clai (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
99
|
Name:
ClaI
Description:
ClaI 5 000 units
Catalog Number:
r0197l
Price:
269
Size:
5 000 units
Category:
Restriction Enzymes
|
Buy from Supplier |
Structured Review
New England Biolabs
clai
ClaI 5 000 units
https://www.bioz.com/result/clai/product/New England Biolabs
Average 99 stars, based on 87 article reviews
Price from $9.99 to $1999.99
ClaI 5 000 units
https://www.bioz.com/result/clai/product/New England Biolabs
Average 99 stars, based on 87 article reviews
Price from $9.99 to $1999.99
clai - by Bioz Stars,
2020-03
99/100 stars
Related Products / Commonly Used Together
Images
Related Articles
Clone Assay:Article Title: Biochemical reconstitution of abasic DNA lesion replication in Xenopus extracts Article Snippet: The products were cloned into pUC19 and introduced into E. coli (DH5α) by transformation. .. For the determination of nucleotides on replicated DNA that still carried the AP lesion, the DNA (after 75 min of incubation in NPE) was digested with DpnI, Article Title: The Genome of Melanoplus sanguinipes Entomopoxvirus Article Snippet: Paragraph title: MsEPV DNA isolation and cloning. ... Right and left ends of the genome were confirmed by using Alu I, Bgl II, Amplification:Article Title: Differences in virulence of pneumolysin and autolysin mutants constructed by insertion duplication mutagenesis and in-frame deletion in Streptococcus pneumoniae Article Snippet: Kit (Qiagen, Hilden, Germany) and were then digested by Article Title: Global structure and mechanical properties of a 10-bp nucleosome positioning motif Article Snippet: .. Cyclization substrates were prepared by PCR amplification in the presence of [α-32 P]dATP, purified by using the Qiagen (Chatsworth, CA) PCR purification kit, and digested at 37°C overnight with 2.5 units of Article Title: Development of Translating Ribosome Affinity Purification for Zebrafish Article Snippet: .. The 668 bp amplicon was digested with EcoRI and Article Title: Vpma phase variation is important for survival and persistence of Mycoplasma agalactiae in the immunocompetent host Article Snippet: Confirming xer1 disruption via Southern blot analyses Mycoplasma genomic DNA was isolated by QIAamp DNA Mini Kit (Qiagen) and digested with Article Title: A Natural Mutation Involving both Pathogenicity and Perithecium Formation in the Fusarium graminearum Species Complex Article Snippet: A 186 bp-DNA fragment amplified from the Fg0407011 genome by PCR using primer pair HS601/HS602 was labeled with digoxigenin (DIG) by using a PCR DIG Probe Synthesis Kit (Roche Diagnostics). .. Genomic DNA digested with Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes Article Snippet: For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Positive Control:Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes Article Snippet: For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Synthesized:Article Title: Differences in virulence of pneumolysin and autolysin mutants constructed by insertion duplication mutagenesis and in-frame deletion in Streptococcus pneumoniae Article Snippet: Kit (Qiagen, Hilden, Germany) and were then digested by Construct:Article Title: Global structure and mechanical properties of a 10-bp nucleosome positioning motif Article Snippet: The molecules with different overall lengths were constructed by using variable bottom-strand PCR primers taken from the set 150 5′-GCAGAT ATCGAT GC AGCACGTTGTAGC 151 GCAGAT ATCGAT CGC AGCACGTTGTAGC 152 GCAGAT ATCGAT TCGC AGCACGTTGTAGC 154 GCAGAT ATCGAT TCCAGC AGCACGTTGTAGC 155 GCAGAT ATCGAT TCCATGC AGCACGTTGTAGC 156 GCAGAT ATCGAT TCCATGGC AGCACGTTGTAGC 157 GCAGAT ATCGAT TCCATGAGC AGCACGTTGTAGC 158 GCAGAT ATCGAT TCCATGGCAA AGCACGTTGTAGC 160 GCAGAT ATCGAT TCTGGACATGGC AGCACGTTGTAGC 161 GCAGAT ATCGAT CTCTGGACATGGC AGCACGTTGTAGC 162 GCAGAT ATCGAT TCTCTGGACATGGC AGCACGTTGTAGC 164 GCAGAT ATCGAT TCTCTCTGGACATGGC AGCACGTTGTAGC 166 GCAGAT ATCGAT GGTCTCTCTGGACATGGC AGCACGTTGTAGC 168 GCAGAT ATCGAT CTGGTCTCTCTGGACATGGC AGCACGTTGTAGC where the variable sequences are underlined. .. Cyclization substrates were prepared by PCR amplification in the presence of [α-32 P]dATP, purified by using the Qiagen (Chatsworth, CA) PCR purification kit, and digested at 37°C overnight with 2.5 units of Article Title: Unusual pungency from extra-virgin olive oil is due to restricted spatial expression of oleocanthal's receptor Article Snippet: Briefly, PCR was performed using two residues of mouse TRPA1 expression vector divided at the Real-time Polymerase Chain Reaction:Article Title: Differences in virulence of pneumolysin and autolysin mutants constructed by insertion duplication mutagenesis and in-frame deletion in Streptococcus pneumoniae Article Snippet: Paragraph title: Validation of TGR from the results of previous PCR assay of IDM mutants by using real-time PCR assay, southern blot hybridization and western blotting ... Kit (Qiagen, Hilden, Germany) and were then digested by Incubation:Article Title: Biochemical reconstitution of abasic DNA lesion replication in Xenopus extracts Article Snippet: .. For the determination of nucleotides on replicated DNA that still carried the AP lesion, the DNA (after 75 min of incubation in NPE) was digested with DpnI, Article Title: Initiation of DNA repair mediated by a stalled RNA polymerase IIO Article Snippet: Cax-Pt was then cut by Expressing:Article Title: Unusual pungency from extra-virgin olive oil is due to restricted spatial expression of oleocanthal's receptor Article Snippet: .. Briefly, PCR was performed using two residues of mouse TRPA1 expression vector divided at the Modification:Article Title: Designer diatom episomes delivered by bacterial conjugation Article Snippet: Plasmid-safe experiments Plasmids from P. tricornutum lines containing the p0521s plasmid were extracted using the modified alkaline lysis extraction protocol described above. .. First, ClaI restriction digest or mock reaction was performed on samples using 1–2 μg total DNA in a 100-μl total reaction with 1 × CutSmart buffer and Article Title: Unusual pungency from extra-virgin olive oil is due to restricted spatial expression of oleocanthal's receptor Article Snippet: These mutations were made by using a modified Quickchange Site-directed Mutagenesis method (Stratagene, La Jolla, CA). .. Briefly, PCR was performed using two residues of mouse TRPA1 expression vector divided at the Article Title: Identification and Characterization of Leuconostoc carnosum, Associated with Production and Spoilage of Vacuum-Packaged, Sliced, Cooked Ham Article Snippet: Reference strains and the five randomly selected industrial isolates, already known to possess similar Eco RI and Hin dIII ribotypes, were characterized with Article Title: Characterization of Leuconostoc gasicomitatum sp. nov., Associated with Spoiled Raw Tomato-Marinated Broiler Meat Strips Packaged under Modified-Atmosphere Conditions Article Snippet: Western Blot:Article Title: Initiation of DNA repair mediated by a stalled RNA polymerase IIO Article Snippet: Cax-Pt was then cut by Article Title: Differences in virulence of pneumolysin and autolysin mutants constructed by insertion duplication mutagenesis and in-frame deletion in Streptococcus pneumoniae Article Snippet: Paragraph title: Validation of TGR from the results of previous PCR assay of IDM mutants by using real-time PCR assay, southern blot hybridization and western blotting ... Kit (Qiagen, Hilden, Germany) and were then digested by Transformation Assay:Article Title: Biochemical reconstitution of abasic DNA lesion replication in Xenopus extracts Article Snippet: Half of the DNA was analyzed by TAE agarose gel electrophoresis and the remaining DNA was introduced into Maxi Efficiency DH5α (Invitrogen, CA, USA) by transformation. .. For the determination of nucleotides on replicated DNA that still carried the AP lesion, the DNA (after 75 min of incubation in NPE) was digested with DpnI, Article Title: Designer diatom episomes delivered by bacterial conjugation Article Snippet: First, ClaI restriction digest or mock reaction was performed on samples using 1–2 μg total DNA in a 100-μl total reaction with 1 × CutSmart buffer and Article Title: Unusual pungency from extra-virgin olive oil is due to restricted spatial expression of oleocanthal's receptor Article Snippet: Briefly, PCR was performed using two residues of mouse TRPA1 expression vector divided at the Derivative Assay:Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes Article Snippet: .. For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Gel Purification:Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes Article Snippet: For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Immunohistochemistry:Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes Article Snippet: Any detectable tumors were harvested 3 weeks after drug supplementation, measured, and characterized via hematoxalin and eosin stain as well as by immunohistochemistry and subsequent microscopic analysis (YCD antibody was purchased from GenWay, San Diego, CA). .. For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Southern Blot:Article Title: Transduction of human embryonic stem cells by ecotropic retroviral vectors Article Snippet: Paragraph title: Southern blot analysis ... DNA was digested overnight using EcoRI and Article Title: Differences in virulence of pneumolysin and autolysin mutants constructed by insertion duplication mutagenesis and in-frame deletion in Streptococcus pneumoniae Article Snippet: Paragraph title: Validation of TGR from the results of previous PCR assay of IDM mutants by using real-time PCR assay, southern blot hybridization and western blotting ... Kit (Qiagen, Hilden, Germany) and were then digested by Article Title: Vpma phase variation is important for survival and persistence of Mycoplasma agalactiae in the immunocompetent host Article Snippet: .. Confirming xer1 disruption via Southern blot analyses Mycoplasma genomic DNA was isolated by QIAamp DNA Mini Kit (Qiagen) and digested with Article Title: A Natural Mutation Involving both Pathogenicity and Perithecium Formation in the Fusarium graminearum Species Complex Article Snippet: Paragraph title: Southern blot hybridization ... Genomic DNA digested with Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes Article Snippet: .. For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Article Title: Characterization of Leuconostoc gasicomitatum sp. nov., Associated with Spoiled Raw Tomato-Marinated Broiler Meat Strips Packaged under Modified-Atmosphere Conditions Article Snippet: Serial Dilution:Article Title: Differences in virulence of pneumolysin and autolysin mutants constructed by insertion duplication mutagenesis and in-frame deletion in Streptococcus pneumoniae Article Snippet: Serial dilution of the cultures were spread to BA to eneumate the viable colonies. .. Kit (Qiagen, Hilden, Germany) and were then digested by Generated:Article Title: Construction of a Single Lentiviral Vector Containing Tetracycline-Inducible Alb-uPA for Transduction of uPA Expression in Murine Hepatocytes Article Snippet: The T vector containing 2399 bp fragment and the pTet-On Advanced Vector plasmid were respectively digested by Article Title: Unusual pungency from extra-virgin olive oil is due to restricted spatial expression of oleocanthal's receptor Article Snippet: A double cysteine mutant of mouse TRPA1 (C422S/C622S) was generated by cysteine-serine substitutions at C422 and C622, residues which are thought to be covalently modified by several electrophilic agonists, in the N terminal domain. .. Briefly, PCR was performed using two residues of mouse TRPA1 expression vector divided at the Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes Article Snippet: For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and DNA Labeling:Article Title: A Natural Mutation Involving both Pathogenicity and Perithecium Formation in the Fusarium graminearum Species Complex Article Snippet: Genomic DNA digested with Sequencing:Article Title: Construction of a Single Lentiviral Vector Containing Tetracycline-Inducible Alb-uPA for Transduction of uPA Expression in Murine Hepatocytes Article Snippet: Construction of CN360 and CN361 Lentiviral Plasmid The coding sequence rtTA2S -M2 was excised from the pTet-On Advanced Vector plasmid (SunBio Shanghai, China). .. The T vector containing 2399 bp fragment and the pTet-On Advanced Vector plasmid were respectively digested by Article Title: Biochemical reconstitution of abasic DNA lesion replication in Xenopus extracts Article Snippet: For the determination of nucleotides on replicated DNA that still carried the AP lesion, the DNA (after 75 min of incubation in NPE) was digested with DpnI, Article Title: The Genome of Melanoplus sanguinipes Entomopoxvirus Article Snippet: MsEPV genome organization was confirmed by comparing observed Bam HI, Hin dIII, and Sca I restriction fragments to the consensus sequence data. .. Right and left ends of the genome were confirmed by using Alu I, Bgl II, Article Title: Global structure and mechanical properties of a 10-bp nucleosome positioning motif Article Snippet: This is followed in the 156-bp B-DNA molecule by (91)CGAAT TCTAGACCTAGGTGGATGACTCATTTTTTT TTGCTCGAGCTACAACGTGCTGCCATGGAAT(156) and, in the variable phasing linker sequences, by 12_156 CGAAT TATAAACGCCTATAAACGCCTATAAACGCC TTGCTCGA GCTACAACGTGCTGCCATGGAAT 16_156 CGAAT TTGC TATAAACGCCTATAAACGCCTATAAACGCC TCGA GCTACAACGTGCTGCCATGGAAT 20_156 CGAAT TTGCTCGA TATAAACGCCTATAAACGCCTATAAACGCC GCTACAACGTGCTGCCATGGAAT in which the 30-bp segment is indicated in boldface, and the sequence elements that differ in the phasing linkers are underlined. .. Cyclization substrates were prepared by PCR amplification in the presence of [α-32 P]dATP, purified by using the Qiagen (Chatsworth, CA) PCR purification kit, and digested at 37°C overnight with 2.5 units of Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes Article Snippet: For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Injection:Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes Article Snippet: When tumors reached an average of 0.2 cm3 , three mice each from both the iPSGFP - and iPSYCD -injected groups were administered 500 mg/kg/day for 10 consecutive days. .. For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Binding Assay:Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes Article Snippet: .. For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Molecular Weight:Article Title: A Natural Mutation Involving both Pathogenicity and Perithecium Formation in the Fusarium graminearum Species Complex Article Snippet: .. Genomic DNA digested with DNA Extraction:Article Title: The Genome of Melanoplus sanguinipes Entomopoxvirus Article Snippet: Paragraph title: MsEPV DNA isolation and cloning. ... Right and left ends of the genome were confirmed by using Alu I, Bgl II, Radioactivity:Article Title: Global structure and mechanical properties of a 10-bp nucleosome positioning motif Article Snippet: Cyclization substrates were prepared by PCR amplification in the presence of [α-32 P]dATP, purified by using the Qiagen (Chatsworth, CA) PCR purification kit, and digested at 37°C overnight with 2.5 units of Mutagenesis:Article Title: Unusual pungency from extra-virgin olive oil is due to restricted spatial expression of oleocanthal's receptor Article Snippet: Paragraph title: Method for mutagenesis ... Briefly, PCR was performed using two residues of mouse TRPA1 expression vector divided at the Isolation:Article Title: Biochemical reconstitution of abasic DNA lesion replication in Xenopus extracts Article Snippet: The plasmids from the transformants were isolated and the AP lesion region was sequenced to determine the nucleotides inserted opposite AP. .. For the determination of nucleotides on replicated DNA that still carried the AP lesion, the DNA (after 75 min of incubation in NPE) was digested with DpnI, Article Title: Vpma phase variation is important for survival and persistence of Mycoplasma agalactiae in the immunocompetent host Article Snippet: .. Confirming xer1 disruption via Southern blot analyses Mycoplasma genomic DNA was isolated by QIAamp DNA Mini Kit (Qiagen) and digested with Article Title: Identification and Characterization of Leuconostoc carnosum, Associated with Production and Spoilage of Vacuum-Packaged, Sliced, Cooked Ham Article Snippet: Paragraph title: In vitro isolation of DNA and ribotyping for species identification. ... Reference strains and the five randomly selected industrial isolates, already known to possess similar Eco RI and Hin dIII ribotypes, were characterized with Article Title: Characterization of Leuconostoc gasicomitatum sp. nov., Associated with Spoiled Raw Tomato-Marinated Broiler Meat Strips Packaged under Modified-Atmosphere Conditions Article Snippet: Paragraph title: Isolation of DNA, REA, and 16 and 23S rDNA RFLP (ribotyping). ... Functional Assay:Article Title: Initiation of DNA repair mediated by a stalled RNA polymerase IIO Article Snippet: Cax-Pt was then cut by Labeling:Article Title: A Natural Mutation Involving both Pathogenicity and Perithecium Formation in the Fusarium graminearum Species Complex Article Snippet: A 186 bp-DNA fragment amplified from the Fg0407011 genome by PCR using primer pair HS601/HS602 was labeled with digoxigenin (DIG) by using a PCR DIG Probe Synthesis Kit (Roche Diagnostics). .. Genomic DNA digested with Purification:Article Title: Biochemical reconstitution of abasic DNA lesion replication in Xenopus extracts Article Snippet: .. For the determination of nucleotides on replicated DNA that still carried the AP lesion, the DNA (after 75 min of incubation in NPE) was digested with DpnI, Article Title: Initiation of DNA repair mediated by a stalled RNA polymerase IIO Article Snippet: Cax-Pt was then cut by Article Title: Global structure and mechanical properties of a 10-bp nucleosome positioning motif Article Snippet: .. Cyclization substrates were prepared by PCR amplification in the presence of [α-32 P]dATP, purified by using the Qiagen (Chatsworth, CA) PCR purification kit, and digested at 37°C overnight with 2.5 units of Article Title: Development of Translating Ribosome Affinity Purification for Zebrafish Article Snippet: .. The 668 bp amplicon was digested with EcoRI and Article Title: Vpma phase variation is important for survival and persistence of Mycoplasma agalactiae in the immunocompetent host Article Snippet: Confirming xer1 disruption via Southern blot analyses Mycoplasma genomic DNA was isolated by QIAamp DNA Mini Kit (Qiagen) and digested with Article Title: A Natural Mutation Involving both Pathogenicity and Perithecium Formation in the Fusarium graminearum Species Complex Article Snippet: The probe was used after purification by Mini Quick Spin DNA Columns (Roche Diagnostics). .. Genomic DNA digested with Polymerase Chain Reaction:Article Title: Construction of a Single Lentiviral Vector Containing Tetracycline-Inducible Alb-uPA for Transduction of uPA Expression in Murine Hepatocytes Article Snippet: PCR conditions were 5 minutes at 94°C, 30 cycles of 10 seconds at 98°C, 15 seconds at 55°C and 2.5 minutes at 72°C, and a final 10-minute extension at 72°C. .. The T vector containing 2399 bp fragment and the pTet-On Advanced Vector plasmid were respectively digested by Article Title: Biochemical reconstitution of abasic DNA lesion replication in Xenopus extracts Article Snippet: For the determination of nucleotides on replicated DNA that still carried the AP lesion, the DNA (after 75 min of incubation in NPE) was digested with DpnI, Article Title: Differences in virulence of pneumolysin and autolysin mutants constructed by insertion duplication mutagenesis and in-frame deletion in Streptococcus pneumoniae Article Snippet: Paragraph title: Validation of TGR from the results of previous PCR assay of IDM mutants by using real-time PCR assay, southern blot hybridization and western blotting ... Kit (Qiagen, Hilden, Germany) and were then digested by Article Title: Global structure and mechanical properties of a 10-bp nucleosome positioning motif Article Snippet: .. Cyclization substrates were prepared by PCR amplification in the presence of [α-32 P]dATP, purified by using the Qiagen (Chatsworth, CA) PCR purification kit, and digested at 37°C overnight with 2.5 units of Article Title: Unusual pungency from extra-virgin olive oil is due to restricted spatial expression of oleocanthal's receptor Article Snippet: .. Briefly, PCR was performed using two residues of mouse TRPA1 expression vector divided at the Article Title: Vpma phase variation is important for survival and persistence of Mycoplasma agalactiae in the immunocompetent host Article Snippet: Confirming xer1 disruption via Southern blot analyses Mycoplasma genomic DNA was isolated by QIAamp DNA Mini Kit (Qiagen) and digested with Article Title: A Natural Mutation Involving both Pathogenicity and Perithecium Formation in the Fusarium graminearum Species Complex Article Snippet: A 186 bp-DNA fragment amplified from the Fg0407011 genome by PCR using primer pair HS601/HS602 was labeled with digoxigenin (DIG) by using a PCR DIG Probe Synthesis Kit (Roche Diagnostics). .. Genomic DNA digested with Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes Article Snippet: For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Lysis:Article Title: Transduction of human embryonic stem cells by ecotropic retroviral vectors Article Snippet: Southern blot analysis Genomic DNA was extracted from cells by lysis with SDS and proteinase K digestion followed by isopropanol precipitation. .. DNA was digested overnight using EcoRI and cDNA Library Assay:Article Title: Development of Translating Ribosome Affinity Purification for Zebrafish Article Snippet: Zebrafish rpl10a was amplified from a cDNA library with primers 5′ RPL10A Link: CGTTCGAATTCAGCAAGG TCTCGAGAGACACG and 3′ RPL10A ClaI: GCATCGATCC TAGTAGAGGCGCTGTGGTT using Phusion High Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA). .. The 668 bp amplicon was digested with EcoRI and Mouse Assay:Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes Article Snippet: All experiments using mice received approval from the Institutional Animal Care and Use Committee at the Fred Hutchinson Cancer Research Center. .. For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Plasmid Preparation:Article Title: Construction of a Single Lentiviral Vector Containing Tetracycline-Inducible Alb-uPA for Transduction of uPA Expression in Murine Hepatocytes Article Snippet: .. The T vector containing 2399 bp fragment and the pTet-On Advanced Vector plasmid were respectively digested by Article Title: Designer diatom episomes delivered by bacterial conjugation Article Snippet: Paragraph title: Plasmid-safe experiments ... First, ClaI restriction digest or mock reaction was performed on samples using 1–2 μg total DNA in a 100-μl total reaction with 1 × CutSmart buffer and Article Title: Unusual pungency from extra-virgin olive oil is due to restricted spatial expression of oleocanthal's receptor Article Snippet: .. Briefly, PCR was performed using two residues of mouse TRPA1 expression vector divided at the Article Title: Development of Translating Ribosome Affinity Purification for Zebrafish Article Snippet: Paragraph title: Zebrafish TRAP Plasmid Construction ... The 668 bp amplicon was digested with EcoRI and Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes Article Snippet: For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Software:Article Title: Transduction of human embryonic stem cells by ecotropic retroviral vectors Article Snippet: DNA was digested overnight using EcoRI and Article Title: The Genome of Melanoplus sanguinipes Entomopoxvirus Article Snippet: The sequences were assembled with Phrap software , using the quality files and default settings to produce a consensus sequence. .. Right and left ends of the genome were confirmed by using Alu I, Bgl II, Hybridization:Article Title: Differences in virulence of pneumolysin and autolysin mutants constructed by insertion duplication mutagenesis and in-frame deletion in Streptococcus pneumoniae Article Snippet: Paragraph title: Validation of TGR from the results of previous PCR assay of IDM mutants by using real-time PCR assay, southern blot hybridization and western blotting ... Kit (Qiagen, Hilden, Germany) and were then digested by Article Title: Vpma phase variation is important for survival and persistence of Mycoplasma agalactiae in the immunocompetent host Article Snippet: Confirming xer1 disruption via Southern blot analyses Mycoplasma genomic DNA was isolated by QIAamp DNA Mini Kit (Qiagen) and digested with Article Title: A Natural Mutation Involving both Pathogenicity and Perithecium Formation in the Fusarium graminearum Species Complex Article Snippet: Paragraph title: Southern blot hybridization ... Genomic DNA digested with Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes Article Snippet: For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Electrophoresis:Article Title: Vpma phase variation is important for survival and persistence of Mycoplasma agalactiae in the immunocompetent host Article Snippet: .. Confirming xer1 disruption via Southern blot analyses Mycoplasma genomic DNA was isolated by QIAamp DNA Mini Kit (Qiagen) and digested with Negative Control:Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes Article Snippet: For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Agarose Gel Electrophoresis:Article Title: Transduction of human embryonic stem cells by ecotropic retroviral vectors Article Snippet: .. DNA was digested overnight using EcoRI and Article Title: Construction of a Single Lentiviral Vector Containing Tetracycline-Inducible Alb-uPA for Transduction of uPA Expression in Murine Hepatocytes Article Snippet: The T vector containing 2399 bp fragment and the pTet-On Advanced Vector plasmid were respectively digested by Article Title: Biochemical reconstitution of abasic DNA lesion replication in Xenopus extracts Article Snippet: Half of the DNA was analyzed by TAE agarose gel electrophoresis and the remaining DNA was introduced into Maxi Efficiency DH5α (Invitrogen, CA, USA) by transformation. .. For the determination of nucleotides on replicated DNA that still carried the AP lesion, the DNA (after 75 min of incubation in NPE) was digested with DpnI, Article Title: Vpma phase variation is important for survival and persistence of Mycoplasma agalactiae in the immunocompetent host Article Snippet: .. Confirming xer1 disruption via Southern blot analyses Mycoplasma genomic DNA was isolated by QIAamp DNA Mini Kit (Qiagen) and digested with Article Title: A Natural Mutation Involving both Pathogenicity and Perithecium Formation in the Fusarium graminearum Species Complex Article Snippet: .. Genomic DNA digested with In Vitro:Article Title: Identification and Characterization of Leuconostoc carnosum, Associated with Production and Spoilage of Vacuum-Packaged, Sliced, Cooked Ham Article Snippet: Paragraph title: In vitro isolation of DNA and ribotyping for species identification. ... Reference strains and the five randomly selected industrial isolates, already known to possess similar Eco RI and Hin dIII ribotypes, were characterized with Protein Binding:Article Title: Initiation of DNA repair mediated by a stalled RNA polymerase IIO Article Snippet: Paragraph title: Protein binding studies on immobilized DNA ... Cax-Pt was then cut by Produced:Article Title: The Genome of Melanoplus sanguinipes Entomopoxvirus Article Snippet: Chromatogram traces were base called with Phred software , which also produced a quality file containing a predicted probability of error at each base position. .. Right and left ends of the genome were confirmed by using Alu I, Bgl II, Concentration Assay:Article Title: Global structure and mechanical properties of a 10-bp nucleosome positioning motif Article Snippet: Cyclization substrates were prepared by PCR amplification in the presence of [α-32 P]dATP, purified by using the Qiagen (Chatsworth, CA) PCR purification kit, and digested at 37°C overnight with 2.5 units of Alkaline Lysis:Article Title: Designer diatom episomes delivered by bacterial conjugation Article Snippet: Plasmid-safe experiments Plasmids from P. tricornutum lines containing the p0521s plasmid were extracted using the modified alkaline lysis extraction protocol described above. .. First, ClaI restriction digest or mock reaction was performed on samples using 1–2 μg total DNA in a 100-μl total reaction with 1 × CutSmart buffer and Marker:Article Title: A Natural Mutation Involving both Pathogenicity and Perithecium Formation in the Fusarium graminearum Species Complex Article Snippet: .. Genomic DNA digested with Staining:Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes Article Snippet: Any detectable tumors were harvested 3 weeks after drug supplementation, measured, and characterized via hematoxalin and eosin stain as well as by immunohistochemistry and subsequent microscopic analysis (YCD antibody was purchased from GenWay, San Diego, CA). .. For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and |