apa li  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    ApaLI
    Description:
    ApaLI 12 500 units
    Catalog Number:
    R0507L
    Price:
    264
    Size:
    12 500 units
    Category:
    Restriction Enzymes
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs apa li
    ApaLI
    ApaLI 12 500 units
    https://www.bioz.com/result/apa li/product/New England Biolabs
    Average 99 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    apa li - by Bioz Stars, 2019-12
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Massive parallel screening of phage libraries for the generation of repertoires of human immunomodulatory monoclonal antibodies
    Article Snippet: Briefly, the VHs and VLs were amplified by CloneAmp HiFi PCR Premix in standard conditions with specific primers and purified with Wizard® SV Gel and PCR Clean-Up System (Promega, A9281) from 1,3% agarose gel. .. In-Fusion HD cloning kit (Clontech Laboratories, 639,692) was used to clone the VHs in Bam HI (R3136) and Bss HII (R0199) all from New England Biolabs, linearized pEU8.2VH vector, and the VLs in Apa LI (R0507) and Avr II (R0174) New England Biolabs, linearized pEU4.2VL vector. .. Stellar Competent Cells (Clontech Laboratories, 636,763) were transformed with the obtained vectors, and the colonies were screened by digestion and sequence analysis.

    Article Title: Hypotonicity Stimulates Potassium Flux through the WNK-SPAK/OSR1 Kinase Cascade and the Ncc69 Sodium-Potassium-2-Chloride Cotransporter in the Drosophila Renal Tubule
    Article Snippet: Paragraph title: wnk Cloning ... The resultant product, as well as pENTR containing segment one, was then digested with ApaLI (New England Biolabs, Ipswich, MA) and ligated together to yield the final full-length wnk cDNA in pENTR.

    Article Title: BAC CLONES GENERATED FROM SHEARED DNA
    Article Snippet: Approximately 12.5 μg pTARBAC6 vector DNA was digested with 10 units of ApaLI (New England Biolabs) in 500 μl reaction mixture [50 mM potassium acetate, 20 mM Tris-acetate (pH7.9), 10 mM magnesium acetate, 1 mM dithiothreitol, 100 μg/ml BSA] at 37°C for 15 min. .. Approximately 12.5 μg pTARBAC6 vector DNA was digested with 10 units of ApaLI (New England Biolabs) in 500 μl reaction mixture [50 mM potassium acetate, 20 mM Tris-acetate (pH7.9), 10 mM magnesium acetate, 1 mM dithiothreitol, 100 μg/ml BSA] at 37°C for 15 min.

    Article Title: Diversity of the Antibody Response to Tetanus Toxoid: Comparison of Hybridoma Library to Phage Display Library
    Article Snippet: Paragraph title: Cloning of Vκ and VH Genes into the pCES Phage Display Vector ... First, 5 µg of Vκ PCR products and 10 µg of vector DNA were digested with 10 U/µg ApaLI and AscI (New England BioLabs) at 37°C overnight.

    Amplification:

    Article Title: Urokinase Gene 3?-UTR T/C Polymorphism Is Associated with Malignancy and ESRD in Idiopathic Membranous Nephropathy
    Article Snippet: PCR amplification was performed in a programmable thermal cycler GeneAmp PCR System 2400 (Perkin Elmer). .. The PCR product of 210-bp was mixed with 2 U ApaL I (New England Biolabs, Beverly, MA) and the reaction buffer, according to the manufacturer's instructions.

    Article Title: Massive parallel screening of phage libraries for the generation of repertoires of human immunomodulatory monoclonal antibodies
    Article Snippet: Briefly, the VHs and VLs were amplified by CloneAmp HiFi PCR Premix in standard conditions with specific primers and purified with Wizard® SV Gel and PCR Clean-Up System (Promega, A9281) from 1,3% agarose gel. .. In-Fusion HD cloning kit (Clontech Laboratories, 639,692) was used to clone the VHs in Bam HI (R3136) and Bss HII (R0199) all from New England Biolabs, linearized pEU8.2VH vector, and the VLs in Apa LI (R0507) and Avr II (R0174) New England Biolabs, linearized pEU4.2VL vector.

    Article Title: Novel synthetic plasmid and Doggybone™ DNA vaccines induce neutralizing antibodies and provide protection from lethal influenza challenge in mice
    Article Snippet: To initiate rolling circle amplification from the denatured template, the reaction was first mixed with reaction buffer (30 mM Tris-HCl pH 7.4, 5 mM (NH4 )2 SO4 , 30 mM KCl, 7.5 mM MgCl2 , 2 mM dithiothreitol) and then 2 mM dNTPs (Bioline) were added together with 4000 units of Phi29 DNA polymerase (Lucigen) and 4 units of thermostable pyrophosphatase (Enzymatics). .. DNA pellets were resuspended in 20 ml NEB buffer 2 and plasmid backbone was removed by incubating the TelN digest mixture with 200U/ml ApaLI (NEB) and 400U/ml ExoIII (Enzymatics) overnight at 37°C. dbDNA™ was partially cleaned from the reaction components by performing a 3% PEG 8000 precipitation (removal of proteins) and 6 % PEG precipitation to pellet dbDNA™ from dNMPs and oligonucleotides.

    Article Title: Risk stratification of adult T‐cell leukemia/lymphoma using immunophenotyping
    Article Snippet: Briefly, genomic DNA is digested with four restriction enzymes, AclI, ApaLI, EcoRI, and PciI, (New England Biolab, UK) that do not cut HTLV‐1, generating DNA fragments with an average size of 1000 bp. .. Digestion is followed by ligation of a linker (with the same overhang sequence) to the digested DNA.

    Article Title: The β-isoform of BCCIP promotes ADP release from the RAD51 presynaptic filament and enhances homologous DNA pairing
    Article Snippet: The amplified product was inserted into the bacterial expression plasmid pET11c (Novagen), and sequenced to ensure no undesired mutations occurred. .. All oligonucleotides were purchased from Integrated DNA Technologies. pBluescript was purified from E. coli using a Giga Kit (Qiagen). ϕX174 (+) virion ssDNA and ϕX174 replicative form I double-stranded DNA (dsDNA) were purchased from New England BioLabs—ϕX174 dsDNA was linearized with ApaLI (New England BioLabs).

    Article Title: Hypotonicity Stimulates Potassium Flux through the WNK-SPAK/OSR1 Kinase Cascade and the Ncc69 Sodium-Potassium-2-Chloride Cotransporter in the Drosophila Renal Tubule
    Article Snippet: The third segment was amplified with primers W13711D and W15754U. .. The resultant product, as well as pENTR containing segment one, was then digested with ApaLI (New England Biolabs, Ipswich, MA) and ligated together to yield the final full-length wnk cDNA in pENTR.

    Stable Transfection:

    Article Title: Genetic Manipulation of Neural Progenitors Derived from Human Embryonic Stem Cells
    Article Snippet: Immediately after pulsing, the cells were transferred to prewarmed NP proliferation medium and plated on polyornithine- and laminin-coated six-well plates. .. For stable transfection of hESC and NP cells by nucleofection, ApaLI (New England Biolabs, Ipswich, MA)–linearized pZsGreen1N1 plasmid (Clontech) was used. .. G418 selection (200 μg/mL) was started 72 h postnucleofection and continued for 2 weeks.

    Construct:

    Article Title: BAC CLONES GENERATED FROM SHEARED DNA
    Article Snippet: The pTARBAC1.3 vector was constructed from the pTARBAC1 vector [ ] by eliminating two ApaLI and one BstXI sites by cross-over PCR [ ]. .. Approximately 12.5 μg pTARBAC6 vector DNA was digested with 10 units of ApaLI (New England Biolabs) in 500 μl reaction mixture [50 mM potassium acetate, 20 mM Tris-acetate (pH7.9), 10 mM magnesium acetate, 1 mM dithiothreitol, 100 μg/ml BSA] at 37°C for 15 min.

    Article Title: Identification of Bacteriophage N4 Virion RNA Polymerase-Nucleic Acid Interactions in Transcription Complexes
    Article Snippet: Reporter Plasmids to Determine in Vivo Activity of Mini-vRNAP —A fragment flanked by ApaLI- and BamHI restriction sites that includes vRNAP promoter P2 (–19 to +2) followed by the lacZ ′ gene from M13mp18 was inserted into ApaLI and BamHI-digested pACYC177 (New England Biolabs), disrupting the β-lactamase gene. .. The resulting plasmid, pIK1, was used to determine in vivo activity of N4 mini-vRNAP variants.

    DNA Binding Assay:

    Article Title: Entamoeba histolytica Dmc1 Catalyzes Homologous DNA Pairing and Strand Exchange That Is Stimulated by Calcium and Hop2-Mnd1
    Article Snippet: The ϕ X174 replicative form I was digested by Apa LI (New England Biolabs) to generate linearized dsDNA. .. The ϕ X174 replicative form I was digested by Apa LI (New England Biolabs) to generate linearized dsDNA.

    Article Title: Characterization of the recombination activities of the Entamoeba histolytica Rad51 recombinase
    Article Snippet: H3c was annealed to H3 for dsDNA in the DNA binding assay. .. All oligonucleotides indicated as radiolabeled were done so using T4 polynucleotide kinase and [32 P-γ]-ATP as described [ ]. ϕX174 (+) virion ssDNA and ϕX174 replicative form I dsDNA were purchased from New England BioLabs; the ϕX174 replicative form I dsDNA was linearized with Apa LI (New England BioLabs). pBluescript was purified from E. coli using a Plasmid Giga kit (Qiagen).

    Incubation:

    Article Title:
    Article Snippet: The nuclei of the cells were then harvested and suspended in the appropriate restriction enzyme buffer containing 0.3% SDS and incubated at 37 °C for 1 h with gentle shaking. .. SDS was then sequestered from the samples by the addition of 1.8% Triton X-100 (Fisher), and the samples were incubated at 37 °C for 1 h. The samples were digested with BglII and/or ApaLI restriction enzyme (New England Biolabs) at 37 °C for 16 h. Restriction enzymes were inactivated by the addition of 1.6% SDS and further incubation at 65 °C for 20 min. .. Samples were diluted with T4 DNA ligase buffer (New England Biolabs) to achieve ∼3 ng of DNA/μl, and then 200 units of T4 DNA ligase (New England Biolabs) were added and incubated for 4 h at 16 °C.

    Article Title: Alkylation induced cerebellar degeneration dependent on Aag and Parp1 does not occur via previously established cell death mechanisms
    Article Snippet: If Aag-initiated BER repairs Hx, the appropriate U is incorporated and no fluorescence is observed. .. To test for the presence of Hx in our plasmids, 150 ng of the plasmids were incubated with 10 units ApaLI (NEB) in 1X Cutsmart buffer for 1 hour at 37°C, followed by 20 min at 65°C for heat-inactivation. .. Products were run on a 1% agarose gel for visualization.

    Article Title: Novel synthetic plasmid and Doggybone™ DNA vaccines induce neutralizing antibodies and provide protection from lethal influenza challenge in mice
    Article Snippet: Upon mixing, the reaction was incubated at 30°C for 18 h with custom primers (50 μM) and 2 mM dNTPs. .. DNA pellets were resuspended in 20 ml NEB buffer 2 and plasmid backbone was removed by incubating the TelN digest mixture with 200U/ml ApaLI (NEB) and 400U/ml ExoIII (Enzymatics) overnight at 37°C. dbDNA™ was partially cleaned from the reaction components by performing a 3% PEG 8000 precipitation (removal of proteins) and 6 % PEG precipitation to pellet dbDNA™ from dNMPs and oligonucleotides.

    Article Title: Identification of Bacteriophage N4 Virion RNA Polymerase-Nucleic Acid Interactions in Transcription Complexes
    Article Snippet: Reporter Plasmids to Determine in Vivo Activity of Mini-vRNAP —A fragment flanked by ApaLI- and BamHI restriction sites that includes vRNAP promoter P2 (–19 to +2) followed by the lacZ ′ gene from M13mp18 was inserted into ApaLI and BamHI-digested pACYC177 (New England Biolabs), disrupting the β-lactamase gene. .. In Vivo Activity of Mini-vRNAP Variants and Mutant Promoters — E. coli strain DH5α cells carrying pIK1 and a plasmid encoding a mini-vRNAP variant (see below) were grown in Lennox Broth base medium containing 100 μg/ml ampicillin and 50 μl/ml kanamycin (Sigma) until they reached a density of ∼109 cells/ml.

    Article Title: Reconstitution of DNA Strand Exchange Mediated by Rhp51 Recombinase and Two Mediators
    Article Snippet: Briefly, the reactions (10 μl) contained the following components: 10 μM øX174 ssDNA (css), 10 μM ApaLI-linearized øX174 dsDNA (lds) (New England Biolabs), 5 μM Rhp51, 0.5 μM Rad22, 0.5 μM Swi5-Sfr1, 1 μM RPA, 2 mM ATP, and an ATP regeneration system (8 mM creatine phosphate and 8 U/ml creatine kinase) in buffer F (25 mM Tris-OAc [pH 7.5], 1 mM DTT, 5% glycerol, 3 mM Mg(OAc)2 , 100 mM KCl). .. When replacing RPA, SSB was used at 2 μM.

    Activity Assay:

    Article Title: Identification of Bacteriophage N4 Virion RNA Polymerase-Nucleic Acid Interactions in Transcription Complexes
    Article Snippet: Bacteria were grown in Lennox broth base medium containing the required antibiotics. .. Reporter Plasmids to Determine in Vivo Activity of Mini-vRNAP —A fragment flanked by ApaLI- and BamHI restriction sites that includes vRNAP promoter P2 (–19 to +2) followed by the lacZ ′ gene from M13mp18 was inserted into ApaLI and BamHI-digested pACYC177 (New England Biolabs), disrupting the β-lactamase gene. .. The resulting plasmid, pIK1, was used to determine in vivo activity of N4 mini-vRNAP variants.

    Expressing:

    Article Title: Massive parallel screening of phage libraries for the generation of repertoires of human immunomodulatory monoclonal antibodies
    Article Snippet: Antibody production and purification The scFvs of interest were converted into whole IgG4 antibodies by cloning the corresponding VH and VL cDNAs in the pEU vectors 8.2VH and 4.2VL, expressing respectively, the constant antibody heavy and light chains . .. In-Fusion HD cloning kit (Clontech Laboratories, 639,692) was used to clone the VHs in Bam HI (R3136) and Bss HII (R0199) all from New England Biolabs, linearized pEU8.2VH vector, and the VLs in Apa LI (R0507) and Avr II (R0174) New England Biolabs, linearized pEU4.2VL vector.

    Article Title: The β-isoform of BCCIP promotes ADP release from the RAD51 presynaptic filament and enhances homologous DNA pairing
    Article Snippet: The amplified product was inserted into the bacterial expression plasmid pET11c (Novagen), and sequenced to ensure no undesired mutations occurred. .. All oligonucleotides were purchased from Integrated DNA Technologies. pBluescript was purified from E. coli using a Giga Kit (Qiagen). ϕX174 (+) virion ssDNA and ϕX174 replicative form I double-stranded DNA (dsDNA) were purchased from New England BioLabs—ϕX174 dsDNA was linearized with ApaLI (New England BioLabs).

    Transformation Assay:

    Article Title: Promiscuous plasmid replication in thermophiles: Use of a novel hyperthermophilic replicon for genetic manipulation of Clostridium thermocellum at its optimum growth temperature
    Article Snippet: Paragraph title: Verification of plasmid transformation and structural stability ... Selection in E. coli was performed with 50 µg/mL apramycin, and colonies were screened for the presence of the plasmid by performing restriction digests with EcoRI and ApaLI (NEB, Ipswich, MA).

    Recombinase Polymerase Amplification:

    Article Title: Reconstitution of DNA Strand Exchange Mediated by Rhp51 Recombinase and Two Mediators
    Article Snippet: Procedures for the standard reaction protocols were essentially the same as previously described [ ], with the exception of Rad22 addition. .. Briefly, the reactions (10 μl) contained the following components: 10 μM øX174 ssDNA (css), 10 μM ApaLI-linearized øX174 dsDNA (lds) (New England Biolabs), 5 μM Rhp51, 0.5 μM Rad22, 0.5 μM Swi5-Sfr1, 1 μM RPA, 2 mM ATP, and an ATP regeneration system (8 mM creatine phosphate and 8 U/ml creatine kinase) in buffer F (25 mM Tris-OAc [pH 7.5], 1 mM DTT, 5% glycerol, 3 mM Mg(OAc)2 , 100 mM KCl). .. When replacing RPA, SSB was used at 2 μM.

    Transfection:

    Article Title: Massive parallel screening of phage libraries for the generation of repertoires of human immunomodulatory monoclonal antibodies
    Article Snippet: In-Fusion HD cloning kit (Clontech Laboratories, 639,692) was used to clone the VHs in Bam HI (R3136) and Bss HII (R0199) all from New England Biolabs, linearized pEU8.2VH vector, and the VLs in Apa LI (R0507) and Avr II (R0174) New England Biolabs, linearized pEU4.2VL vector. .. Stellar Competent Cells (Clontech Laboratories, 636,763) were transformed with the obtained vectors, and the colonies were screened by digestion and sequence analysis.

    Article Title: Alkylation induced cerebellar degeneration dependent on Aag and Parp1 does not occur via previously established cell death mechanisms
    Article Snippet: To test for the presence of Hx in our plasmids, 150 ng of the plasmids were incubated with 10 units ApaLI (NEB) in 1X Cutsmart buffer for 1 hour at 37°C, followed by 20 min at 65°C for heat-inactivation. .. To test for the presence of Hx in our plasmids, 150 ng of the plasmids were incubated with 10 units ApaLI (NEB) in 1X Cutsmart buffer for 1 hour at 37°C, followed by 20 min at 65°C for heat-inactivation.

    Ligation:

    Article Title: A Rapid and Economic In-House DNA Purification Method Using Glass Syringe Filters
    Article Snippet: Paragraph title: Enzyme Digestion and Ligation ... Bgl II, Afl III, Cla I, and ApaL I (NEB) were used to digest 3 ug of pLL3.7 and pLL-LS at 37°C for one hour in 60 ul using the manufacture's recommended buffer.

    Host-Cell Reactivation:

    Article Title: Alkylation induced cerebellar degeneration dependent on Aag and Parp1 does not occur via previously established cell death mechanisms
    Article Snippet: Paragraph title: Host cell reactivation assay ... To test for the presence of Hx in our plasmids, 150 ng of the plasmids were incubated with 10 units ApaLI (NEB) in 1X Cutsmart buffer for 1 hour at 37°C, followed by 20 min at 65°C for heat-inactivation.

    Polymerase Chain Reaction:

    Article Title: Urokinase Gene 3?-UTR T/C Polymorphism Is Associated with Malignancy and ESRD in Idiopathic Membranous Nephropathy
    Article Snippet: The cycling condition for urokinase gene 3′-UTR T/C polymorphism was set as follows: one cycle at 94°C for 5 minutes, 35 cycles at 94°C for 30 seconds, 58°C for 30 seconds, and 72°C for 40 seconds, and one final cycle of extension at 72°C for 7 minutes. .. The PCR product of 210-bp was mixed with 2 U ApaL I (New England Biolabs, Beverly, MA) and the reaction buffer, according to the manufacturer's instructions. .. The restriction site was designed to be located at the allele of 3′-UTR (T) to form a digestible site.

    Article Title: Massive parallel screening of phage libraries for the generation of repertoires of human immunomodulatory monoclonal antibodies
    Article Snippet: Briefly, the VHs and VLs were amplified by CloneAmp HiFi PCR Premix in standard conditions with specific primers and purified with Wizard® SV Gel and PCR Clean-Up System (Promega, A9281) from 1,3% agarose gel. .. In-Fusion HD cloning kit (Clontech Laboratories, 639,692) was used to clone the VHs in Bam HI (R3136) and Bss HII (R0199) all from New England Biolabs, linearized pEU8.2VH vector, and the VLs in Apa LI (R0507) and Avr II (R0174) New England Biolabs, linearized pEU4.2VL vector.

    Article Title: The β-isoform of BCCIP promotes ADP release from the RAD51 presynaptic filament and enhances homologous DNA pairing
    Article Snippet: A (HIS)6 tag was added to the 3′ end of BCCIPβ via PCR using the forward primer 5′-GGGAATCCCATATGGCGTCCAGGTCTAAGCGGCGTG and reverse primer 5′-CCCATATGGAATTCTTAATGATGATGATGATGATGAGGACCACCGACAGATAGATATTCTTTCAGTTTATCCATG. .. All oligonucleotides were purchased from Integrated DNA Technologies. pBluescript was purified from E. coli using a Giga Kit (Qiagen). ϕX174 (+) virion ssDNA and ϕX174 replicative form I double-stranded DNA (dsDNA) were purchased from New England BioLabs—ϕX174 dsDNA was linearized with ApaLI (New England BioLabs).

    Article Title: Hypotonicity Stimulates Potassium Flux through the WNK-SPAK/OSR1 Kinase Cascade and the Ncc69 Sodium-Potassium-2-Chloride Cotransporter in the Drosophila Renal Tubule
    Article Snippet: PCR was performed with primers W5024D and W6483U, revealing an alternatively spliced exon within the 5′-UTR as well as redefining the splicing events in the 5′-UTR and suggesting a “new” start codon. .. The resultant product, as well as pENTR containing segment one, was then digested with ApaLI (New England Biolabs, Ipswich, MA) and ligated together to yield the final full-length wnk cDNA in pENTR.

    Article Title: BAC CLONES GENERATED FROM SHEARED DNA
    Article Snippet: The pTARBAC1.3 vector was constructed from the pTARBAC1 vector [ ] by eliminating two ApaLI and one BstXI sites by cross-over PCR [ ]. .. Approximately 12.5 μg pTARBAC6 vector DNA was digested with 10 units of ApaLI (New England Biolabs) in 500 μl reaction mixture [50 mM potassium acetate, 20 mM Tris-acetate (pH7.9), 10 mM magnesium acetate, 1 mM dithiothreitol, 100 μg/ml BSA] at 37°C for 15 min.

    Article Title: Bottleneck-mediated quasispecies restriction during spread of an RNA virus from inoculation site to brain
    Article Snippet: The sense primer was end-labeled by using T4 polynucleotide kinase (NEB, Beverly, MA) and was used at a 1:5 ratio with the unlabeled sense primer ( ). .. PCR products were digested with NdeI, ApaLI, and AccI (NEB) at 37°C, ethanol-precipitated, and run on denaturing polyacrylamide gels as described in ref. . .. We thank Peter Sarnow for helpful comments on the manuscript and Shane Crotty and Raul Andino for the provision of PVR mice.

    Article Title: Diversity of the Antibody Response to Tetanus Toxoid: Comparison of Hybridoma Library to Phage Display Library
    Article Snippet: Purified Vκ and VH PCR products were sequentially cloned into the pCES phage display vector, which is designed to express Fabs . .. First, 5 µg of Vκ PCR products and 10 µg of vector DNA were digested with 10 U/µg ApaLI and AscI (New England BioLabs) at 37°C overnight. .. Digestion of pCES with ApaLI and AscI removes the human Cκ insert and allows cloning of the full murine VκCκ PCR product.

    Article Title: Promiscuous plasmid replication in thermophiles: Use of a novel hyperthermophilic replicon for genetic manipulation of Clostridium thermocellum at its optimum growth temperature
    Article Snippet: PCR products were visualized on a 1% agarose gel with an NEB 1 kb Ladder for size verification (NEB, Ipswich, MA). .. Selection in E. coli was performed with 50 µg/mL apramycin, and colonies were screened for the presence of the plasmid by performing restriction digests with EcoRI and ApaLI (NEB, Ipswich, MA).

    Recombinant:

    Article Title: Identification of Bacteriophage N4 Virion RNA Polymerase-Nucleic Acid Interactions in Transcription Complexes
    Article Snippet: E. coli strain BL21 ( F – ompT hsd SB r B– m B– ) was used for the purification of recombinant proteins. .. Reporter Plasmids to Determine in Vivo Activity of Mini-vRNAP —A fragment flanked by ApaLI- and BamHI restriction sites that includes vRNAP promoter P2 (–19 to +2) followed by the lacZ ′ gene from M13mp18 was inserted into ApaLI and BamHI-digested pACYC177 (New England Biolabs), disrupting the β-lactamase gene.

    In Vivo:

    Article Title: Identification of Bacteriophage N4 Virion RNA Polymerase-Nucleic Acid Interactions in Transcription Complexes
    Article Snippet: Bacteria were grown in Lennox broth base medium containing the required antibiotics. .. Reporter Plasmids to Determine in Vivo Activity of Mini-vRNAP —A fragment flanked by ApaLI- and BamHI restriction sites that includes vRNAP promoter P2 (–19 to +2) followed by the lacZ ′ gene from M13mp18 was inserted into ApaLI and BamHI-digested pACYC177 (New England Biolabs), disrupting the β-lactamase gene. .. The resulting plasmid, pIK1, was used to determine in vivo activity of N4 mini-vRNAP variants.

    Fluorescence:

    Article Title: Alkylation induced cerebellar degeneration dependent on Aag and Parp1 does not occur via previously established cell death mechanisms
    Article Snippet: If Aag-initiated BER repairs Hx, the appropriate U is incorporated and no fluorescence is observed. .. To test for the presence of Hx in our plasmids, 150 ng of the plasmids were incubated with 10 units ApaLI (NEB) in 1X Cutsmart buffer for 1 hour at 37°C, followed by 20 min at 65°C for heat-inactivation.

    Methylation:

    Article Title: A case for sliding SeqA tracts at anchored replication forks during Escherichia coli chromosome replication and segregation
    Article Snippet: Unmethylated and fully methylated pGB2 DNA were made similarly, but using pGB2-containing derivatives of strains KO1607 ( dam – ) and MC1061 ( dam + ), respectively. .. Fragments of pGB2 DNA were prepared by digesting the unlabeled plasmid DNA with the restriction enzymes Nde I, Mse I and Apa LI according to the manufacturer’s recommendations (New England Biolabs).

    Mutagenesis:

    Article Title: Alkylation induced cerebellar degeneration dependent on Aag and Parp1 does not occur via previously established cell death mechanisms
    Article Snippet: In the absence of Aag, Hx causes transcriptional mutagenesis and miscodes for a C, leading to the fluorescent variant of the protein. .. To test for the presence of Hx in our plasmids, 150 ng of the plasmids were incubated with 10 units ApaLI (NEB) in 1X Cutsmart buffer for 1 hour at 37°C, followed by 20 min at 65°C for heat-inactivation.

    Article Title: Identification of Bacteriophage N4 Virion RNA Polymerase-Nucleic Acid Interactions in Transcription Complexes
    Article Snippet: Bacterial Strains and Plasmids — E. coli strain DH5α ( supE44 Δ lacU169 (φ80 lacZ Δ M15 ) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 ) was used to determine the in vivo activity of wild-type and mutant mini-vRNAP enzymes. .. Reporter Plasmids to Determine in Vivo Activity of Mini-vRNAP —A fragment flanked by ApaLI- and BamHI restriction sites that includes vRNAP promoter P2 (–19 to +2) followed by the lacZ ′ gene from M13mp18 was inserted into ApaLI and BamHI-digested pACYC177 (New England Biolabs), disrupting the β-lactamase gene.

    Labeling:

    Article Title: A case for sliding SeqA tracts at anchored replication forks during Escherichia coli chromosome replication and segregation
    Article Snippet: Fragments of pGB2 DNA were prepared by digesting the unlabeled plasmid DNA with the restriction enzymes Nde I, Mse I and Apa LI according to the manufacturer’s recommendations (New England Biolabs). .. The resulting DNA fragments were labeled using Klenow fragment and [α-32 P]thymidine triphosphate (3000 Ci/mmol; Amersham Pharmacia Biotech).

    Purification:

    Article Title: Entamoeba histolytica Dmc1 Catalyzes Homologous DNA Pairing and Strand Exchange That Is Stimulated by Calcium and Hop2-Mnd1
    Article Snippet: The ϕ X174 replicative form I was digested by Apa LI (New England Biolabs) to generate linearized dsDNA. .. The ϕ X174 replicative form I was digested by Apa LI (New England Biolabs) to generate linearized dsDNA.

    Article Title: Massive parallel screening of phage libraries for the generation of repertoires of human immunomodulatory monoclonal antibodies
    Article Snippet: Paragraph title: Antibody production and purification ... In-Fusion HD cloning kit (Clontech Laboratories, 639,692) was used to clone the VHs in Bam HI (R3136) and Bss HII (R0199) all from New England Biolabs, linearized pEU8.2VH vector, and the VLs in Apa LI (R0507) and Avr II (R0174) New England Biolabs, linearized pEU4.2VL vector.

    Article Title: Characterization of the recombination activities of the Entamoeba histolytica Rad51 recombinase
    Article Snippet: OL90 (ssDNA) was used in the nuclease protection assay and D-loop assay. .. All oligonucleotides indicated as radiolabeled were done so using T4 polynucleotide kinase and [32 P-γ]-ATP as described [ ]. ϕX174 (+) virion ssDNA and ϕX174 replicative form I dsDNA were purchased from New England BioLabs; the ϕX174 replicative form I dsDNA was linearized with Apa LI (New England BioLabs). pBluescript was purified from E. coli using a Plasmid Giga kit (Qiagen). .. 4,4′-diisothiocyanostilbene-2,2′-disulfonic acid, DIDS was purchased from Sigma-Aldrich. ( E )-2-(2-(pyridin-3-yl)vinyl)quinazolin-4(3H)-one, B02 was purchased from Ryan Scientific Inc. [ ].

    Article Title: A case for sliding SeqA tracts at anchored replication forks during Escherichia coli chromosome replication and segregation
    Article Snippet: The cells were processed and the plasmid DNA was purified exactly as for the unlabeled supercoiled pGB2 DNA. .. Fragments of pGB2 DNA were prepared by digesting the unlabeled plasmid DNA with the restriction enzymes Nde I, Mse I and Apa LI according to the manufacturer’s recommendations (New England Biolabs).

    Article Title:
    Article Snippet: SDS was then sequestered from the samples by the addition of 1.8% Triton X-100 (Fisher), and the samples were incubated at 37 °C for 1 h. The samples were digested with BglII and/or ApaLI restriction enzyme (New England Biolabs) at 37 °C for 16 h. Restriction enzymes were inactivated by the addition of 1.6% SDS and further incubation at 65 °C for 20 min. .. Then samples were incubated with Triton X-100, followed by incubation with Proteinase K (200 μg/ml) at 65 °C for 16 h to reverse the cross-linking.

    Article Title: The β-isoform of BCCIP promotes ADP release from the RAD51 presynaptic filament and enhances homologous DNA pairing
    Article Snippet: The oligonucleotide OL90 (5′-AAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTT) was radiolabeled using T4 polynucleotide kinase and [32P-γ]-ATP as described ( ). .. All oligonucleotides were purchased from Integrated DNA Technologies. pBluescript was purified from E. coli using a Giga Kit (Qiagen). ϕX174 (+) virion ssDNA and ϕX174 replicative form I double-stranded DNA (dsDNA) were purchased from New England BioLabs—ϕX174 dsDNA was linearized with ApaLI (New England BioLabs). .. The BCCIPβ-(HIS)6 pET11c expression plasmid was transformed into the E. coli strain BL21(DE3).

    Article Title: Identification of Bacteriophage N4 Virion RNA Polymerase-Nucleic Acid Interactions in Transcription Complexes
    Article Snippet: E. coli strain BL21 ( F – ompT hsd SB r B– m B– ) was used for the purification of recombinant proteins. .. Reporter Plasmids to Determine in Vivo Activity of Mini-vRNAP —A fragment flanked by ApaLI- and BamHI restriction sites that includes vRNAP promoter P2 (–19 to +2) followed by the lacZ ′ gene from M13mp18 was inserted into ApaLI and BamHI-digested pACYC177 (New England Biolabs), disrupting the β-lactamase gene.

    Article Title: Diversity of the Antibody Response to Tetanus Toxoid: Comparison of Hybridoma Library to Phage Display Library
    Article Snippet: Purified Vκ and VH PCR products were sequentially cloned into the pCES phage display vector, which is designed to express Fabs . .. First, 5 µg of Vκ PCR products and 10 µg of vector DNA were digested with 10 U/µg ApaLI and AscI (New England BioLabs) at 37°C overnight.

    Article Title: Promiscuous plasmid replication in thermophiles: Use of a novel hyperthermophilic replicon for genetic manipulation of Clostridium thermocellum at its optimum growth temperature
    Article Snippet: 2.6 Taq polymerase (Sigma, St. Louis, MO) was used for PCR reactions to confirm presence of the plasmid using total DNA purified from C. thermocellum transformants as template. .. Selection in E. coli was performed with 50 µg/mL apramycin, and colonies were screened for the presence of the plasmid by performing restriction digests with EcoRI and ApaLI (NEB, Ipswich, MA).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Bottleneck-mediated quasispecies restriction during spread of an RNA virus from inoculation site to brain
    Article Snippet: Paragraph title: RT-PCR Digestion Assay. ... PCR products were digested with NdeI, ApaLI, and AccI (NEB) at 37°C, ethanol-precipitated, and run on denaturing polyacrylamide gels as described in ref. .

    Polyacrylamide Gel Electrophoresis:

    Article Title: Entamoeba histolytica Dmc1 Catalyzes Homologous DNA Pairing and Strand Exchange That Is Stimulated by Calcium and Hop2-Mnd1
    Article Snippet: The ϕ X174 replicative form I was digested by Apa LI (New England Biolabs) to generate linearized dsDNA. .. The ϕ X174 replicative form I was digested by Apa LI (New England Biolabs) to generate linearized dsDNA.

    Staining:

    Article Title: Massive parallel screening of phage libraries for the generation of repertoires of human immunomodulatory monoclonal antibodies
    Article Snippet: In-Fusion HD cloning kit (Clontech Laboratories, 639,692) was used to clone the VHs in Bam HI (R3136) and Bss HII (R0199) all from New England Biolabs, linearized pEU8.2VH vector, and the VLs in Apa LI (R0507) and Avr II (R0174) New England Biolabs, linearized pEU4.2VL vector. .. The conditioned media were collected, and the antibodies were purified by using Protein A HP SpinTrap (GE Healthcare Life Sciences, 28–9031–32).

    Nested PCR:

    Article Title:
    Article Snippet: SDS was then sequestered from the samples by the addition of 1.8% Triton X-100 (Fisher), and the samples were incubated at 37 °C for 1 h. The samples were digested with BglII and/or ApaLI restriction enzyme (New England Biolabs) at 37 °C for 16 h. Restriction enzymes were inactivated by the addition of 1.6% SDS and further incubation at 65 °C for 20 min. .. This was followed by the addition of 10 μg of RNase/ml, and the DNA was purified by phenol/chloroform extraction.

    SDS Page:

    Article Title: Massive parallel screening of phage libraries for the generation of repertoires of human immunomodulatory monoclonal antibodies
    Article Snippet: In-Fusion HD cloning kit (Clontech Laboratories, 639,692) was used to clone the VHs in Bam HI (R3136) and Bss HII (R0199) all from New England Biolabs, linearized pEU8.2VH vector, and the VLs in Apa LI (R0507) and Avr II (R0174) New England Biolabs, linearized pEU4.2VL vector. .. The conditioned media were collected, and the antibodies were purified by using Protein A HP SpinTrap (GE Healthcare Life Sciences, 28–9031–32).

    Plasmid Preparation:

    Article Title: Massive parallel screening of phage libraries for the generation of repertoires of human immunomodulatory monoclonal antibodies
    Article Snippet: Briefly, the VHs and VLs were amplified by CloneAmp HiFi PCR Premix in standard conditions with specific primers and purified with Wizard® SV Gel and PCR Clean-Up System (Promega, A9281) from 1,3% agarose gel. .. In-Fusion HD cloning kit (Clontech Laboratories, 639,692) was used to clone the VHs in Bam HI (R3136) and Bss HII (R0199) all from New England Biolabs, linearized pEU8.2VH vector, and the VLs in Apa LI (R0507) and Avr II (R0174) New England Biolabs, linearized pEU4.2VL vector. .. Stellar Competent Cells (Clontech Laboratories, 636,763) were transformed with the obtained vectors, and the colonies were screened by digestion and sequence analysis.

    Article Title: Characterization of the recombination activities of the Entamoeba histolytica Rad51 recombinase
    Article Snippet: OL90 (ssDNA) was used in the nuclease protection assay and D-loop assay. .. All oligonucleotides indicated as radiolabeled were done so using T4 polynucleotide kinase and [32 P-γ]-ATP as described [ ]. ϕX174 (+) virion ssDNA and ϕX174 replicative form I dsDNA were purchased from New England BioLabs; the ϕX174 replicative form I dsDNA was linearized with Apa LI (New England BioLabs). pBluescript was purified from E. coli using a Plasmid Giga kit (Qiagen). .. 4,4′-diisothiocyanostilbene-2,2′-disulfonic acid, DIDS was purchased from Sigma-Aldrich. ( E )-2-(2-(pyridin-3-yl)vinyl)quinazolin-4(3H)-one, B02 was purchased from Ryan Scientific Inc. [ ].

    Article Title: A case for sliding SeqA tracts at anchored replication forks during Escherichia coli chromosome replication and segregation
    Article Snippet: The cells were processed and the plasmid DNA was purified exactly as for the unlabeled supercoiled pGB2 DNA. .. Fragments of pGB2 DNA were prepared by digesting the unlabeled plasmid DNA with the restriction enzymes Nde I, Mse I and Apa LI according to the manufacturer’s recommendations (New England Biolabs). .. The resulting DNA fragments were labeled using Klenow fragment and [α-32 P]thymidine triphosphate (3000 Ci/mmol; Amersham Pharmacia Biotech).

    Article Title: Alkylation induced cerebellar degeneration dependent on Aag and Parp1 does not occur via previously established cell death mechanisms
    Article Snippet: To test for the presence of Hx in our plasmids, 150 ng of the plasmids were incubated with 10 units ApaLI (NEB) in 1X Cutsmart buffer for 1 hour at 37°C, followed by 20 min at 65°C for heat-inactivation. .. To test for the presence of Hx in our plasmids, 150 ng of the plasmids were incubated with 10 units ApaLI (NEB) in 1X Cutsmart buffer for 1 hour at 37°C, followed by 20 min at 65°C for heat-inactivation.

    Article Title: Genetic Manipulation of Neural Progenitors Derived from Human Embryonic Stem Cells
    Article Snippet: Immediately after pulsing, the cells were transferred to prewarmed NP proliferation medium and plated on polyornithine- and laminin-coated six-well plates. .. For stable transfection of hESC and NP cells by nucleofection, ApaLI (New England Biolabs, Ipswich, MA)–linearized pZsGreen1N1 plasmid (Clontech) was used. .. G418 selection (200 μg/mL) was started 72 h postnucleofection and continued for 2 weeks.

    Article Title: Novel synthetic plasmid and Doggybone™ DNA vaccines induce neutralizing antibodies and provide protection from lethal influenza challenge in mice
    Article Snippet: DNA was pelleted by centrifuging at 14,000g for 10 mins. .. DNA pellets were resuspended in 20 ml NEB buffer 2 and plasmid backbone was removed by incubating the TelN digest mixture with 200U/ml ApaLI (NEB) and 400U/ml ExoIII (Enzymatics) overnight at 37°C. dbDNA™ was partially cleaned from the reaction components by performing a 3% PEG 8000 precipitation (removal of proteins) and 6 % PEG precipitation to pellet dbDNA™ from dNMPs and oligonucleotides. .. This was repeated to increase efficiency and the final 6% pellet resuspended in sterile H2 O.

    Article Title: The β-isoform of BCCIP promotes ADP release from the RAD51 presynaptic filament and enhances homologous DNA pairing
    Article Snippet: The amplified product was inserted into the bacterial expression plasmid pET11c (Novagen), and sequenced to ensure no undesired mutations occurred. .. All oligonucleotides were purchased from Integrated DNA Technologies. pBluescript was purified from E. coli using a Giga Kit (Qiagen). ϕX174 (+) virion ssDNA and ϕX174 replicative form I double-stranded DNA (dsDNA) were purchased from New England BioLabs—ϕX174 dsDNA was linearized with ApaLI (New England BioLabs).

    Article Title: BAC CLONES GENERATED FROM SHEARED DNA
    Article Snippet: This resulted in the pTARBAC6 vector ( ). .. Approximately 12.5 μg pTARBAC6 vector DNA was digested with 10 units of ApaLI (New England Biolabs) in 500 μl reaction mixture [50 mM potassium acetate, 20 mM Tris-acetate (pH7.9), 10 mM magnesium acetate, 1 mM dithiothreitol, 100 μg/ml BSA] at 37°C for 15 min. .. Subsequently 3 units of calf intestinal alkaline phosphatase (Roche) was added into the reaction mixture, and the incubation was continued at 37°C for another 1 hr.

    Article Title: Identification of Bacteriophage N4 Virion RNA Polymerase-Nucleic Acid Interactions in Transcription Complexes
    Article Snippet: Reporter Plasmids to Determine in Vivo Activity of Mini-vRNAP —A fragment flanked by ApaLI- and BamHI restriction sites that includes vRNAP promoter P2 (–19 to +2) followed by the lacZ ′ gene from M13mp18 was inserted into ApaLI and BamHI-digested pACYC177 (New England Biolabs), disrupting the β-lactamase gene. .. Additional plasmids with early N4 promoters P1 (pKMK63), P2 (pKMK64), or P3 (pKMK65); four mutant P2 promoters (–10G to T, pKMK66; –11G to T, pKMK67; –12A to T, pKMK68; and +1C to T, pKMK69); and a control lacking the promoter (pKMK62) were constructed.

    Article Title: Diversity of the Antibody Response to Tetanus Toxoid: Comparison of Hybridoma Library to Phage Display Library
    Article Snippet: Purified Vκ and VH PCR products were sequentially cloned into the pCES phage display vector, which is designed to express Fabs . .. First, 5 µg of Vκ PCR products and 10 µg of vector DNA were digested with 10 U/µg ApaLI and AscI (New England BioLabs) at 37°C overnight. .. Digestion of pCES with ApaLI and AscI removes the human Cκ insert and allows cloning of the full murine VκCκ PCR product.

    Article Title: Promiscuous plasmid replication in thermophiles: Use of a novel hyperthermophilic replicon for genetic manipulation of Clostridium thermocellum at its optimum growth temperature
    Article Snippet: To verify structural stability in C. thermocellum, total DNA was electrotransformed into E. coli BL21 with a BioRad Gene Pulser (Biorad, Hercules, CA) using an exponential pulse in a 2mm cuvette (2.5 kV, 25 μF, 200 Ω). .. Selection in E. coli was performed with 50 µg/mL apramycin, and colonies were screened for the presence of the plasmid by performing restriction digests with EcoRI and ApaLI (NEB, Ipswich, MA). .. 2.7 qPCR experiments were carried out with a LightCycler 480 Real-Time PCR instrument (Roche, Basel, Switzerland) with LightCycler 480 SYBR Green I master mix (Roche).

    Software:

    Article Title: Spatial organization of DNA sequences directs the assembly of bacterial chromatin by a nucleoid-associated protein
    Article Snippet: The cleavage reactions of the H-NS nucleoprotein complexes were carried out for 5 min with BamHI-EcoRI and BamHI-HindIII and for 10 min with ApaLI at 37 °C in the same standard New England BioLabs CutSmart buffer. .. The reactions were stopped by the addition of 50 mm EDTA and 0.2% SDS (final concentration).

    Electrophoresis:

    Article Title: Urokinase Gene 3?-UTR T/C Polymorphism Is Associated with Malignancy and ESRD in Idiopathic Membranous Nephropathy
    Article Snippet: The PCR product of 210-bp was mixed with 2 U ApaL I (New England Biolabs, Beverly, MA) and the reaction buffer, according to the manufacturer's instructions. .. The PCR product of 210-bp was mixed with 2 U ApaL I (New England Biolabs, Beverly, MA) and the reaction buffer, according to the manufacturer's instructions.

    Article Title: Risk stratification of adult T‐cell leukemia/lymphoma using immunophenotyping
    Article Snippet: Briefly, genomic DNA is digested with four restriction enzymes, AclI, ApaLI, EcoRI, and PciI, (New England Biolab, UK) that do not cut HTLV‐1, generating DNA fragments with an average size of 1000 bp. .. The sequences flanking the integration sites of the virus are then amplified using two HTLV‐1‐specific primers and two vectorette‐specific primers.

    Article Title: Reconstitution of DNA Strand Exchange Mediated by Rhp51 Recombinase and Two Mediators
    Article Snippet: Briefly, the reactions (10 μl) contained the following components: 10 μM øX174 ssDNA (css), 10 μM ApaLI-linearized øX174 dsDNA (lds) (New England Biolabs), 5 μM Rhp51, 0.5 μM Rad22, 0.5 μM Swi5-Sfr1, 1 μM RPA, 2 mM ATP, and an ATP regeneration system (8 mM creatine phosphate and 8 U/ml creatine kinase) in buffer F (25 mM Tris-OAc [pH 7.5], 1 mM DTT, 5% glycerol, 3 mM Mg(OAc)2 , 100 mM KCl). .. Briefly, the reactions (10 μl) contained the following components: 10 μM øX174 ssDNA (css), 10 μM ApaLI-linearized øX174 dsDNA (lds) (New England Biolabs), 5 μM Rhp51, 0.5 μM Rad22, 0.5 μM Swi5-Sfr1, 1 μM RPA, 2 mM ATP, and an ATP regeneration system (8 mM creatine phosphate and 8 U/ml creatine kinase) in buffer F (25 mM Tris-OAc [pH 7.5], 1 mM DTT, 5% glycerol, 3 mM Mg(OAc)2 , 100 mM KCl).

    Selection:

    Article Title: Promiscuous plasmid replication in thermophiles: Use of a novel hyperthermophilic replicon for genetic manipulation of Clostridium thermocellum at its optimum growth temperature
    Article Snippet: To verify structural stability in C. thermocellum, total DNA was electrotransformed into E. coli BL21 with a BioRad Gene Pulser (Biorad, Hercules, CA) using an exponential pulse in a 2mm cuvette (2.5 kV, 25 μF, 200 Ω). .. Selection in E. coli was performed with 50 µg/mL apramycin, and colonies were screened for the presence of the plasmid by performing restriction digests with EcoRI and ApaLI (NEB, Ipswich, MA). .. 2.7 qPCR experiments were carried out with a LightCycler 480 Real-Time PCR instrument (Roche, Basel, Switzerland) with LightCycler 480 SYBR Green I master mix (Roche).

    Agarose Gel Electrophoresis:

    Article Title: Urokinase Gene 3?-UTR T/C Polymorphism Is Associated with Malignancy and ESRD in Idiopathic Membranous Nephropathy
    Article Snippet: The PCR product of 210-bp was mixed with 2 U ApaL I (New England Biolabs, Beverly, MA) and the reaction buffer, according to the manufacturer's instructions. .. The PCR product of 210-bp was mixed with 2 U ApaL I (New England Biolabs, Beverly, MA) and the reaction buffer, according to the manufacturer's instructions.

    Article Title: Massive parallel screening of phage libraries for the generation of repertoires of human immunomodulatory monoclonal antibodies
    Article Snippet: Briefly, the VHs and VLs were amplified by CloneAmp HiFi PCR Premix in standard conditions with specific primers and purified with Wizard® SV Gel and PCR Clean-Up System (Promega, A9281) from 1,3% agarose gel. .. In-Fusion HD cloning kit (Clontech Laboratories, 639,692) was used to clone the VHs in Bam HI (R3136) and Bss HII (R0199) all from New England Biolabs, linearized pEU8.2VH vector, and the VLs in Apa LI (R0507) and Avr II (R0174) New England Biolabs, linearized pEU4.2VL vector.

    Article Title: Risk stratification of adult T‐cell leukemia/lymphoma using immunophenotyping
    Article Snippet: Briefly, genomic DNA is digested with four restriction enzymes, AclI, ApaLI, EcoRI, and PciI, (New England Biolab, UK) that do not cut HTLV‐1, generating DNA fragments with an average size of 1000 bp. .. The sequences flanking the integration sites of the virus are then amplified using two HTLV‐1‐specific primers and two vectorette‐specific primers.

    Article Title: BAC CLONES GENERATED FROM SHEARED DNA
    Article Snippet: The pTARBAC1.3 vector was digested with BamHI and EcoRI, and separated in a 0.7 % agarose gel. .. Approximately 12.5 μg pTARBAC6 vector DNA was digested with 10 units of ApaLI (New England Biolabs) in 500 μl reaction mixture [50 mM potassium acetate, 20 mM Tris-acetate (pH7.9), 10 mM magnesium acetate, 1 mM dithiothreitol, 100 μg/ml BSA] at 37°C for 15 min.

    Article Title: Promiscuous plasmid replication in thermophiles: Use of a novel hyperthermophilic replicon for genetic manipulation of Clostridium thermocellum at its optimum growth temperature
    Article Snippet: PCR products were visualized on a 1% agarose gel with an NEB 1 kb Ladder for size verification (NEB, Ipswich, MA). .. Selection in E. coli was performed with 50 µg/mL apramycin, and colonies were screened for the presence of the plasmid by performing restriction digests with EcoRI and ApaLI (NEB, Ipswich, MA).

    Article Title: Reconstitution of DNA Strand Exchange Mediated by Rhp51 Recombinase and Two Mediators
    Article Snippet: Briefly, the reactions (10 μl) contained the following components: 10 μM øX174 ssDNA (css), 10 μM ApaLI-linearized øX174 dsDNA (lds) (New England Biolabs), 5 μM Rhp51, 0.5 μM Rad22, 0.5 μM Swi5-Sfr1, 1 μM RPA, 2 mM ATP, and an ATP regeneration system (8 mM creatine phosphate and 8 U/ml creatine kinase) in buffer F (25 mM Tris-OAc [pH 7.5], 1 mM DTT, 5% glycerol, 3 mM Mg(OAc)2 , 100 mM KCl). .. Briefly, the reactions (10 μl) contained the following components: 10 μM øX174 ssDNA (css), 10 μM ApaLI-linearized øX174 dsDNA (lds) (New England Biolabs), 5 μM Rhp51, 0.5 μM Rad22, 0.5 μM Swi5-Sfr1, 1 μM RPA, 2 mM ATP, and an ATP regeneration system (8 mM creatine phosphate and 8 U/ml creatine kinase) in buffer F (25 mM Tris-OAc [pH 7.5], 1 mM DTT, 5% glycerol, 3 mM Mg(OAc)2 , 100 mM KCl).

    Concentration Assay:

    Article Title: Spatial organization of DNA sequences directs the assembly of bacterial chromatin by a nucleoid-associated protein
    Article Snippet: The cleavage reactions of the H-NS nucleoprotein complexes were carried out for 5 min with BamHI-EcoRI and BamHI-HindIII and for 10 min with ApaLI at 37 °C in the same standard New England BioLabs CutSmart buffer. .. H-NS was added in increasing concentrations to DNA constructs and incubated for 6 min at 37 °C before the addition of restriction enzymes.

    BAC Assay:

    Article Title: BAC CLONES GENERATED FROM SHEARED DNA
    Article Snippet: Paragraph title: Construction and preparation of BAC vectors ... Approximately 12.5 μg pTARBAC6 vector DNA was digested with 10 units of ApaLI (New England Biolabs) in 500 μl reaction mixture [50 mM potassium acetate, 20 mM Tris-acetate (pH7.9), 10 mM magnesium acetate, 1 mM dithiothreitol, 100 μg/ml BSA] at 37°C for 15 min.

    Lysis:

    Article Title:
    Article Snippet: Cross-linked cells were washed with ice-cold phosphate-buffered saline and lysed for 1 h with ice-cold lysis buffer containing 10 m m Tris (pH 8.0), 10 m m NaCl, 0.2% Nonidet P-40, and 1 m m dithiothreitol. .. SDS was then sequestered from the samples by the addition of 1.8% Triton X-100 (Fisher), and the samples were incubated at 37 °C for 1 h. The samples were digested with BglII and/or ApaLI restriction enzyme (New England Biolabs) at 37 °C for 16 h. Restriction enzymes were inactivated by the addition of 1.6% SDS and further incubation at 65 °C for 20 min.

    Gel Extraction:

    Article Title: Diversity of the Antibody Response to Tetanus Toxoid: Comparison of Hybridoma Library to Phage Display Library
    Article Snippet: First, 5 µg of Vκ PCR products and 10 µg of vector DNA were digested with 10 U/µg ApaLI and AscI (New England BioLabs) at 37°C overnight. .. The hybridoma sequences do not contain these restriction sites and therefore would not be eliminated during the cloning process.

    Variant Assay:

    Article Title: Alkylation induced cerebellar degeneration dependent on Aag and Parp1 does not occur via previously established cell death mechanisms
    Article Snippet: In the absence of Aag, Hx causes transcriptional mutagenesis and miscodes for a C, leading to the fluorescent variant of the protein. .. To test for the presence of Hx in our plasmids, 150 ng of the plasmids were incubated with 10 units ApaLI (NEB) in 1X Cutsmart buffer for 1 hour at 37°C, followed by 20 min at 65°C for heat-inactivation.

    Article Title: Identification of Bacteriophage N4 Virion RNA Polymerase-Nucleic Acid Interactions in Transcription Complexes
    Article Snippet: Reporter Plasmids to Determine in Vivo Activity of Mini-vRNAP —A fragment flanked by ApaLI- and BamHI restriction sites that includes vRNAP promoter P2 (–19 to +2) followed by the lacZ ′ gene from M13mp18 was inserted into ApaLI and BamHI-digested pACYC177 (New England Biolabs), disrupting the β-lactamase gene. .. Additional plasmids with early N4 promoters P1 (pKMK63), P2 (pKMK64), or P3 (pKMK65); four mutant P2 promoters (–10G to T, pKMK66; –11G to T, pKMK67; –12A to T, pKMK68; and +1C to T, pKMK69); and a control lacking the promoter (pKMK62) were constructed.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars

  • 99
    New England Biolabs apa li
    Apa Li, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/apa li/product/New England Biolabs
    Average 99 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    apa li - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results