mlui (New England Biolabs)


Name:
MluI
Description:
MluI 5 000 units
Catalog Number:
r0198l
Price:
269
Category:
Restriction Enzymes
Size:
5 000 units
|
Buy from Supplier |
Structured Review

MluI 5 000 units
https://www.bioz.com/result/mlui/product/New England Biolabs
Average 95 stars, based on 1 article reviews
Price from $9.99 to $1999.99
Images
1) Product Images from "vLIP, a Viral Lipase Homologue, Is a Virulence Factor of Marek's Disease Virus"
Article Title: vLIP, a Viral Lipase Homologue, Is a Virulence Factor of Marek's Disease Virus
Journal: Journal of Virology
doi: 10.1128/JVI.79.11.6984-6996.2005

Figure Legend Snippet: Shuttle mutagenesis strategy used to construct vLIP mutant MDVs and revertants in the pRB-1B BAC. A 4.268-kb fragment of the Md5 strain of MDV, containing the vLIP gene and portions of neighboring genes, was cloned into pST76K-SR, a RecA-based shuttle vector. In step 1 (labeled arrow), an in-frame deletion of vLIP amino acids 256 to 426 was incorporated into the pRB-1B BAC by shuttle mutagenesis using a pST76K-SR-based shuttle vector bearing the same deletion (ΔMluI-SpeI), yielding Δ vLIP . In parallel (step 2), an alanine point mutant of the vLIP serine nucleophile position ( vLIP S307A) was incorporated into pRB-1B. As depicted in steps 3 and 4, shuttle mutagenesis was performed on the Δ vLIP BAC to generate C-terminally FLAG tagged vLIP ( vLIP *-rev) and native vLIP ( vLIP -rev) revertants. Relevant features of the DNA fragment used and modified in shuttle mutagenesis procedures are labeled accordingly. A double-headed arrow represents lipase homology in the vLIP ORF, a white X represents the location of the S307A change, a FLAG epitope tag is represented as a labeled asterisk, and the MluI and SpeI sites which were used to remove the lipase homology region of vLIP are labeled accordingly.
Techniques Used: Mutagenesis, Construct, BAC Assay, Clone Assay, Plasmid Preparation, Labeling, Modification, FLAG-tag

Figure Legend Snippet: (a) Location of vLIP relative to other genes in the MDV genome. The vLIP open reading frame is drawn to scale; a bar representing 1 kb is drawn and labeled. The terminal repeat long (TR L ) region, the U L region, and an a-like sequence (double-headed arrow) are also indicated. Several MDV-1-specific ORFs neighboring the vLIP gene are displayed, as are the conserved genes U L 1 to U L 3. The gene organization of the vLIP transcript is shown in more detail below, also drawn to scale. A 500-bp bar is shown, and the TATA box, putatively used to initiate vLIP transcripts, as well as the poly(A) site and poly(A) signal, is labeled. MluI and SpeI restriction sites flanking the lipase homology region, indicated by a double-headed arrow, are also labeled. (b) The vLIP transcript as visualized by Northern blotting. In the left panel, a Northern blot was probed with a single-stranded riboprobe antisense to vLIP mRNA. RNA samples were derived from MSB-1 tumor cells which had been either treated for 24 h in the presence of sodium butyrate to induce virus replication or left untreated, as indicated. PFA was also used where indicated, to show the sensitivity of vLIP transcription to inhibition of DNA replication. To the right, RNA samples used in Northern blotting were separated on denatured agarose gels, stained with ethidium bromide, and imaged to verify that RNA integrity and quantity were comparable across all samples tested. An RNA marker (Ambion) was included to determine molecular weights.
Techniques Used: Labeling, Sequencing, Northern Blot, Derivative Assay, Inhibition, Staining, Marker
2) Product Images from "Diversity of Proteolytic Clostridium botulinum Strains, Determined by a Pulsed-Field Gel Electrophoresis Approach"
Article Title: Diversity of Proteolytic Clostridium botulinum Strains, Determined by a Pulsed-Field Gel Electrophoresis Approach
Journal:
doi: 10.1128/AEM.71.3.1311-1317.2005

Figure Legend Snippet: Digestion patterns of type A (ATCC 3502) and type B (FT 243) proteolytic C. botulinum strains using the rare-cutting restriction enzymes ApaI, AscI, MluI, NruI, PmeI, and RsrII. The pulse time ramp was 1 to 22 s, and the running time was 20 h. The outermost
Techniques Used:
3) Product Images from "Characterization of Genes Encoding for Acquired Bacitracin Resistance in Clostridium perfringens"
Article Title: Characterization of Genes Encoding for Acquired Bacitracin Resistance in Clostridium perfringens
Journal: PLoS ONE
doi: 10.1371/journal.pone.0044449

Figure Legend Snippet: PFGE and hybridization analysis of I-CeuI and MluI double-digested DNA of the bacitracin resistant C. perfringens strain c1261_A. PFGE analysis of C. perfringens strain c1261_A total DNA (A). Southern blot of C. perfringens isolate c1261_A total DNA probed with rrn (B) and with bcrB (C). Sizes (in kilobases) are indicated on the left.
Techniques Used: Hybridization, Southern Blot
4) Product Images from "Rescue of SARS-CoV-2 from a Single Bacterial Artificial Chromosome"
Article Title: Rescue of SARS-CoV-2 from a Single Bacterial Artificial Chromosome
Journal: mBio
doi: 10.1128/mBio.02168-20

Figure Legend Snippet: Characterization of rSARS2-CoV-2 in vitro . (A and B) Genotypic characterization. Vero E6 cells were mock infected or infected (MOI, 0.01) with rSARS-CoV-2 or the SARS-CoV-2 USA-WA1/2020 natural isolate. At 24 h postinfection, total RNA from Vero E6 cells was extracted and a 1,297-bp region of the M gene (nt 26488 to 27784) was amplified by RT-PCR. Amplified DNA was subjected to MluI digestion ( Fig. 1 ). (A) Undigested (top) and digested (bottom) samples were separated in a 0.7% agarose gel. The RT-PCR-amplified DNA product was also sequenced to verify the presence of the silent mutation in the MluI restriction site introduced in the viral genome of the rSARS-CoV-2 ( Fig. 1 ). (B) The MluI restriction site is underlined in red, and the silent mutation introduced to remove the MluI restriction site (T to A) is shown in the black box. (C) Verification of BAC and rSARS-CoV-2 sequences. The SARS-CoV-2 non-reference allele frequency was calculated by comparing short reads to the reference genome of the USA-WA1/2020 reference. All variants were at low frequency in the P6 natural isolate (top), the BAC (bottom), and rSARS-CoV-2 (middle), with the exception of introduced variants at positions 21895 and 26843, which were fixed in the BAC and in rSARS-CoV-2. Non-reference alleles present in less than 1% of reads are not shown. (D) Plaque phenotype. Vero E6 cells were infected with ∼20 PFU of rSARS-CoV-2 (left) or the natural SARS-CoV-2 isolate (right). After 72 h of incubation at 37°C, cells were fixed and immunostained with the N protein 1C7 monoclonal antibody. (E) Growth kinetics. Vero E6 cells were infected (MOI, 0.01) with rSARS-CoV-2 or the natural SARS-CoV-2 isolate. At the indicated times postinfection, tissue culture supernatants were collected and viral titers were assessed by plaque assay (PFU/ml). Data are presented as means ± SDs. LOD, limit of detection.
Techniques Used: In Vitro, Infection, Amplification, Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis, Mutagenesis, BAC Assay, Incubation, Plaque Assay
5) Product Images from "Novel Human Polyomavirus Noncoding Control Regions Differ in Bidirectional Gene Expression according to Host Cell, Large T-Antigen Expression, and Clinically Occurring Rearrangements"
Article Title: Novel Human Polyomavirus Noncoding Control Regions Differ in Bidirectional Gene Expression according to Host Cell, Large T-Antigen Expression, and Clinically Occurring Rearrangements
Journal: Journal of Virology
doi: 10.1128/JVI.02231-17
![... early to late orientation cloned via restriction sites MluI and BssHII; the red fluorescence protein dsRed2, used ... Rearranged BKPyV Dunlop NCCR showed higher EVGR expression than did BKPyVww NCCR in HEK293 cells. (A) Schematic representation of the HPyV genome: noncoding control region (NCCR); early viral gene region (EVGR, in red) encoding large and small T antigens (Tags), alternative spliced Tags; microRNAs (blue arrow); late viral gene region (LVGR) encoding structural proteins (Vp1, Vp2, and Vp3) and the agnoprotein (agno) only in BKPyV and JCPyV. (B) Representation of the bidirectional reporter vector pRG13D12, containing the following: NCCR (in gray) in the early to late orientation cloned via restriction sites MluI and BssHII; the red fluorescence protein dsRed2, used as a marker of EVGR expression; the enhanced green fluorescence protein, EGFP, in the opposite orientation, used as a marker of LVGR expression; SV40 polyadenylation signals [SV40 poly(A)] for the dsRed2 and EGFP expression cassette; E1 ori for bacterial plasmid replication; the ampicillin-resistant gene (Amp) for selecting Escherichia coli transformants. (C) Flow cytometry of HEK293 cells 2 dpt with the pRG13D12 reporter vector alone or containing the NCCR of the archetype BKPyVww, the BKPyV(DUN), or the BKPyV(DUN-R) in the reverse orientation. x axis, EGFP fluorescence; y axis, dsRed2 fluorescence; 10,000 control transfected cells were gated for the live gate, while 5,000 transfected cells were gated for the P3 (Q1, Q2, and Q4) gate. Q1, Q4, and Q2 depict cells expressing red fluorescence, green fluorescence, and both, respectively. Ex, excitation wavelength; Em, emission wavelength. (D) Quantification of cells: red bars, sum of red cells (Q1 + Q2); green bars, sum of green cells (Q2 + Q4); yellow bars, red- and green-fluorescence double-positive cells (Q2); black bars, nonfluorescent cells (Q3, negative). Means with standard deviations (SD) from three independent replicates are shown. (E) Normalized mean fluorescence intensity (MFI). The weighted MFI was calculated for each measurement (see formulas in Materials and Methods); late expression was normalized to BKPyVww NCCR (green MFI was set as 100), while early expression was normalized to BKPyVww NCCR (red MFI was set as 1). Means with SD from three independent replicates are shown.](https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5972868/bin/zjv0071834250002.jpg)
Figure Legend Snippet: Rearranged BKPyV Dunlop NCCR showed higher EVGR expression than did BKPyVww NCCR in HEK293 cells. (A) Schematic representation of the HPyV genome: noncoding control region (NCCR); early viral gene region (EVGR, in red) encoding large and small T antigens (Tags), alternative spliced Tags; microRNAs (blue arrow); late viral gene region (LVGR) encoding structural proteins (Vp1, Vp2, and Vp3) and the agnoprotein (agno) only in BKPyV and JCPyV. (B) Representation of the bidirectional reporter vector pRG13D12, containing the following: NCCR (in gray) in the early to late orientation cloned via restriction sites MluI and BssHII; the red fluorescence protein dsRed2, used as a marker of EVGR expression; the enhanced green fluorescence protein, EGFP, in the opposite orientation, used as a marker of LVGR expression; SV40 polyadenylation signals [SV40 poly(A)] for the dsRed2 and EGFP expression cassette; E1 ori for bacterial plasmid replication; the ampicillin-resistant gene (Amp) for selecting Escherichia coli transformants. (C) Flow cytometry of HEK293 cells 2 dpt with the pRG13D12 reporter vector alone or containing the NCCR of the archetype BKPyVww, the BKPyV(DUN), or the BKPyV(DUN-R) in the reverse orientation. x axis, EGFP fluorescence; y axis, dsRed2 fluorescence; 10,000 control transfected cells were gated for the live gate, while 5,000 transfected cells were gated for the P3 (Q1, Q2, and Q4) gate. Q1, Q4, and Q2 depict cells expressing red fluorescence, green fluorescence, and both, respectively. Ex, excitation wavelength; Em, emission wavelength. (D) Quantification of cells: red bars, sum of red cells (Q1 + Q2); green bars, sum of green cells (Q2 + Q4); yellow bars, red- and green-fluorescence double-positive cells (Q2); black bars, nonfluorescent cells (Q3, negative). Means with standard deviations (SD) from three independent replicates are shown. (E) Normalized mean fluorescence intensity (MFI). The weighted MFI was calculated for each measurement (see formulas in Materials and Methods); late expression was normalized to BKPyVww NCCR (green MFI was set as 100), while early expression was normalized to BKPyVww NCCR (red MFI was set as 1). Means with SD from three independent replicates are shown.
Techniques Used: Expressing, Plasmid Preparation, Clone Assay, Fluorescence, Marker, Flow Cytometry, Cytometry, Transfection
6) Product Images from "A Systematic Analysis on DNA Methylation and the Expression of Both mRNA and microRNA in Bladder Cancer"
Article Title: A Systematic Analysis on DNA Methylation and the Expression of Both mRNA and microRNA in Bladder Cancer
Journal: PLoS ONE
doi: 10.1371/journal.pone.0028223

Figure Legend Snippet: Validation results of BSP for DNA methylation and RT-qPCR for gene expression. A. Validation results of MMSDK with BSP. To compare the BSP-Sanger sequencing data and deep sequencing MMSDK data, the MluI loci that were determined to be differentially methylated on average by deep sequencing were validated using BSP. The height of the columns represents the log2-transformed average fold change (tumor/normal) in methylation level across the 9 patients. B. BSP and RT-qPCR results for four cancer-associated genes examined in 33 bladder cancer patients. The methylation levels of promoters of four selected genes (SLIT2, HIC1, RASRAl1, KRT17) and their expression level were evaluated in a panel of 33 samples. The height of the columns represents the log2 average fold change (tumor/normal) in methylation level (blue) or expression level (red) across all patients. The bars represent the standard error. The number of samples (n) used in the validation assay is indicated beside each standard error bar.
Techniques Used: DNA Methylation Assay, Quantitative RT-PCR, Expressing, Sequencing, Methylation, Transformation Assay
7) Product Images from "Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis"
Article Title: Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis
Journal: Nature protocols
doi: 10.1038/nprot.2010.131

Figure Legend Snippet: Diagrammatic representation of an A-homology (A-box) arm. The example chosen is the gene Chat (encoding choline acetyltransferase). The 5′ primer used in the amplification of the Chat A-box was 5′ GGCGCGCC AAGGTGCTCTAGTGCTCTGATCCCAG 3′. The first eight nucleotides in this sequence do not correspond to the genomic sequence of Chat but represent an added Asc I recognition site sequence 5′-GGCGCGCC-3′. A key step in designing the 5′ primer is the addition of an AscI or MluI enzyme site at the front of the primer. It serves in a later step when the A-homology arm is ligated into an AscI and SwaI-digested pLD53.SC2 vector at its AscI or SwaI cloning sites. If an internal AscI recognition sequence is present within the homology sequence (can be checked with the DNASTAR program), a MluI recognition site, 5′-ACGCGT-3′, should be added to the end of the primer instead. The enzyme MluI is then used in the digestion step. The 3′ primer used for Cha t in the homology amplification step was 5′ CCTAGCGATTCTTAATCCAGAGTAGC 3′. This is the reverse-complement of the 3′ sequence highlighted in the figure.
Techniques Used: Amplification, Sequencing, Plasmid Preparation, Clone Assay
8) Product Images from "A Systematic Analysis on DNA Methylation and the Expression of Both mRNA and microRNA in Bladder Cancer"
Article Title: A Systematic Analysis on DNA Methylation and the Expression of Both mRNA and microRNA in Bladder Cancer
Journal: PLoS ONE
doi: 10.1371/journal.pone.0028223

Figure Legend Snippet: Validation results of BSP for DNA methylation and RT-qPCR for gene expression. A. Validation results of MMSDK with BSP. To compare the BSP-Sanger sequencing data and deep sequencing MMSDK data, the MluI loci that were determined to be differentially methylated on average by deep sequencing were validated using BSP. The height of the columns represents the log2-transformed average fold change (tumor/normal) in methylation level across the 9 patients. B. BSP and RT-qPCR results for four cancer-associated genes examined in 33 bladder cancer patients. The methylation levels of promoters of four selected genes (SLIT2, HIC1, RASRAl1, KRT17) and their expression level were evaluated in a panel of 33 samples. The height of the columns represents the log2 average fold change (tumor/normal) in methylation level (blue) or expression level (red) across all patients. The bars represent the standard error. The number of samples (n) used in the validation assay is indicated beside each standard error bar.
Techniques Used: DNA Methylation Assay, Quantitative RT-PCR, Expressing, Sequencing, Methylation, Transformation Assay
9) Product Images from "The use of an adeno-associated viral vector for efficient bicistronic expression of two genes in the CNS"
Article Title: The use of an adeno-associated viral vector for efficient bicistronic expression of two genes in the CNS
Journal: Methods in molecular biology (Clifton, N.J.)
doi: 10.1007/978-1-4939-0777-9_16

Figure Legend Snippet: (A) psubCMV-2A-WPRE plasmid map showing NheI site for cloning a transgene immediately downstream of the CMV promoter (and upstream of the 2A sequence) and an MluI site for cloning a transgene downstream of the 2A sequence. (B) Nucleotide sequence showing
Techniques Used: Plasmid Preparation, Clone Assay, Sequencing
10) Product Images from "The abundance of Fob1 modulates the efficiency of rRFBs to stall replication forks"
Article Title: The abundance of Fob1 modulates the efficiency of rRFBs to stall replication forks
Journal: Nucleic Acids Research
doi: 10.1093/nar/gkx655

Figure Legend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_MEM_3rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_MEM_3rRFBs+ (8908 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note the insertion of an EcoRI fragment containing the three putative Fob1 binding sites expected to act as RFBs (indicated in red), described by Kobayashi ( 20 ). ( B ) Map of the 3708 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with SwaI and BamHI showing the relative position of the three putative RFBs. ( C ) Map of the 5186 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with EcoRV and MluI showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3708 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5186-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them.
Techniques Used: Two-Dimensional Gel Electrophoresis, Binding Assay, Activated Clotting Time Assay, Generated

Figure Legend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_3′rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_3′rRFBs+ (8175 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the three putative Fob1 binding sites expected to act as RFBs (indicated in red and white), described by Kobayashi ( 20 ), are equally distanced. ( B ) Map of the 3710-bp linear fragment generated by digestion of pYAC_AC_3′rRFBs+ with FspI and BamHI showing the relative position of the three putative RFBs. ( C ) Map of the 4454-bp linear fragment generated by digestion of pYAC_AC_3′rRFBs+ with EcoRV and MluI showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the FspI-BamHI 3710-bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 4454-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them. For comparison, the densitometric profile corresponding to pYAC_MEM_3rRFBs shown in Figure 4H is presented on top.
Techniques Used: Two-Dimensional Gel Electrophoresis, Binding Assay, Activated Clotting Time Assay, Generated

Figure Legend Snippet: Genetic map and 2D gel analysis of linear fragments corresponding to pYAC_MEM. ( A ) Genetic map of pYAC_MEM (7966 bp) showing its most relevant features: clockwise starting with the replication origin ARS4 (indicated in green), URA3 gene active in Saccharomyces cerevisiae (indicated in light blue), L1 lambda DNA used for hybridization (indicated in yellow), HIS3 gene active in S. cerevisiae (indicated in light blue), L2 lambda DNA used for hybridization (indicated in yellow), the ColE1 replication origin active only in Escherichia coli (indicated in gray), the ampicillin resistance gene active only in E. coli (indicated in gray) and the budding yeast centromeric sequence CEN6 (indicated in orange). The sites for specific restriction endonucleases are indicated outside the map. In addition, a magenta triangle points the position located 180° apart from the replication origin ARS4. ( B ) Map of the 2764-bp linear fragment generated by digestion of pYAC_MEM with SwaI and BamHI. ( C ) Map of the 4245-bp linear fragment generated by digestion of pYAC_MEM with EcoRV and MluI. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 2764 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 4245-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). De-localized termination signals are indicated in magenta.
Techniques Used: Two-Dimensional Gel Electrophoresis, Lambda DNA Preparation, Hybridization, Sequencing, Generated

Figure Legend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ isolated from cells that overexpress Fob1 and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the ten putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194 bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in ( D ) is presented in ( H ) indicating the height of the peaks. For comparison, the densitometric profile corresponding to the 3705-bp SwaI-BamHI of pYAC_AC_10rRFBs isolated from the top2-td strain shown in Figure 4H is presented on top.
Techniques Used: Two-Dimensional Gel Electrophoresis, Isolation, Binding Assay, Activated Clotting Time Assay, In Vivo, Generated

Figure Legend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the 10 putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705-bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks.
Techniques Used: Two-Dimensional Gel Electrophoresis, Binding Assay, Activated Clotting Time Assay, In Vivo, Generated
11) Product Images from "Introducing undergraduate students to reverse genetics in the laboratory: a case study of a project-oriented learning (POL) system in Taishan Medical University, China"
Article Title: Introducing undergraduate students to reverse genetics in the laboratory: a case study of a project-oriented learning (POL) system in Taishan Medical University, China
Journal: bioRxiv
doi: 10.1101/2020.05.21.108068

Figure Legend Snippet: The agarose gel electrophoresis of linearized DNA. The pFK-JFHl-WT and pFK-JFHl-B/WT were digested by MluI for 3hrs at 37 °C, then the 5ul digested products were applied to 1%agarose gel for electrophoresis. M represents DNA ladder (Thermofisher 1Kb plus DNA Marker), WT and B/WT represent JFHl-WT and JFHl-B/WT individually.
Techniques Used: Agarose Gel Electrophoresis, Electrophoresis, Marker
12) Product Images from "Rescue of SARS-CoV-2 from a single bacterial artificial chromosome"
Article Title: Rescue of SARS-CoV-2 from a single bacterial artificial chromosome
Journal: bioRxiv
doi: 10.1101/2020.07.22.216358

Figure Legend Snippet: Characterization of rSARS2-CoV-2 in vitro . A-B) Genotypic characterization: Vero E6 cells (6-well plate, 10 6 cells/well, triplicates) were mock-infected or infected (MOI 0.01) with rSARS-CoV-2 or the SARS-CoV-2 USA-WA1/2020 natural isolate. After 1 h viral adsorption at 37°C, Vero E6 cells were washed 3 times with PBS and incubated in post-infection media at 37°C. At 24 h post-infection, total RNA from Vero E6 cells was extracted and a 1,297 bp region of the M gene (nt 26,488 to 27,784) was amplified by RT-PCR. Amplified DNA was subjected to MluI digestion ( Figure 1 ). Undigested (top) and digested (bottom) samples were separated in a 0.7% agarose gel ( A ). The RT-PCR amplified DNA product was also sequenced to verify the presence of the silent mutation in the MluI restriction site introduced in the viral genome of the rSARS-CoV-2 ( Figure 1 ). The MluI restriction site is underlined in red and the silent mutation introduced to remove the MluI restriction site (T to A) is shown in the black box ( B ). C ) Verification of BAC and rSARS-CoV-2 sequences: The SARS-CoV-2 non-reference allele frequency was calculated by comparing short reads to the reference genome of USA-WA1/2020 reference. All variants were at low frequency in P6 natural isolate (top), BAC (bottom), and rSARS-CoV-2 (middle) with the exception of introduced variants at positions 21,895 and 26,843, which were fixed in the BAC and rSARS-CoV-2 virus. Non-reference alleles present in less than 1% of reads are not shown. D ) Plaque phenotype: Vero E6 cells (6-well plate, 10 6 cells/well, triplicates) were infected with ∼20 PFU of rSARS-CoV-2 (left) or the natural SARS-CoV-2 isolate (right) for 1h at 37°C. After viral adsorption, cells were washed 3 times with PBS and overlaid with 2 ml of post-infection media containing 1% agar. After 72 h incubation at 37°C, cells were fixed and immunostained with the N protein 1C7 monoclonal antibody. D ) Growth kinetics: Vero E6 cells (6-well plate, 10 6 cells/well, triplicates) were infected (MOI 0.01) with rSARS-CoV-2 or the natural SARS-CoV-2 isolate for 1h at 37°C. After viral adsorption, cells were washed 3 times with PBS and incubated in 2 ml of post-infection media. At the indicated times post-infection, tissue culture supernatants were collected and viral titers were assessed by plaque assay (PFU/ml). Data were presented in mean ± SD. LOD: limit of detection.
Techniques Used: In Vitro, Infection, Adsorption, Incubation, Amplification, Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis, Mutagenesis, BAC Assay, Plaque Assay
13) Product Images from "LIGHT elevation enhances immune eradication of colon cancer metastases"
Article Title: LIGHT elevation enhances immune eradication of colon cancer metastases
Journal: Cancer research
doi: 10.1158/0008-5472.CAN-16-1655

Figure Legend Snippet: LIGHT expressing colon cancer cell lines maintain wild-type characteristics (A) To construct constitutive and doxycycline inducible(i) expressing LIGHT lentiviral vectors, murine LIGHT cDNA was cloned into MluI/PstI sites of the pHIV-Puro (pHIV-LIGHT) and pLVX-TRE3G (pLVX-LIGHT) parental plasmids. (B) CT26 cell clones constitutively expressing LIGHT (CT26LIGHT) or inducible expressing LIGHT (CT26LIGHT i ) or its empty control (CT26control i ) were established after drug selection and limited dilution, and LIGHT expression was analyzed using FACS after DNA sequencing. (C) LIGHT protein expression was confirmed in CT26LIGHT cells and CT26LIGHT i cells in the presence of doxycycline. The LIGHT expressing murine fibrosarcoma cell line Ag104LIGHT served as a positive control. (D) wtCT26, CT26control (empty vector), CT26control i , CT26LIGHTand CT26LIGHT i ). Cells were seeded in triplicate and MTS/PMS solution was added on days 1 2, 3, 4, and 5 with no difference in cell proliferation or metabolic activity.
Techniques Used: Expressing, Construct, Clone Assay, Selection, FACS, DNA Sequencing, Positive Control, Plasmid Preparation, Activity Assay
Related Articles
Sequencing:Article Title: A Systematic Analysis on DNA Methylation and the Expression of Both mRNA and microRNA in Bladder Cancer Article Snippet: MMSDK and statistical analysis MMSDK combines the use of methylation-sensitive restriction enzyme digestion and the second generation sequencing technique (Illumina Genome Analyzer IIx) . .. Briefly, 3 µg of genomic DNA was digested with Construct:Article Title: vLIP, a Viral Lipase Homologue, Is a Virulence Factor of Marek's Disease Virus Article Snippet: The pEco4.268 plasmid was originally constructed by inserting the EcoRI 4,268-bp subfragment of the Md5 genome derived from the sn5 cosmid ( ) (a gift of Sanjay Reddy) into pUC18 (Fig. ). .. In order to construct a shuttle vector to incorporate an in-frame deletion of amino acids 256 to 428 of the vLIP open reading frame, a 519-bp fragment was released from the pEco4.268 plasmid using Plasmid Preparation:Article Title: vLIP, a Viral Lipase Homologue, Is a Virulence Factor of Marek's Disease Virus Article Snippet: The pEco4.268 plasmid was originally constructed by inserting the EcoRI 4,268-bp subfragment of the Md5 genome derived from the sn5 cosmid ( ) (a gift of Sanjay Reddy) into pUC18 (Fig. ). .. In order to construct a shuttle vector to incorporate an in-frame deletion of amino acids 256 to 428 of the vLIP open reading frame, a 519-bp fragment was released from the pEco4.268 plasmid using Synthesized:Article Title: Novel Human Polyomavirus Noncoding Control Regions Differ in Bidirectional Gene Expression according to Host Cell, Large T-Antigen Expression, and Clinically Occurring Rearrangements Article Snippet: Based on the phRG1 reporter vector ( ) recapitulating the principal HPyV genome organization with respect to EVGR and LVGR , a smaller bidirectional reporter, pRG13D12, was constructed, in which the expression cassette for hygromycin resistance was removed, and the reporter genes were placed upstream of SV40 polyadenylation sites instead of those from beta-globin ( ). .. The HPyV NCCRs were chemically synthesized in pUC57 (Eurogentec S.A, Belgium) , excised using the restriction enzymes BssHII and Article Title: Multi-transgenic minipig models exhibiting potential for hepatic insulin resistance and pancreatic apoptosis Article Snippet: In addition, Mlu I and Not I restriction sites were designed to locate the start and end of this synthesized fragment, respectively. .. The multiple cloning site of pcDNA3.1 (+) was digested using the Clone Assay:Article Title: Novel Human Polyomavirus Noncoding Control Regions Differ in Bidirectional Gene Expression according to Host Cell, Large T-Antigen Expression, and Clinically Occurring Rearrangements Article Snippet: Based on the phRG1 reporter vector ( ) recapitulating the principal HPyV genome organization with respect to EVGR and LVGR , a smaller bidirectional reporter, pRG13D12, was constructed, in which the expression cassette for hygromycin resistance was removed, and the reporter genes were placed upstream of SV40 polyadenylation sites instead of those from beta-globin ( ). .. The HPyV NCCRs were chemically synthesized in pUC57 (Eurogentec S.A, Belgium) , excised using the restriction enzymes BssHII and Article Title: Multi-transgenic minipig models exhibiting potential for hepatic insulin resistance and pancreatic apoptosis Article Snippet: In addition, Mlu I and Not I restriction sites were designed to locate the start and end of this synthesized fragment, respectively. .. The multiple cloning site of pcDNA3.1 (+) was digested using the Polymerase Chain Reaction:Article Title: Role of N-Linked Glycans in a Human Immunodeficiency Virus Envelope Glycoprotein: Effects on Protein Function and the Neutralizing Antibody Response Article Snippet: .. The PCR product was digested with Amplification:Article Title: Rescue of SARS-CoV-2 from a Single Bacterial Artificial Chromosome Article Snippet: RT-PCR amplification of the viral genome spanning nucleotides 26488 to 27784 was performed using SuperScript II reverse transcriptase (Thermo Fisher Scientific) and the Expand high-fidelity PCR system (Sigma-Aldrich). .. The 1,297 amplified RT-PCR products were digested with Reverse Transcription Polymerase Chain Reaction:Article Title: Rescue of SARS-CoV-2 from a Single Bacterial Artificial Chromosome Article Snippet: RT-PCR amplification of the viral genome spanning nucleotides 26488 to 27784 was performed using SuperScript II reverse transcriptase (Thermo Fisher Scientific) and the Expand high-fidelity PCR system (Sigma-Aldrich). .. The 1,297 amplified RT-PCR products were digested with |