlwI (New England BioLabs) for several hours. .. Nt.AlwI was used as a positive control for SSB detection.

    TA Cloning:

    Article Title: Structural Characterization of the Xi Class Glutathione Transferase From the Haloalkaliphilic Archaeon Natrialba magadii
    Article Snippet: Successful amplification was confirmed by agarose gel electrophoresis and the PCR product was first subcloned into pCR2.1-TOPO vector (TOPO TA Cloning Kit, Thermo Fisher Scientific) according to the manufacturer’s protocol and further sequencing to confirm a correct amplification. .. Then, the inserted fragment was digested with BspHI and BamHI (New England BioLabs) from pCR2.1 TOPO vector and inserted into the PciI and BamHI sites of pTA963 expression vector.

    Incubation:

    Article Title: Meiotic association between Spo11 regulated by Rec102, Rec104 and Rec114
    Article Snippet: After the agarose plugs were melted at 65°C for 10 min, S1 nuclease was added and the mixture was incubated for 30 min at 37°C ( , ). .. At the GAL2 locus, the purified genomic DNA was treated with AccI, BspHI, HhaI and Nt.AlwI (New England BioLabs) for several hours.

    Article Title: Cleavage of a model DNA replication fork by a methyl-specific endonuclease
    Article Snippet: The resulting short-DNA strands were dissociated by incubation at 78°C for 10 min and 37°C for 10 min in the presence of the complementary single-strand oligonucleotide gap1-cis-C [for (vi) below] or gap1 [for (iv) below] as described before ( ). .. The 5′-ends of intermediate (iv) were labeled with [γ-32 P]ATP (Perkin Elmer) and T4 polynucleotide kinase (TaKaRa) (v), followed by cleavage with BspHI (New England Biolabs) and recovery of the left half for removal of one of the end labels (vii).

    Article Title: Structural Characterization of the Xi Class Glutathione Transferase From the Haloalkaliphilic Archaeon Natrialba magadii
    Article Snippet: The reaction was incubated at 25°C for 10 min, 37°C for 120 min, 85°C for 5 min and then at 4°C. cDNAs were stored at –20°C. nmagghr cDNA was amplified by PCR using the following primers (BspHI and BamHI sites are underlined): Forw-BspHI, 5′-TTAA TCATGA ACATGCTCGTCGACGGCGAGTGG-3′, and Rev-BamHI, 5′-TATA GGATCC TCACCGACCTGCAGACGA-3′, both based on the published nucleotide sequence (accession gene number: NMAG_RS05605). .. Then, the inserted fragment was digested with BspHI and BamHI (New England BioLabs) from pCR2.1 TOPO vector and inserted into the PciI and BamHI sites of pTA963 expression vector.

    Expressing:

    Article Title: Structural Characterization of the Xi Class Glutathione Transferase From the Haloalkaliphilic Archaeon Natrialba magadii
    Article Snippet: .. Then, the inserted fragment was digested with BspHI and BamHI (New England BioLabs) from pCR2.1 TOPO vector and inserted into the PciI and BamHI sites of pTA963 expression vector. .. Restriction products were visualized on a 0.8% agarose gel containing ethidium bromide (0.5 μg/mL).

    Modification:

    Article Title: Cleavage of a model DNA replication fork by a methyl-specific endonuclease
    Article Snippet: To eliminate potential unmethylated plasmid molecules, the plasmid preparations were treated with BstUI (New England Biolabs), which recognizes the same sequence as M.FnuDII but cannot cleave DNAs modified by M.FnuDII [see (i), (ii) below]. .. The 5′-ends of intermediate (iv) were labeled with [γ-32 P]ATP (Perkin Elmer) and T4 polynucleotide kinase (TaKaRa) (v), followed by cleavage with BspHI (New England Biolabs) and recovery of the left half for removal of one of the end labels (vii).

    Article Title: Transplantation of Gene-Edited Hepatocyte-like Cells Modestly Improves Survival of Arginase-1-Deficient Mice
    Article Snippet: .. The PCR products were also assessed for gene modification by BspHI (NEB, Ipswich, MA) digestion, which gave rise to 183 and 169 bp fragments. .. To confirm TALEN-mediated gene modification, PCR amplicons were subcloned into pCR 2.1-TOPO TA vector (Invitrogen, Carlsbad, CA) and individual colonies were subjected to sequence analysis.

    Transformation Assay:

    Article Title: Role of pleiotropy during adaptation of TEM-1 β-lactamase to two novel antibiotics
    Article Snippet: The cycling program consisted of the following: denaturation at 95°C for 2 min, 30 cycles of denaturation (30 s at 95°C), annealing (30 s at 60°C), and extension (75 s at 72°C), followed by a final step at 72°C for 10 min. Amplicons were digested with BspHI and SacI restriction enzymes, followed by DpnI (to remove template), ligated into pACSE3 using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), and electroporated into DH5α E. Cells were allowed to recover in SOC medium (20 g tryptone and 5 g yeast extract/liter supplied with 10 mm NaCl, 2.5 mm KCl, 10 mm MgSO4 , 10 mm MgCl2 , and 20 mm glucose) at 37°C for 60 min. .. Library size was determined by spreading aliquots from each transformation mixture onto LB agar plates (LB containing 15 g agar/liter) supplemented with tetracycline.

    other:

    Article Title: Fabrication of circular assemblies with DNA tetrahedrons: from static structures to a dynamic rotary motor
    Article Snippet: Tris(hydroxymethyl)aminomethane hydrochloride (Tris) was purchased from Bio-Rad (Singapore); MgCl2 were from Quality Reagent Chemical (Singapore); EDTA were from USB biochemical (USA); agarose was purchased from Bio-Rad (Singapore); 100bp DNA ladder was from Thermo Fisher (Singapore); Endonuclease MspI and BspHI were purchased from New England Biolabs (Singapore).

    DNA Sequencing:

    Article Title: Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence
    Article Snippet: Bst DNA Polymerase large fragment exo-, pUC19 DNA, BsaI, NcoI and BspHI, T4 DNA ligase REase were from New England Biolabs (Ipswich, MA, USA). .. Oligo and custom DNA sequencing were provided by Genomed (Warsaw, Poland).

    Polymerase Chain Reaction:

    Article Title: TNFα G308A polymorphism is associated with resilience to sleep deprivation-induced psychomotor vigilance performance impairment in healthy young adults
    Article Snippet: Samples identified as A/G or A/A were subjected to a reverse (control) assay , involving amplification with 20 µM forward primer 5’ – GAG GCA ATA GGT TTT GAG GGT CAT – 3’ and the above-mentioned reverse primer, using the PCR procedures described above with an annealing temperature of 57°C. .. Amplified products were digested with another restriction enzyme, BspHI (New England Biolabs, Inc., Ipwsich, MA), which recognized a restriction site on the A allele.

    Article Title: Foamy virus-mediated gene transfer to canine repopulating cells
    Article Snippet: Msp I or both Bsp HI and Pci I restriction enzymes (NEB, Beverly, MA) were used to digest DNA after creating double-stranded DNA. .. PCR products were visualized on Spreadex gels (Elcrom Scientific, Cham, Switzerland).

    Article Title: Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence
    Article Snippet: Difco media components were obtained from Becton-Dickinson (Franklin Lakes, NJ, USA), agarose GTG from FMC (Rockland, MA, USA), and the DNA purification kits, T4 DNA polymerase, Tfl DNA Polymerase, Taq DNA Polymerase, OptiTaq, GeneMatrix PCR/DNA Clean-Up Purification Kit and GeneMatrix Agarose-Out DNA Purification Kit were from EURx Ltd. (Gdansk, Poland). .. Bst DNA Polymerase large fragment exo-, pUC19 DNA, BsaI, NcoI and BspHI, T4 DNA ligase REase were from New England Biolabs (Ipswich, MA, USA).

    Article Title: Reduction in corpora lutea number in obese melanocortin-4-receptor-deficient mice
    Article Snippet: .. Genotyping of the littermates was performed by polymerase chain reaction (PCR) followed by Bsp HI (New England Biolabs, Frankfurt, Germany) restriction analysis. .. The following primers and PCR conditions were used: 5'-taccctgttaaacagtacggatac-3' (sense) and 5'-gaacatggaaatgaggcagatca-3' (antisense) creating a Bsp HI-site in MC4R+/+ sequence, conditions: 94°C 3 min; 35 cycles of 94°C 30 sec, 58°C 30 sec and 72°C 1 min. Products were digested with Bsp HI and fragments were separated in a 3% agarose gel.

    Article Title: Role of pleiotropy during adaptation of TEM-1 β-lactamase to two novel antibiotics
    Article Snippet: The primers P3 (TCATCCGGCTCGTATAATGTGTGGA) and P4 (ACTCTCTTCCGGGCGCTATCAT) flank the multiple cloning site of pACSE3 and were used for PCR amplification with pACTEM1 as a template. .. The cycling program consisted of the following: denaturation at 95°C for 2 min, 30 cycles of denaturation (30 s at 95°C), annealing (30 s at 60°C), and extension (75 s at 72°C), followed by a final step at 72°C for 10 min. Amplicons were digested with BspHI and SacI restriction enzymes, followed by DpnI (to remove template), ligated into pACSE3 using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), and electroporated into DH5α E. Cells were allowed to recover in SOC medium (20 g tryptone and 5 g yeast extract/liter supplied with 10 mm NaCl, 2.5 mm KCl, 10 mm MgSO4 , 10 mm MgCl2 , and 20 mm glucose) at 37°C for 60 min.

    Article Title: Structural Characterization of the Xi Class Glutathione Transferase From the Haloalkaliphilic Archaeon Natrialba magadii
    Article Snippet: Successful amplification was confirmed by agarose gel electrophoresis and the PCR product was first subcloned into pCR2.1-TOPO vector (TOPO TA Cloning Kit, Thermo Fisher Scientific) according to the manufacturer’s protocol and further sequencing to confirm a correct amplification. .. Then, the inserted fragment was digested with BspHI and BamHI (New England BioLabs) from pCR2.1 TOPO vector and inserted into the PciI and BamHI sites of pTA963 expression vector.

    Article Title: Transplantation of Gene-Edited Hepatocyte-like Cells Modestly Improves Survival of Arginase-1-Deficient Mice
    Article Snippet: .. The PCR products were also assessed for gene modification by BspHI (NEB, Ipswich, MA) digestion, which gave rise to 183 and 169 bp fragments. .. To confirm TALEN-mediated gene modification, PCR amplicons were subcloned into pCR 2.1-TOPO TA vector (Invitrogen, Carlsbad, CA) and individual colonies were subjected to sequence analysis.

    Recombinant:

    Article Title: Evolution of a transposon in Daphnia hybrid genomes
    Article Snippet: We used NebCutter v2.0 ( http://tools.neb.com/NEBcutter2/ ) on each of the 53 sequences to choose enzymes that would highlight different pure and recombinant Pokey alleles. .. The restriction enzymes Dra I, Bsp HI and Bst EII (New England BioLabs Inc., Ipswich, MA, USA) were used in a two-step protocol.

    Transmission Electron Microscopy:

    Article Title: Role of pleiotropy during adaptation of TEM-1 β-lactamase to two novel antibiotics
    Article Snippet: Mutagenesis We introduced random mutations into TEM-1 using the GeneMorph II random mutagenesis kit (Stratagene). .. The cycling program consisted of the following: denaturation at 95°C for 2 min, 30 cycles of denaturation (30 s at 95°C), annealing (30 s at 60°C), and extension (75 s at 72°C), followed by a final step at 72°C for 10 min. Amplicons were digested with BspHI and SacI restriction enzymes, followed by DpnI (to remove template), ligated into pACSE3 using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), and electroporated into DH5α E. Cells were allowed to recover in SOC medium (20 g tryptone and 5 g yeast extract/liter supplied with 10 mm NaCl, 2.5 mm KCl, 10 mm MgSO4 , 10 mm MgCl2 , and 20 mm glucose) at 37°C for 60 min.

    In Vivo:

    Article Title: Cleavage of a model DNA replication fork by a methyl-specific endonuclease
    Article Snippet: The two starting plasmids, pME63 and pMap63, were methylated in vivo by propagating in bacterial cells (DH5alpha_Mcr) carrying a plasmid (pKI2) producing M.FnuDII. .. The 5′-ends of intermediate (iv) were labeled with [γ-32 P]ATP (Perkin Elmer) and T4 polynucleotide kinase (TaKaRa) (v), followed by cleavage with BspHI (New England Biolabs) and recovery of the left half for removal of one of the end labels (vii).

    Methylation:

    Article Title: Cleavage of a model DNA replication fork by a methyl-specific endonuclease
    Article Snippet: The two starting plasmids, pME63 and pMap63, were methylated in vivo by propagating in bacterial cells (DH5alpha_Mcr) carrying a plasmid (pKI2) producing M.FnuDII. .. The 5′-ends of intermediate (iv) were labeled with [γ-32 P]ATP (Perkin Elmer) and T4 polynucleotide kinase (TaKaRa) (v), followed by cleavage with BspHI (New England Biolabs) and recovery of the left half for removal of one of the end labels (vii).

    Mutagenesis:

    Article Title: Role of pleiotropy during adaptation of TEM-1 β-lactamase to two novel antibiotics
    Article Snippet: Paragraph title: Mutagenesis ... The cycling program consisted of the following: denaturation at 95°C for 2 min, 30 cycles of denaturation (30 s at 95°C), annealing (30 s at 60°C), and extension (75 s at 72°C), followed by a final step at 72°C for 10 min. Amplicons were digested with BspHI and SacI restriction enzymes, followed by DpnI (to remove template), ligated into pACSE3 using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), and electroporated into DH5α E. Cells were allowed to recover in SOC medium (20 g tryptone and 5 g yeast extract/liter supplied with 10 mm NaCl, 2.5 mm KCl, 10 mm MgSO4 , 10 mm MgCl2 , and 20 mm glucose) at 37°C for 60 min.

    Isolation:

    Article Title: Foamy virus-mediated gene transfer to canine repopulating cells
    Article Snippet: Integration site analysis by linear amplification-mediated–polymerase chain reaction (LAM-PCR) was performed on canine DNA isolated from peripheral blood leukocytes. .. Msp I or both Bsp HI and Pci I restriction enzymes (NEB, Beverly, MA) were used to digest DNA after creating double-stranded DNA.

    Size-exclusion Chromatography:

    Article Title: Reduction in corpora lutea number in obese melanocortin-4-receptor-deficient mice
    Article Snippet: Genotyping of the littermates was performed by polymerase chain reaction (PCR) followed by Bsp HI (New England Biolabs, Frankfurt, Germany) restriction analysis. .. The following primers and PCR conditions were used: 5'-taccctgttaaacagtacggatac-3' (sense) and 5'-gaacatggaaatgaggcagatca-3' (antisense) creating a Bsp HI-site in MC4R+/+ sequence, conditions: 94°C 3 min; 35 cycles of 94°C 30 sec, 58°C 30 sec and 72°C 1 min. Products were digested with Bsp HI and fragments were separated in a 3% agarose gel.

    Labeling:

    Article Title: Cleavage of a model DNA replication fork by a methyl-specific endonuclease
    Article Snippet: .. The 5′-ends of intermediate (iv) were labeled with [γ-32 P]ATP (Perkin Elmer) and T4 polynucleotide kinase (TaKaRa) (v), followed by cleavage with BspHI (New England Biolabs) and recovery of the left half for removal of one of the end labels (vii). ..

    Mouse Assay:

    Article Title: Reduction in corpora lutea number in obese melanocortin-4-receptor-deficient mice
    Article Snippet: The initial I194F C3HeB/FeJ (C3H) mouse strain [ ] was crossed into the C57Bl6J (B6) background to reduce the C3H genetic influence on the number of offspring and estrous cyclicity, as C3H mice are more susceptible to irregular cyclicity than B6 mice [ ]. .. Genotyping of the littermates was performed by polymerase chain reaction (PCR) followed by Bsp HI (New England Biolabs, Frankfurt, Germany) restriction analysis.

    Sequencing:

    Article Title: Reduction in corpora lutea number in obese melanocortin-4-receptor-deficient mice
    Article Snippet: Genotyping of the littermates was performed by polymerase chain reaction (PCR) followed by Bsp HI (New England Biolabs, Frankfurt, Germany) restriction analysis. .. The following primers and PCR conditions were used: 5'-taccctgttaaacagtacggatac-3' (sense) and 5'-gaacatggaaatgaggcagatca-3' (antisense) creating a Bsp HI-site in MC4R+/+ sequence, conditions: 94°C 3 min; 35 cycles of 94°C 30 sec, 58°C 30 sec and 72°C 1 min. Products were digested with Bsp HI and fragments were separated in a 3% agarose gel.

    Article Title: Cleavage of a model DNA replication fork by a methyl-specific endonuclease
    Article Snippet: To eliminate potential unmethylated plasmid molecules, the plasmid preparations were treated with BstUI (New England Biolabs), which recognizes the same sequence as M.FnuDII but cannot cleave DNAs modified by M.FnuDII [see (i), (ii) below]. .. The 5′-ends of intermediate (iv) were labeled with [γ-32 P]ATP (Perkin Elmer) and T4 polynucleotide kinase (TaKaRa) (v), followed by cleavage with BspHI (New England Biolabs) and recovery of the left half for removal of one of the end labels (vii).

    Article Title: Structural Characterization of the Xi Class Glutathione Transferase From the Haloalkaliphilic Archaeon Natrialba magadii
    Article Snippet: Successful amplification was confirmed by agarose gel electrophoresis and the PCR product was first subcloned into pCR2.1-TOPO vector (TOPO TA Cloning Kit, Thermo Fisher Scientific) according to the manufacturer’s protocol and further sequencing to confirm a correct amplification. .. Then, the inserted fragment was digested with BspHI and BamHI (New England BioLabs) from pCR2.1 TOPO vector and inserted into the PciI and BamHI sites of pTA963 expression vector.

    Article Title: Transplantation of Gene-Edited Hepatocyte-like Cells Modestly Improves Survival of Arginase-1-Deficient Mice
    Article Snippet: The PCR products were also assessed for gene modification by BspHI (NEB, Ipswich, MA) digestion, which gave rise to 183 and 169 bp fragments. .. To confirm TALEN-mediated gene modification, PCR amplicons were subcloned into pCR 2.1-TOPO TA vector (Invitrogen, Carlsbad, CA) and individual colonies were subjected to sequence analysis.

    Staining:

    Article Title: TNFα G308A polymorphism is associated with resilience to sleep deprivation-induced psychomotor vigilance performance impairment in healthy young adults
    Article Snippet: The final digested products were electrophoresed on a 3% agarose gel stained with ethidium bromide and visualized under UV light to determine genotypes: G/G, A/G or A/A. .. Amplified products were digested with another restriction enzyme, BspHI (New England Biolabs, Inc., Ipwsich, MA), which recognized a restriction site on the A allele.

    Nested PCR:

    Article Title: Foamy virus-mediated gene transfer to canine repopulating cells
    Article Snippet: Msp I or both Bsp HI and Pci I restriction enzymes (NEB, Beverly, MA) were used to digest DNA after creating double-stranded DNA. .. Two additional rounds of nested PCRs with 25 pmol LTR-specific primers f3LTR2 (5′-ACC GAC TTG ATT CGA GAA CC-3′) and f3LTR3 5′-GCT AAG GGA GAC ATC TAG TG-3′) amplified the virus long terminal repeat (LTR) and genomic flanking regions using 4% of the first nested PCR as template for the second round.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: TNFα G308A polymorphism is associated with resilience to sleep deprivation-induced psychomotor vigilance performance impairment in healthy young adults
    Article Snippet: Samples identified as A/G or A/A were subjected to a reverse (control) assay , involving amplification with 20 µM forward primer 5’ – GAG GCA ATA GGT TTT GAG GGT CAT – 3’ and the above-mentioned reverse primer, using the PCR procedures described above with an annealing temperature of 57°C. .. Amplified products were digested with another restriction enzyme, BspHI (New England Biolabs, Inc., Ipwsich, MA), which recognized a restriction site on the A allele.

    Purification:

    Article Title: Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence
    Article Snippet: Difco media components were obtained from Becton-Dickinson (Franklin Lakes, NJ, USA), agarose GTG from FMC (Rockland, MA, USA), and the DNA purification kits, T4 DNA polymerase, Tfl DNA Polymerase, Taq DNA Polymerase, OptiTaq, GeneMatrix PCR/DNA Clean-Up Purification Kit and GeneMatrix Agarose-Out DNA Purification Kit were from EURx Ltd. (Gdansk, Poland). .. Bst DNA Polymerase large fragment exo-, pUC19 DNA, BsaI, NcoI and BspHI, T4 DNA ligase REase were from New England Biolabs (Ipswich, MA, USA).

    Article Title: Meiotic association between Spo11 regulated by Rec102, Rec104 and Rec114
    Article Snippet: .. At the GAL2 locus, the purified genomic DNA was treated with AccI, BspHI, HhaI and Nt.AlwI (New England BioLabs) for several hours. .. Nt.AlwI was used as a positive control for SSB detection.

    Article Title: Transplantation of Gene-Edited Hepatocyte-like Cells Modestly Improves Survival of Arginase-1-Deficient Mice
    Article Snippet: Purified PCR products were subjected to a re-annealing process using a step gradient (95°C–25°C over 30 min) to enable heteroduplex formation. .. The PCR products were also assessed for gene modification by BspHI (NEB, Ipswich, MA) digestion, which gave rise to 183 and 169 bp fragments.

    Plasmid Preparation:

    Article Title: Foamy virus-mediated gene transfer to canine repopulating cells
    Article Snippet: Briefly, 0.25 pmol vector-specific 5′-biotinylated primer f3LTR1 (5′-GT GAT TGC AAT GCT TTG TGC-3′) was used to anneal and extend linear fragments containing the LTR with 5 U ThermalAce DNA polymerase (Invitrogen, Carlsbad, CA). .. Msp I or both Bsp HI and Pci I restriction enzymes (NEB, Beverly, MA) were used to digest DNA after creating double-stranded DNA.

    Article Title: Role of pleiotropy during adaptation of TEM-1 β-lactamase to two novel antibiotics
    Article Snippet: The mutagenesis conditions were tuned to induce ∼2 mutations per amplicon by adding 1130 ng of plasmid template (Salverda et al. ). .. The cycling program consisted of the following: denaturation at 95°C for 2 min, 30 cycles of denaturation (30 s at 95°C), annealing (30 s at 60°C), and extension (75 s at 72°C), followed by a final step at 72°C for 10 min. Amplicons were digested with BspHI and SacI restriction enzymes, followed by DpnI (to remove template), ligated into pACSE3 using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), and electroporated into DH5α E. Cells were allowed to recover in SOC medium (20 g tryptone and 5 g yeast extract/liter supplied with 10 mm NaCl, 2.5 mm KCl, 10 mm MgSO4 , 10 mm MgCl2 , and 20 mm glucose) at 37°C for 60 min.

    Article Title: The three-dimensional crystal structure of the PrpF protein of Shewanella oneidensis complexed with trans-aconitate: Insights into its biological function
    Article Snippet: Paragraph title: Plasmid and strain construction ... Restriction endonucleases NheI and NcoI were purchased from Promega, and BspHI was purchased from New England Biolabs.

    Article Title: Cleavage of a model DNA replication fork by a methyl-specific endonuclease
    Article Snippet: To eliminate potential unmethylated plasmid molecules, the plasmid preparations were treated with BstUI (New England Biolabs), which recognizes the same sequence as M.FnuDII but cannot cleave DNAs modified by M.FnuDII [see (i), (ii) below]. .. The 5′-ends of intermediate (iv) were labeled with [γ-32 P]ATP (Perkin Elmer) and T4 polynucleotide kinase (TaKaRa) (v), followed by cleavage with BspHI (New England Biolabs) and recovery of the left half for removal of one of the end labels (vii).

    Article Title: Structural Characterization of the Xi Class Glutathione Transferase From the Haloalkaliphilic Archaeon Natrialba magadii
    Article Snippet: .. Then, the inserted fragment was digested with BspHI and BamHI (New England BioLabs) from pCR2.1 TOPO vector and inserted into the PciI and BamHI sites of pTA963 expression vector. .. Restriction products were visualized on a 0.8% agarose gel containing ethidium bromide (0.5 μg/mL).

    Article Title: Transplantation of Gene-Edited Hepatocyte-like Cells Modestly Improves Survival of Arginase-1-Deficient Mice
    Article Snippet: The PCR products were also assessed for gene modification by BspHI (NEB, Ipswich, MA) digestion, which gave rise to 183 and 169 bp fragments. .. To confirm TALEN-mediated gene modification, PCR amplicons were subcloned into pCR 2.1-TOPO TA vector (Invitrogen, Carlsbad, CA) and individual colonies were subjected to sequence analysis.

    Software:

    Article Title: Transplantation of Gene-Edited Hepatocyte-like Cells Modestly Improves Survival of Arginase-1-Deficient Mice
    Article Snippet: The indel efficiency was quantified based on the relative band intensities measured using Quantity One Software (Bio-Rad, Mississauga, ON, Canada). .. The PCR products were also assessed for gene modification by BspHI (NEB, Ipswich, MA) digestion, which gave rise to 183 and 169 bp fragments.

    Functional Assay:

    Article Title: Transplantation of Gene-Edited Hepatocyte-like Cells Modestly Improves Survival of Arginase-1-Deficient Mice
    Article Snippet: Paragraph title: Functional Evaluation of TALEN Cutting Efficiency ... The PCR products were also assessed for gene modification by BspHI (NEB, Ipswich, MA) digestion, which gave rise to 183 and 169 bp fragments.

    Agarose Gel Electrophoresis:

    Article Title: TNFα G308A polymorphism is associated with resilience to sleep deprivation-induced psychomotor vigilance performance impairment in healthy young adults
    Article Snippet: The final digested products were electrophoresed on a 3% agarose gel stained with ethidium bromide and visualized under UV light to determine genotypes: G/G, A/G or A/A. .. Amplified products were digested with another restriction enzyme, BspHI (New England Biolabs, Inc., Ipwsich, MA), which recognized a restriction site on the A allele.

    Article Title: Reduction in corpora lutea number in obese melanocortin-4-receptor-deficient mice
    Article Snippet: Genotyping of the littermates was performed by polymerase chain reaction (PCR) followed by Bsp HI (New England Biolabs, Frankfurt, Germany) restriction analysis. .. The following primers and PCR conditions were used: 5'-taccctgttaaacagtacggatac-3' (sense) and 5'-gaacatggaaatgaggcagatca-3' (antisense) creating a Bsp HI-site in MC4R+/+ sequence, conditions: 94°C 3 min; 35 cycles of 94°C 30 sec, 58°C 30 sec and 72°C 1 min. Products were digested with Bsp HI and fragments were separated in a 3% agarose gel.

    Article Title: Structural Characterization of the Xi Class Glutathione Transferase From the Haloalkaliphilic Archaeon Natrialba magadii
    Article Snippet: Successful amplification was confirmed by agarose gel electrophoresis and the PCR product was first subcloned into pCR2.1-TOPO vector (TOPO TA Cloning Kit, Thermo Fisher Scientific) according to the manufacturer’s protocol and further sequencing to confirm a correct amplification. .. Then, the inserted fragment was digested with BspHI and BamHI (New England BioLabs) from pCR2.1 TOPO vector and inserted into the PciI and BamHI sites of pTA963 expression vector.

    Laser Capture Microdissection:

    Article Title: Foamy virus-mediated gene transfer to canine repopulating cells
    Article Snippet: Paragraph title: LAM-PCR ... Msp I or both Bsp HI and Pci I restriction enzymes (NEB, Beverly, MA) were used to digest DNA after creating double-stranded DNA.

    DNA Methylation Assay:

    Article Title: Cleavage of a model DNA replication fork by a methyl-specific endonuclease
    Article Snippet: Paragraph title: Forked DNA with methylation ... The 5′-ends of intermediate (iv) were labeled with [γ-32 P]ATP (Perkin Elmer) and T4 polynucleotide kinase (TaKaRa) (v), followed by cleavage with BspHI (New England Biolabs) and recovery of the left half for removal of one of the end labels (vii).

    DNA Purification:

    Article Title: Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence
    Article Snippet: Difco media components were obtained from Becton-Dickinson (Franklin Lakes, NJ, USA), agarose GTG from FMC (Rockland, MA, USA), and the DNA purification kits, T4 DNA polymerase, Tfl DNA Polymerase, Taq DNA Polymerase, OptiTaq, GeneMatrix PCR/DNA Clean-Up Purification Kit and GeneMatrix Agarose-Out DNA Purification Kit were from EURx Ltd. (Gdansk, Poland). .. Bst DNA Polymerase large fragment exo-, pUC19 DNA, BsaI, NcoI and BspHI, T4 DNA ligase REase were from New England Biolabs (Ipswich, MA, USA).

    Lysis:

    Article Title: Meiotic association between Spo11 regulated by Rec102, Rec104 and Rec114
    Article Snippet: After cells were spheroplasted with Zymolyase-20T (MP Biomedicals, Inc.) in spheroplast buffer (1% 2-mercaptoethanol, 1 M sorbitol, 0.1 M EDTA [pH 8.0]), they were lysed and digested in lysis buffer (50 mM EDTA [pH 8.0], 50 mM Tris [pH 8.0], 0.5% SDS, 200 µg of proteinase K). .. At the GAL2 locus, the purified genomic DNA was treated with AccI, BspHI, HhaI and Nt.AlwI (New England BioLabs) for several hours.

    Gel Extraction:

    Article Title: Structural Characterization of the Xi Class Glutathione Transferase From the Haloalkaliphilic Archaeon Natrialba magadii
    Article Snippet: Then, the inserted fragment was digested with BspHI and BamHI (New England BioLabs) from pCR2.1 TOPO vector and inserted into the PciI and BamHI sites of pTA963 expression vector. .. Appropriate bands were excised and extracted using Qiagen Gel extraction Kit.

    Control Assay:

    Article Title: TNFα G308A polymorphism is associated with resilience to sleep deprivation-induced psychomotor vigilance performance impairment in healthy young adults
    Article Snippet: Samples identified as A/G or A/A were subjected to a reverse (control) assay , involving amplification with 20 µM forward primer 5’ – GAG GCA ATA GGT TTT GAG GGT CAT – 3’ and the above-mentioned reverse primer, using the PCR procedures described above with an annealing temperature of 57°C. .. Amplified products were digested with another restriction enzyme, BspHI (New England Biolabs, Inc., Ipwsich, MA), which recognized a restriction site on the A allele.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs restriction endonuclease bsphi
    Restriction Endonuclease Bsphi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction endonuclease bsphi/product/New England Biolabs
    Average 90 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    restriction endonuclease bsphi - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    Image Search Results