avr ii r0174 new england biolabs  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    AvrII
    Description:
    AvrII 500 units
    Catalog Number:
    r0174l
    Price:
    290
    Size:
    500 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs avr ii r0174 new england biolabs
    AvrII
    AvrII 500 units
    https://www.bioz.com/result/avr ii r0174 new england biolabs/product/New England Biolabs
    Average 99 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    avr ii r0174 new england biolabs - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Heterologous Gene Expression from Transmissible Gastroenteritis Virus Replicon Particles
    Article Snippet: Clones were identified by DNA sequencing using an ABI model 377 automated sequencer, and the resulting construct, TGEV pFiGFP2( Pfl MI), was subsequently used in the assembly of recombinant TGEV viral cDNA and as the backbone for the construction of structural gene deletions (Fig. ). .. TGEV pFiGFP2( Pfl MI) was digested with Pfl MI and Avr II or Eco NI, treated with T4 DNA polymerase under conditions in which the 5′→3′ exonuclease activity generated blunt ends (according to the manufacturer’s directions) (New England BioLabs), and religated using T4 DNA ligase.

    Article Title: Successful synthesis of active human coagulation factor VII by co-expression of mammalian gamma-glutamyl carboxylase and modification of vit.K cycle in Drosophila Schneider S2 cells
    Article Snippet: .. These amplicons were subcloned to pMAK86 digested by Avr II and Afe I (NEB Japan) using In-Fusion® HD Cloning Kit (TAKARA BIO) (pMAK132, Fig. f). .. Non-transfected S2 cells (RIKEN BioResource Center, Tsukuba, Japan) were maintained at 27 °C in ExpressFive SFM (Life Technologies Japan, Tokyo, Japan) supplemented with 10% fetal bovine serum (FBS, Life Technologies Japan) and 1 × antibiotic antimycotic solution (Sigma-Aldrich Japan, Tokyo, Japan) (hereafter the medium were referred as FBS-supplemented medium).

    Article Title: Protection conferred by a recombinant Marek's disease virus that expresses the spike protein from infectious bronchitis virus in specific pathogen-free chicken
    Article Snippet: To produce the transfer vector pUP-LTR-EGFP-S1-DOWN containing an EGFP reporter gene, the plasmid pLTR-GFP was digested with Not I (New England BioLabs), and the LTR-EGFP expression cassette was cloned into the Not I-digested, pUP-S1-DOWN plasmid in the same orientation as the S1 gene (Figure a). .. The insertion of both the S1 gene and LTR-EGFP was verified by Avr II and Not I (New England BioLabs) digestion.

    Article Title: Murine Gammaherpesvirus 68 Lacking Thymidine Kinase Shows Severe Attenuation of Lytic Cycle Replication In Vivo but Still Establishes Latency
    Article Snippet: An Eco RI-restricted MHV-68 genomic fragment (genomic coordinates 30798 to 38212) was cloned into pUC8. .. The central portion (33293 to 34300) of the TK open reading frame (ORF) (32879 to 34813) was excised by digestion with Avr II and Pme I, blunting with T4 DNA polymerase (New England Biolabs, Hitchin, United Kingdom), and religation with T4 DNA ligase (New England Biolabs).

    Article Title: A novel approach to the generation of seamless constructs for plant transformation
    Article Snippet: Paragraph title: In-Fusion™ cloning of gfp ... Plasmid mini-preparations of overnight LB cultures (100 mg/L ampicillin) of randomly selected single white colonies were analyzed with REs NotI for pAUrumII-gfp , AvrII for pAUrumIII-gfp and AseI + NcoI for both constructs (all New England Biolabs).

    Amplification:

    Article Title: Successful synthesis of active human coagulation factor VII by co-expression of mammalian gamma-glutamyl carboxylase and modification of vit.K cycle in Drosophila Schneider S2 cells
    Article Snippet: The amplicon was subcloned to pCoPGE digested by Avr II and Not I, pCoVKE digested by Avr II and Not I, and pCoPGKE digested by Avr II and Not I, and then pMAK85 (Fig. c), pMAK86 (Fig. d), and pMAK219 (Fig. e) were generated, respectively. .. These amplicons were subcloned to pMAK86 digested by Avr II and Afe I (NEB Japan) using In-Fusion® HD Cloning Kit (TAKARA BIO) (pMAK132, Fig. f).

    Article Title: Protection conferred by a recombinant Marek's disease virus that expresses the spike protein from infectious bronchitis virus in specific pathogen-free chicken
    Article Snippet: Artificial Avr II and Not I restriction sites (underlined) permitted the direct cloning of a 1641-bp fragment of the resulting amplicon into the pUP/DOWN vector. .. The insertion of both the S1 gene and LTR-EGFP was verified by Avr II and Not I (New England BioLabs) digestion.

    Article Title: Pathogenicity and Immunogenicity of Recombinant Rabies Viruses Expressing the Lagos Bat Virus Matrix and Glycoprotein: Perspectives for a Pan-Lyssavirus Vaccine
    Article Snippet: The amplified PCR product was digested with XmaI and PacI (New England Biolabs, Ipswich, MA, USA) and then ligated to pSPBN previously digested with XmaI and PacI . .. To replace both the M and G genes of SPBN with those of the LBVAFR1999, the KpnI site was introduced upstream of the pSPBN-LBVG M gene start signal, through digestion of another pSPBN (that contains the KpnI site) with AvrII and KpnI (New England Biolabs, Ipswich, MA, USA) ( ).

    Synthesized:

    Article Title: Pathogenicity and Immunogenicity of Recombinant Rabies Viruses Expressing the Lagos Bat Virus Matrix and Glycoprotein: Perspectives for a Pan-Lyssavirus Vaccine
    Article Snippet: To replace both the M and G genes of SPBN with those of the LBVAFR1999, the KpnI site was introduced upstream of the pSPBN-LBVG M gene start signal, through digestion of another pSPBN (that contains the KpnI site) with AvrII and KpnI (New England Biolabs, Ipswich, MA, USA) ( ). .. LBVAFR1999 M gene was synthesized (GenScript, Piscataway, NJ, USA) to contain the KpnI and XmaI restriction enzyme sites.

    Construct:

    Article Title: Heterologous Gene Expression from Transmissible Gastroenteritis Virus Replicon Particles
    Article Snippet: Clones were identified by DNA sequencing using an ABI model 377 automated sequencer, and the resulting construct, TGEV pFiGFP2( Pfl MI), was subsequently used in the assembly of recombinant TGEV viral cDNA and as the backbone for the construction of structural gene deletions (Fig. ). .. TGEV pFiGFP2( Pfl MI) was digested with Pfl MI and Avr II or Eco NI, treated with T4 DNA polymerase under conditions in which the 5′→3′ exonuclease activity generated blunt ends (according to the manufacturer’s directions) (New England BioLabs), and religated using T4 DNA ligase.

    Article Title: A novel approach to the generation of seamless constructs for plant transformation
    Article Snippet: .. Plasmid mini-preparations of overnight LB cultures (100 mg/L ampicillin) of randomly selected single white colonies were analyzed with REs NotI for pAUrumII-gfp , AvrII for pAUrumIII-gfp and AseI + NcoI for both constructs (all New England Biolabs). .. A plasmid midi-preparation of a selected positive clone of each of pAUrumII-gfp and pAUrumIII-gfp was made and correct gene insertion was verified by sequencing at Eurofins MWG Operon, Germany.

    Electrophoresis:

    Article Title: CTAG-Containing Cleavage Site Profiling to Delineate Salmonella into Natural Clusters
    Article Snippet: Reagents and PFGE analyses of genomic DNA I-CeuI, XbaI and AvrII were purchased from New England Biolabs, and proteinase K was from Roche. .. PFGE was done in a CHEF DR II electrophoresis system (BioRad) at 5.6 V/cm with 0.5×TBE buffer as the running buffer.

    Article Title: The Highly Virulent 2006 Norwegian EHEC O103:H25 Outbreak Strain Is Related to the 2011 German O104:H4 Outbreak Strain
    Article Snippet: Pulsed-Field Gel Electrophoresis (PFGE) and plasmid isolation The E. coli isolates associated with the outbreak were analyzed by PFGE as described previously using the restriction enzymes Xba I and Avr II (New England BioLabs). .. DNA for detection of colicin E2 encoding plasmids were isolated by Qiagen plasmid purification kit (Qiagen, Hilden, Germany), and separated by electrophoresis in 2% agarose gels.

    Incubation:

    Article Title: A novel approach to the generation of seamless constructs for plant transformation
    Article Snippet: After the 1 h shaking of the transformed bacteria, a 1:100 dilution was prepared in S.O.C. medium and 100 μL were spread on each of three LB agar plates (100 mg/L ampicillin, 100 mg/L X-gal) before incubation overnight at 37°C. .. Plasmid mini-preparations of overnight LB cultures (100 mg/L ampicillin) of randomly selected single white colonies were analyzed with REs NotI for pAUrumII-gfp , AvrII for pAUrumIII-gfp and AseI + NcoI for both constructs (all New England Biolabs).

    Activity Assay:

    Article Title: Heterologous Gene Expression from Transmissible Gastroenteritis Virus Replicon Particles
    Article Snippet: .. TGEV pFiGFP2( Pfl MI) was digested with Pfl MI and Avr II or Eco NI, treated with T4 DNA polymerase under conditions in which the 5′→3′ exonuclease activity generated blunt ends (according to the manufacturer’s directions) (New England BioLabs), and religated using T4 DNA ligase. ..

    Expressing:

    Article Title: Successful synthesis of active human coagulation factor VII by co-expression of mammalian gamma-glutamyl carboxylase and modification of vit.K cycle in Drosophila Schneider S2 cells
    Article Snippet: An expression unit for human F7 driven by PMT and poly A signal (pA) was taken from MAK80 by a PCR using two primers: MAK80F-LIC; 5′-GGTAATACGG CCTAGG CTGCAAGGCGATTAAGTTGGGTAACGCCAG (The underlined part; Avr II recognition site) and MAK80R-LIC; 5′-GCGCGCCTT GCGGCCGC CGCAGCGAGTCAGTGAGCGAGGAAG (The underlined part; Not I recognition site). .. These amplicons were subcloned to pMAK86 digested by Avr II and Afe I (NEB Japan) using In-Fusion® HD Cloning Kit (TAKARA BIO) (pMAK132, Fig. f).

    Article Title: Protection conferred by a recombinant Marek's disease virus that expresses the spike protein from infectious bronchitis virus in specific pathogen-free chicken
    Article Snippet: To produce the transfer vector pUP-LTR-EGFP-S1-DOWN containing an EGFP reporter gene, the plasmid pLTR-GFP was digested with Not I (New England BioLabs), and the LTR-EGFP expression cassette was cloned into the Not I-digested, pUP-S1-DOWN plasmid in the same orientation as the S1 gene (Figure a). .. The insertion of both the S1 gene and LTR-EGFP was verified by Avr II and Not I (New England BioLabs) digestion.

    Article Title: Murine Gammaherpesvirus 68 Lacking Thymidine Kinase Shows Severe Attenuation of Lytic Cycle Replication In Vivo but Still Establishes Latency
    Article Snippet: Cointegrant resolution was selected by growth in chloramphenicol-5% sucrose at 30°C; under these conditions, the induced expression of SacB is lethal to E. coli . .. The central portion (33293 to 34300) of the TK open reading frame (ORF) (32879 to 34813) was excised by digestion with Avr II and Pme I, blunting with T4 DNA polymerase (New England Biolabs, Hitchin, United Kingdom), and religation with T4 DNA ligase (New England Biolabs).

    Article Title: A Method for Rapid Genetic Integration into Plasmodium falciparum Utilizing Mycobacteriophage Bxb1 Integrase
    Article Snippet: Plasmids: Integrase-expressing plasmid pINT, which contains a Neomycin selectable marker that confers G418 resistance; attP -containing plasmid pLN-ENR-GFP, which harbors a pfenr-gfp expression cassette as well as a bsd (blasticidin S-deaminase) selectable marker that confers resistance to blasticidin hydrochloride. pLN-ENR-GFP can be digested with Afl II and Avr II enzymes (New England Biolabs, Ipswich, MA) to replace the pfenr-gfp fusion with the gene of interest. .. Digestion with Avr II and Bsi WI (New England Biolabs) can also be performed to place the gene of interest in frame with gfp ) under the identifiers and for pLN-ENR-GFP and pINT, respectively.

    Modification:

    Article Title: Murine Gammaherpesvirus 68 Lacking Thymidine Kinase Shows Severe Attenuation of Lytic Cycle Replication In Vivo but Still Establishes Latency
    Article Snippet: The central portion (33293 to 34300) of the TK open reading frame (ORF) (32879 to 34813) was excised by digestion with Avr II and Pme I, blunting with T4 DNA polymerase (New England Biolabs, Hitchin, United Kingdom), and religation with T4 DNA ligase (New England Biolabs). .. This modified genomic fragment was then excised with Eco RI, blunted with T4 DNA polymerase, and subcloned into Sma I-cut pST76K-SR.

    Transformation Assay:

    Article Title: Murine Gammaherpesvirus 68 Lacking Thymidine Kinase Shows Severe Attenuation of Lytic Cycle Replication In Vivo but Still Establishes Latency
    Article Snippet: The central portion (33293 to 34300) of the TK open reading frame (ORF) (32879 to 34813) was excised by digestion with Avr II and Pme I, blunting with T4 DNA polymerase (New England Biolabs, Hitchin, United Kingdom), and religation with T4 DNA ligase (New England Biolabs). .. This plasmid was transformed into E. coli DH10B containing the WT MHV-68 BAC.

    Article Title: A novel approach to the generation of seamless constructs for plant transformation
    Article Snippet: After the 1 h shaking of the transformed bacteria, a 1:100 dilution was prepared in S.O.C. medium and 100 μL were spread on each of three LB agar plates (100 mg/L ampicillin, 100 mg/L X-gal) before incubation overnight at 37°C. .. Plasmid mini-preparations of overnight LB cultures (100 mg/L ampicillin) of randomly selected single white colonies were analyzed with REs NotI for pAUrumII-gfp , AvrII for pAUrumIII-gfp and AseI + NcoI for both constructs (all New England Biolabs).

    Transfection:

    Article Title: A Method for Rapid Genetic Integration into Plasmodium falciparum Utilizing Mycobacteriophage Bxb1 Integrase
    Article Snippet: Paragraph title: 2.2. Parasite Transfection and Selection of Recombinant Lines ... Digestion with Avr II and Bsi WI (New England Biolabs) can also be performed to place the gene of interest in frame with gfp ) under the identifiers and for pLN-ENR-GFP and pINT, respectively.

    Ligation:

    Article Title: Heterologous Gene Expression from Transmissible Gastroenteritis Virus Replicon Particles
    Article Snippet: XI sites, allowing for directional assembly into a full-length replicon cDNA by in vitro ligation ( Serial deletions within the TGEV structural gene region were generated from the unique Pfl MI site at the very 3′ end of the GFP gene and extended for various distances toward the 3′ end of the genome (Fig. ). .. TGEV pFiGFP2( Pfl MI) was digested with Pfl MI and Avr II or Eco NI, treated with T4 DNA polymerase under conditions in which the 5′→3′ exonuclease activity generated blunt ends (according to the manufacturer’s directions) (New England BioLabs), and religated using T4 DNA ligase.

    Cell Culture:

    Article Title: Pathogenicity and Immunogenicity of Recombinant Rabies Viruses Expressing the Lagos Bat Virus Matrix and Glycoprotein: Perspectives for a Pan-Lyssavirus Vaccine
    Article Snippet: Construction of the Recombinant Viruses Total RNA was isolated from LBVAFR1999 cell culture material using TRIzol® reagent (Invitrogen, Carlsbad, CA, USA) according to manufacturer’s instructions. .. To replace both the M and G genes of SPBN with those of the LBVAFR1999, the KpnI site was introduced upstream of the pSPBN-LBVG M gene start signal, through digestion of another pSPBN (that contains the KpnI site) with AvrII and KpnI (New England Biolabs, Ipswich, MA, USA) ( ).

    Generated:

    Article Title: Heterologous Gene Expression from Transmissible Gastroenteritis Virus Replicon Particles
    Article Snippet: .. TGEV pFiGFP2( Pfl MI) was digested with Pfl MI and Avr II or Eco NI, treated with T4 DNA polymerase under conditions in which the 5′→3′ exonuclease activity generated blunt ends (according to the manufacturer’s directions) (New England BioLabs), and religated using T4 DNA ligase. ..

    Article Title: Successful synthesis of active human coagulation factor VII by co-expression of mammalian gamma-glutamyl carboxylase and modification of vit.K cycle in Drosophila Schneider S2 cells
    Article Snippet: The amplicon was subcloned to pCoPGE digested by Avr II and Not I, pCoVKE digested by Avr II and Not I, and pCoPGKE digested by Avr II and Not I, and then pMAK85 (Fig. c), pMAK86 (Fig. d), and pMAK219 (Fig. e) were generated, respectively. .. These amplicons were subcloned to pMAK86 digested by Avr II and Afe I (NEB Japan) using In-Fusion® HD Cloning Kit (TAKARA BIO) (pMAK132, Fig. f).

    other:

    Article Title: Optimization of Pulse-Field Gel Electrophoresis for Subtyping of Klebsiella pneumoniae
    Article Snippet: Because Xba I is cheaper than Avr II (30 times cheaper from New England Biolabs), so we recommend the use of the Xba I as the primary enzyme, and then Avr II used when further differentiation is needed.

    Article Title: Genomic Diversification among Archival Strains of Salmonella enterica Serovar Typhimurium LT7
    Article Snippet: I- Ceu I, Avr II, and Spe I were purchased from New England BioLabs; Xba I and proteinase K were from Boehringer Mannheim.

    DNA Sequencing:

    Article Title: Heterologous Gene Expression from Transmissible Gastroenteritis Virus Replicon Particles
    Article Snippet: Clones were identified by DNA sequencing using an ABI model 377 automated sequencer, and the resulting construct, TGEV pFiGFP2( Pfl MI), was subsequently used in the assembly of recombinant TGEV viral cDNA and as the backbone for the construction of structural gene deletions (Fig. ). .. TGEV pFiGFP2( Pfl MI) was digested with Pfl MI and Avr II or Eco NI, treated with T4 DNA polymerase under conditions in which the 5′→3′ exonuclease activity generated blunt ends (according to the manufacturer’s directions) (New England BioLabs), and religated using T4 DNA ligase.

    Sequencing:

    Article Title: Successful synthesis of active human coagulation factor VII by co-expression of mammalian gamma-glutamyl carboxylase and modification of vit.K cycle in Drosophila Schneider S2 cells
    Article Snippet: In order to replace BiP secretion signal in pMAK86 to native F7 signal, a fragment containing F7 signal sequence was taken from the cDNA clone (MGC:163340, IMAGE:40146499) by PCR using the following primers: MAK132F; 5′- ATG GTCTCCCAGGCCCTCAGGC (The underlined part; the initial codon), and MAK132R; 5′-GGCACCGACAGG AGCGCT TGG (The underlined part; Afe I recognition site). .. These amplicons were subcloned to pMAK86 digested by Avr II and Afe I (NEB Japan) using In-Fusion® HD Cloning Kit (TAKARA BIO) (pMAK132, Fig. f).

    Article Title: Protection conferred by a recombinant Marek's disease virus that expresses the spike protein from infectious bronchitis virus in specific pathogen-free chicken
    Article Snippet: These primers were designed based on the S1 gene sequence of CK/CH/JS/06II. .. The insertion of both the S1 gene and LTR-EGFP was verified by Avr II and Not I (New England BioLabs) digestion.

    Article Title: A novel approach to the generation of seamless constructs for plant transformation
    Article Snippet: Plasmid mini-preparations of overnight LB cultures (100 mg/L ampicillin) of randomly selected single white colonies were analyzed with REs NotI for pAUrumII-gfp , AvrII for pAUrumIII-gfp and AseI + NcoI for both constructs (all New England Biolabs). .. A plasmid midi-preparation of a selected positive clone of each of pAUrumII-gfp and pAUrumIII-gfp was made and correct gene insertion was verified by sequencing at Eurofins MWG Operon, Germany.

    Recombinant:

    Article Title: Heterologous Gene Expression from Transmissible Gastroenteritis Virus Replicon Particles
    Article Snippet: Paragraph title: Recombinant DNA manipulations of TGEV F subclone. ... TGEV pFiGFP2( Pfl MI) was digested with Pfl MI and Avr II or Eco NI, treated with T4 DNA polymerase under conditions in which the 5′→3′ exonuclease activity generated blunt ends (according to the manufacturer’s directions) (New England BioLabs), and religated using T4 DNA ligase.

    Article Title: Pathogenicity and Immunogenicity of Recombinant Rabies Viruses Expressing the Lagos Bat Virus Matrix and Glycoprotein: Perspectives for a Pan-Lyssavirus Vaccine
    Article Snippet: Paragraph title: 2.2. Construction of the Recombinant Viruses ... To replace both the M and G genes of SPBN with those of the LBVAFR1999, the KpnI site was introduced upstream of the pSPBN-LBVG M gene start signal, through digestion of another pSPBN (that contains the KpnI site) with AvrII and KpnI (New England Biolabs, Ipswich, MA, USA) ( ).

    Article Title: A Method for Rapid Genetic Integration into Plasmodium falciparum Utilizing Mycobacteriophage Bxb1 Integrase
    Article Snippet: Paragraph title: 2.2. Parasite Transfection and Selection of Recombinant Lines ... Digestion with Avr II and Bsi WI (New England Biolabs) can also be performed to place the gene of interest in frame with gfp ) under the identifiers and for pLN-ENR-GFP and pINT, respectively.

    Pulsed-Field Gel:

    Article Title: The Highly Virulent 2006 Norwegian EHEC O103:H25 Outbreak Strain Is Related to the 2011 German O104:H4 Outbreak Strain
    Article Snippet: .. Pulsed-Field Gel Electrophoresis (PFGE) and plasmid isolation The E. coli isolates associated with the outbreak were analyzed by PFGE as described previously using the restriction enzymes Xba I and Avr II (New England BioLabs). .. DNA for detection of colicin E2 encoding plasmids were isolated by Qiagen plasmid purification kit (Qiagen, Hilden, Germany), and separated by electrophoresis in 2% agarose gels.

    Article Title: Evidence of Metabolic Switching and Implications for Food Safety from the Phenome(s) of Salmonella enterica Serovar Typhimurium DT104 Cultured at Selected Points across the Pork Production Food Chain
    Article Snippet: .. Pulsed-field gel electrophoresis (PFGE) was performed using the restriction endonucleases XbaI and AvrII (New England BioLabs) by following the CDC PulseNet protocol ( ). .. Salmonella enterica serovar Braenderup H9812 (ATCC BAA-664) was used as the reference strain for the molecular size standard.

    DNA Extraction:

    Article Title: CTAG-Containing Cleavage Site Profiling to Delineate Salmonella into Natural Clusters
    Article Snippet: Reagents and PFGE analyses of genomic DNA I-CeuI, XbaI and AvrII were purchased from New England Biolabs, and proteinase K was from Roche. .. Bacterial genomic DNA isolation, endonuclease cleavage with I-CeuI, XbaI and AvrII, and separation of the cleavage fragments were described previously , , .

    Mutagenesis:

    Article Title: Murine Gammaherpesvirus 68 Lacking Thymidine Kinase Shows Severe Attenuation of Lytic Cycle Replication In Vivo but Still Establishes Latency
    Article Snippet: Paragraph title: Viral mutagenesis. ... The central portion (33293 to 34300) of the TK open reading frame (ORF) (32879 to 34813) was excised by digestion with Avr II and Pme I, blunting with T4 DNA polymerase (New England Biolabs, Hitchin, United Kingdom), and religation with T4 DNA ligase (New England Biolabs).

    Isolation:

    Article Title: Heterologous Gene Expression from Transmissible Gastroenteritis Virus Replicon Particles
    Article Snippet: The mammalian codon-optimized version of the GFP gene was isolated from the noncytopathic Sindbis virus vector pSINrep19/GFP (kindly provided by Charlie Rice, Columbia University) and was inserted with a 5′ 20-nt N gene IS using the Cla I/ Pfl MI cloning site by standard recombinant DNA techniques (Fig. ) ( ). .. TGEV pFiGFP2( Pfl MI) was digested with Pfl MI and Avr II or Eco NI, treated with T4 DNA polymerase under conditions in which the 5′→3′ exonuclease activity generated blunt ends (according to the manufacturer’s directions) (New England BioLabs), and religated using T4 DNA ligase.

    Article Title: The Highly Virulent 2006 Norwegian EHEC O103:H25 Outbreak Strain Is Related to the 2011 German O104:H4 Outbreak Strain
    Article Snippet: .. Pulsed-Field Gel Electrophoresis (PFGE) and plasmid isolation The E. coli isolates associated with the outbreak were analyzed by PFGE as described previously using the restriction enzymes Xba I and Avr II (New England BioLabs). .. DNA for detection of colicin E2 encoding plasmids were isolated by Qiagen plasmid purification kit (Qiagen, Hilden, Germany), and separated by electrophoresis in 2% agarose gels.

    Article Title: Pathogenicity and Immunogenicity of Recombinant Rabies Viruses Expressing the Lagos Bat Virus Matrix and Glycoprotein: Perspectives for a Pan-Lyssavirus Vaccine
    Article Snippet: Construction of the Recombinant Viruses Total RNA was isolated from LBVAFR1999 cell culture material using TRIzol® reagent (Invitrogen, Carlsbad, CA, USA) according to manufacturer’s instructions. .. To replace both the M and G genes of SPBN with those of the LBVAFR1999, the KpnI site was introduced upstream of the pSPBN-LBVG M gene start signal, through digestion of another pSPBN (that contains the KpnI site) with AvrII and KpnI (New England Biolabs, Ipswich, MA, USA) ( ).

    Purification:

    Article Title: The Highly Virulent 2006 Norwegian EHEC O103:H25 Outbreak Strain Is Related to the 2011 German O104:H4 Outbreak Strain
    Article Snippet: Pulsed-Field Gel Electrophoresis (PFGE) and plasmid isolation The E. coli isolates associated with the outbreak were analyzed by PFGE as described previously using the restriction enzymes Xba I and Avr II (New England BioLabs). .. DNA for detection of colicin E2 encoding plasmids were isolated by Qiagen plasmid purification kit (Qiagen, Hilden, Germany), and separated by electrophoresis in 2% agarose gels.

    Polymerase Chain Reaction:

    Article Title: Successful synthesis of active human coagulation factor VII by co-expression of mammalian gamma-glutamyl carboxylase and modification of vit.K cycle in Drosophila Schneider S2 cells
    Article Snippet: For an overlapped and extension PCR, an additional fragment was taken from pMAK80 by a PCR using the following primers: MAK80F-LIC and MAK132OLR; 5′-GGCCTGGGAGACCATATTGAGATCGGATCCCCCCTTTAG. .. These amplicons were subcloned to pMAK86 digested by Avr II and Afe I (NEB Japan) using In-Fusion® HD Cloning Kit (TAKARA BIO) (pMAK132, Fig. f).

    Article Title: Pathogenicity and Immunogenicity of Recombinant Rabies Viruses Expressing the Lagos Bat Virus Matrix and Glycoprotein: Perspectives for a Pan-Lyssavirus Vaccine
    Article Snippet: The amplified PCR product was digested with XmaI and PacI (New England Biolabs, Ipswich, MA, USA) and then ligated to pSPBN previously digested with XmaI and PacI . .. To replace both the M and G genes of SPBN with those of the LBVAFR1999, the KpnI site was introduced upstream of the pSPBN-LBVG M gene start signal, through digestion of another pSPBN (that contains the KpnI site) with AvrII and KpnI (New England Biolabs, Ipswich, MA, USA) ( ).

    Plasmid Preparation:

    Article Title: Heterologous Gene Expression from Transmissible Gastroenteritis Virus Replicon Particles
    Article Snippet: The mammalian codon-optimized version of the GFP gene was isolated from the noncytopathic Sindbis virus vector pSINrep19/GFP (kindly provided by Charlie Rice, Columbia University) and was inserted with a 5′ 20-nt N gene IS using the Cla I/ Pfl MI cloning site by standard recombinant DNA techniques (Fig. ) ( ). .. TGEV pFiGFP2( Pfl MI) was digested with Pfl MI and Avr II or Eco NI, treated with T4 DNA polymerase under conditions in which the 5′→3′ exonuclease activity generated blunt ends (according to the manufacturer’s directions) (New England BioLabs), and religated using T4 DNA ligase.

    Article Title: The Highly Virulent 2006 Norwegian EHEC O103:H25 Outbreak Strain Is Related to the 2011 German O104:H4 Outbreak Strain
    Article Snippet: .. Pulsed-Field Gel Electrophoresis (PFGE) and plasmid isolation The E. coli isolates associated with the outbreak were analyzed by PFGE as described previously using the restriction enzymes Xba I and Avr II (New England BioLabs). .. DNA for detection of colicin E2 encoding plasmids were isolated by Qiagen plasmid purification kit (Qiagen, Hilden, Germany), and separated by electrophoresis in 2% agarose gels.

    Article Title: Protection conferred by a recombinant Marek's disease virus that expresses the spike protein from infectious bronchitis virus in specific pathogen-free chicken
    Article Snippet: Paragraph title: Construction of the transfer vector ... The insertion of both the S1 gene and LTR-EGFP was verified by Avr II and Not I (New England BioLabs) digestion.

    Article Title: Pathogenicity and Immunogenicity of Recombinant Rabies Viruses Expressing the Lagos Bat Virus Matrix and Glycoprotein: Perspectives for a Pan-Lyssavirus Vaccine
    Article Snippet: The resulting plasmid was designated pSPBN-LBVG ( ). .. To replace both the M and G genes of SPBN with those of the LBVAFR1999, the KpnI site was introduced upstream of the pSPBN-LBVG M gene start signal, through digestion of another pSPBN (that contains the KpnI site) with AvrII and KpnI (New England Biolabs, Ipswich, MA, USA) ( ).

    Article Title: Murine Gammaherpesvirus 68 Lacking Thymidine Kinase Shows Severe Attenuation of Lytic Cycle Replication In Vivo but Still Establishes Latency
    Article Snippet: The central portion (33293 to 34300) of the TK open reading frame (ORF) (32879 to 34813) was excised by digestion with Avr II and Pme I, blunting with T4 DNA polymerase (New England Biolabs, Hitchin, United Kingdom), and religation with T4 DNA ligase (New England Biolabs). .. This plasmid was transformed into E. coli DH10B containing the WT MHV-68 BAC.

    Article Title: A novel approach to the generation of seamless constructs for plant transformation
    Article Snippet: .. Plasmid mini-preparations of overnight LB cultures (100 mg/L ampicillin) of randomly selected single white colonies were analyzed with REs NotI for pAUrumII-gfp , AvrII for pAUrumIII-gfp and AseI + NcoI for both constructs (all New England Biolabs). .. A plasmid midi-preparation of a selected positive clone of each of pAUrumII-gfp and pAUrumIII-gfp was made and correct gene insertion was verified by sequencing at Eurofins MWG Operon, Germany.

    Article Title: A Method for Rapid Genetic Integration into Plasmodium falciparum Utilizing Mycobacteriophage Bxb1 Integrase
    Article Snippet: Plasmids: Integrase-expressing plasmid pINT, which contains a Neomycin selectable marker that confers G418 resistance; attP -containing plasmid pLN-ENR-GFP, which harbors a pfenr-gfp expression cassette as well as a bsd (blasticidin S-deaminase) selectable marker that confers resistance to blasticidin hydrochloride. pLN-ENR-GFP can be digested with Afl II and Avr II enzymes (New England Biolabs, Ipswich, MA) to replace the pfenr-gfp fusion with the gene of interest. .. Digestion with Avr II and Bsi WI (New England Biolabs) can also be performed to place the gene of interest in frame with gfp ) under the identifiers and for pLN-ENR-GFP and pINT, respectively.

    Software:

    Article Title: Evidence of Metabolic Switching and Implications for Food Safety from the Phenome(s) of Salmonella enterica Serovar Typhimurium DT104 Cultured at Selected Points across the Pork Production Food Chain
    Article Snippet: Pulsed-field gel electrophoresis (PFGE) was performed using the restriction endonucleases XbaI and AvrII (New England BioLabs) by following the CDC PulseNet protocol ( ). .. Macrorestriction patterns were compared using the BioNumerics fingerprinting software (version 6.5; Applied Math, Austin, TX).

    Selection:

    Article Title: A Method for Rapid Genetic Integration into Plasmodium falciparum Utilizing Mycobacteriophage Bxb1 Integrase
    Article Snippet: Paragraph title: 2.2. Parasite Transfection and Selection of Recombinant Lines ... Digestion with Avr II and Bsi WI (New England Biolabs) can also be performed to place the gene of interest in frame with gfp ) under the identifiers and for pLN-ENR-GFP and pINT, respectively.

    In Vitro:

    Article Title: Heterologous Gene Expression from Transmissible Gastroenteritis Virus Replicon Particles
    Article Snippet: XI sites, allowing for directional assembly into a full-length replicon cDNA by in vitro ligation ( Serial deletions within the TGEV structural gene region were generated from the unique Pfl MI site at the very 3′ end of the GFP gene and extended for various distances toward the 3′ end of the genome (Fig. ). .. TGEV pFiGFP2( Pfl MI) was digested with Pfl MI and Avr II or Eco NI, treated with T4 DNA polymerase under conditions in which the 5′→3′ exonuclease activity generated blunt ends (according to the manufacturer’s directions) (New England BioLabs), and religated using T4 DNA ligase.

    BAC Assay:

    Article Title: Murine Gammaherpesvirus 68 Lacking Thymidine Kinase Shows Severe Attenuation of Lytic Cycle Replication In Vivo but Still Establishes Latency
    Article Snippet: The central portion (33293 to 34300) of the TK open reading frame (ORF) (32879 to 34813) was excised by digestion with Avr II and Pme I, blunting with T4 DNA polymerase (New England Biolabs, Hitchin, United Kingdom), and religation with T4 DNA ligase (New England Biolabs). .. This plasmid was transformed into E. coli DH10B containing the WT MHV-68 BAC.

    Marker:

    Article Title: A Method for Rapid Genetic Integration into Plasmodium falciparum Utilizing Mycobacteriophage Bxb1 Integrase
    Article Snippet: Plasmids: Integrase-expressing plasmid pINT, which contains a Neomycin selectable marker that confers G418 resistance; attP -containing plasmid pLN-ENR-GFP, which harbors a pfenr-gfp expression cassette as well as a bsd (blasticidin S-deaminase) selectable marker that confers resistance to blasticidin hydrochloride. pLN-ENR-GFP can be digested with Afl II and Avr II enzymes (New England Biolabs, Ipswich, MA) to replace the pfenr-gfp fusion with the gene of interest. .. Digestion with Avr II and Bsi WI (New England Biolabs) can also be performed to place the gene of interest in frame with gfp ) under the identifiers and for pLN-ENR-GFP and pINT, respectively.

    Staining:

    Article Title: Evidence of Metabolic Switching and Implications for Food Safety from the Phenome(s) of Salmonella enterica Serovar Typhimurium DT104 Cultured at Selected Points across the Pork Production Food Chain
    Article Snippet: Pulsed-field gel electrophoresis (PFGE) was performed using the restriction endonucleases XbaI and AvrII (New England BioLabs) by following the CDC PulseNet protocol ( ). .. Gels were stained in a 1-μg/ml solution of ethidium bromide and visualized under UV light transillumination with Gel Doc (Bio-Rad, Munich, Germany).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs bss hii
    Bss Hii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bss hii/product/New England Biolabs
    Average 99 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    bss hii - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results