clai  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    ClaI
    Description:
    ClaI 5 000 units
    Catalog Number:
    r0197l
    Price:
    269
    Size:
    5 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs clai
    ClaI
    ClaI 5 000 units
    https://www.bioz.com/result/clai/product/New England Biolabs
    Average 99 stars, based on 87 article reviews
    Price from $9.99 to $1999.99
    clai - by Bioz Stars, 2020-03
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Biochemical reconstitution of abasic DNA lesion replication in Xenopus extracts
    Article Snippet: The products were cloned into pUC19 and introduced into E. coli (DH5α) by transformation. .. For the determination of nucleotides on replicated DNA that still carried the AP lesion, the DNA (after 75 min of incubation in NPE) was digested with DpnI, ClaI and APE (NEB, MA, USA), purified by Qiagen column, and re-digested with KpnI.

    Article Title: The Genome of Melanoplus sanguinipes Entomopoxvirus
    Article Snippet: Paragraph title: MsEPV DNA isolation and cloning. ... Right and left ends of the genome were confirmed by using Alu I, Bgl II, Cla I, Nhe I, Pml I, and Sau 3AI restriction digests (New England Biolabs).

    Amplification:

    Article Title: Differences in virulence of pneumolysin and autolysin mutants constructed by insertion duplication mutagenesis and in-frame deletion in Streptococcus pneumoniae
    Article Snippet: Kit (Qiagen, Hilden, Germany) and were then digested by Cla I (New England Biolabs, Ipswich, MA, USA) according to the manufactures’ instruction. .. Digoxigenin (DIG)-labeled probe ply-pb, synthesized by PCR amplification of ply-pbF and ply-pbR, were hybridized to the membrane and detected by DIG-luminescent detection kit (Roche, Mannheim Germany) (Table ).

    Article Title: Global structure and mechanical properties of a 10-bp nucleosome positioning motif
    Article Snippet: .. Cyclization substrates were prepared by PCR amplification in the presence of [α-32 P]dATP, purified by using the Qiagen (Chatsworth, CA) PCR purification kit, and digested at 37°C overnight with 2.5 units of Cla I (New England Biolabs) per 100 μl. .. After purification on nondenaturing 10% polyacrylamide gels and electroelution, the radioactivity was monitored by scintillation counting and the concentration was determined by UV absorbance.

    Article Title: Development of Translating Ribosome Affinity Purification for Zebrafish
    Article Snippet: .. The 668 bp amplicon was digested with EcoRI and ClaI restriction endonucleases (New England Biolabs, Ipswich, MA) and gel purified (Qiagen, Verlo, NL). .. Vector s296 containing the murine EGFP- Rpl10a fusion was digested with AgeI and EcoRI restriction endonucleases.

    Article Title: Vpma phase variation is important for survival and persistence of Mycoplasma agalactiae in the immunocompetent host
    Article Snippet: Confirming xer1 disruption via Southern blot analyses Mycoplasma genomic DNA was isolated by QIAamp DNA Mini Kit (Qiagen) and digested with Cla I (New England Biolabs) at 37°C for at least 6–7 h before subjecting to electrophoresis on a 1% agarose gel. .. A DIG-labelled probe corresponding to a 513 bp partial xer1 fragment was prepared by PCR amplification of genomic DNA of type strain PG2 using primers XerR and XerS in presence of 2.5 mM MgCl2 using 30 cycles of 95°C for 43 s, 56°C for 43 s and 72°C for 43 s. After purification with the QIAquick PCR Purification Kit (Qiagen), hybridization and subsequent chemiluminescent detection of the DIG-labelled nucleic acids using Anti-DIG -AP was carried out according to the manufacturer’s instructions (Roche).

    Article Title: A Natural Mutation Involving both Pathogenicity and Perithecium Formation in the Fusarium graminearum Species Complex
    Article Snippet: A 186 bp-DNA fragment amplified from the Fg0407011 genome by PCR using primer pair HS601/HS602 was labeled with digoxigenin (DIG) by using a PCR DIG Probe Synthesis Kit (Roche Diagnostics). .. Genomic DNA digested with Cla I (New England Biolabs, Beverly, MA) was subjected to agarose gel electrophoresis together with DNA Molecular Weight Marker III, DIG-labeled (Roche Diagnostics), and transferred to a nylon membrane.

    Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes
    Article Snippet: For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Cla I (New England Biolabs, Ipswich, MA) that cleave within the probe region of the YCD gene of the iPSYCD cells and randomly within the genomic DNA to produce fragments that were detectable by the 473 bp probe binding within the YCD gene. .. The 473 bp YCD -probe was generated via PCR amplification from 10 pg vector plasmid DNA using a forward primer with the sequence ATGGTGACAGGGGGAATG and a reverse primer with the sequence CAATATCTTCAAACCAATCCTG followed by gel-purification.

    Positive Control:

    Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes
    Article Snippet: For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Cla I (New England Biolabs, Ipswich, MA) that cleave within the probe region of the YCD gene of the iPSYCD cells and randomly within the genomic DNA to produce fragments that were detectable by the 473 bp probe binding within the YCD gene. .. Plasmid encoding the YCD- containing lentiviral vector was used as positive control and DNA from iPSGFP cells was used as negative control.

    Synthesized:

    Article Title: Differences in virulence of pneumolysin and autolysin mutants constructed by insertion duplication mutagenesis and in-frame deletion in Streptococcus pneumoniae
    Article Snippet: Kit (Qiagen, Hilden, Germany) and were then digested by Cla I (New England Biolabs, Ipswich, MA, USA) according to the manufactures’ instruction. .. Digoxigenin (DIG)-labeled probe ply-pb, synthesized by PCR amplification of ply-pbF and ply-pbR, were hybridized to the membrane and detected by DIG-luminescent detection kit (Roche, Mannheim Germany) (Table ).

    Construct:

    Article Title: Global structure and mechanical properties of a 10-bp nucleosome positioning motif
    Article Snippet: The molecules with different overall lengths were constructed by using variable bottom-strand PCR primers taken from the set 150 5′-GCAGAT ATCGAT GC AGCACGTTGTAGC 151 GCAGAT ATCGAT CGC AGCACGTTGTAGC 152 GCAGAT ATCGAT TCGC AGCACGTTGTAGC 154 GCAGAT ATCGAT TCCAGC AGCACGTTGTAGC 155 GCAGAT ATCGAT TCCATGC AGCACGTTGTAGC 156 GCAGAT ATCGAT TCCATGGC AGCACGTTGTAGC 157 GCAGAT ATCGAT TCCATGAGC AGCACGTTGTAGC 158 GCAGAT ATCGAT TCCATGGCAA AGCACGTTGTAGC 160 GCAGAT ATCGAT TCTGGACATGGC AGCACGTTGTAGC 161 GCAGAT ATCGAT CTCTGGACATGGC AGCACGTTGTAGC 162 GCAGAT ATCGAT TCTCTGGACATGGC AGCACGTTGTAGC 164 GCAGAT ATCGAT TCTCTCTGGACATGGC AGCACGTTGTAGC 166 GCAGAT ATCGAT GGTCTCTCTGGACATGGC AGCACGTTGTAGC 168 GCAGAT ATCGAT CTGGTCTCTCTGGACATGGC AGCACGTTGTAGC where the variable sequences are underlined. .. Cyclization substrates were prepared by PCR amplification in the presence of [α-32 P]dATP, purified by using the Qiagen (Chatsworth, CA) PCR purification kit, and digested at 37°C overnight with 2.5 units of Cla I (New England Biolabs) per 100 μl.

    Article Title: Unusual pungency from extra-virgin olive oil is due to restricted spatial expression of oleocanthal's receptor
    Article Snippet: Briefly, PCR was performed using two residues of mouse TRPA1 expression vector divided at the Cla I (New England Biolabs, Beverly, MA) site as templates (the former for C422S, the latter for C622S), two synthetic oligonucleotide primers containing specific mutations (C422S-S and AS, 5’-CATTATGCCTCTAGGCAGGGG-3’ and 5’-CCCCTGCCTAGAGGCATAATG-3’, C622S-S and AS, 5’-CCCGAGTCCATGAAAGTTCTT-3’ and 5’-AAGAACTTTCATGGACTCGGG-3’), and primestar™ HS DNA polymerase (TAKARA, Kusatsu, Japan). .. TRPA1 mutant (C422S/C622S) was constructed by combining these two mutants at the Cla I site.

    Real-time Polymerase Chain Reaction:

    Article Title: Differences in virulence of pneumolysin and autolysin mutants constructed by insertion duplication mutagenesis and in-frame deletion in Streptococcus pneumoniae
    Article Snippet: Paragraph title: Validation of TGR from the results of previous PCR assay of IDM mutants by using real-time PCR assay, southern blot hybridization and western blotting ... Kit (Qiagen, Hilden, Germany) and were then digested by Cla I (New England Biolabs, Ipswich, MA, USA) according to the manufactures’ instruction.

    Incubation:

    Article Title: Biochemical reconstitution of abasic DNA lesion replication in Xenopus extracts
    Article Snippet: .. For the determination of nucleotides on replicated DNA that still carried the AP lesion, the DNA (after 75 min of incubation in NPE) was digested with DpnI, ClaI and APE (NEB, MA, USA), purified by Qiagen column, and re-digested with KpnI. .. This DNA was then used as template for PCR with two primers (5′ AGCGAGG AAGCGGAAGAGC 3′ and 5′ TGGTTGCCGCCACT TCACC 3′) that bracket the ClaI and KpnI sites.

    Article Title: Initiation of DNA repair mediated by a stalled RNA polymerase IIO
    Article Snippet: Cax-Pt was then cut by Cla I (New England Biolabs) in a reaction volume of 40 ml. .. The transcribed and Cla I-cut immobilized Cax-Pt is washed again in transcription buffer 400 and 50, before incubation with either purified NER factors or XPC-WCE under dual incision assay condition for 30 min at 30°C.

    Expressing:

    Article Title: Unusual pungency from extra-virgin olive oil is due to restricted spatial expression of oleocanthal's receptor
    Article Snippet: .. Briefly, PCR was performed using two residues of mouse TRPA1 expression vector divided at the Cla I (New England Biolabs, Beverly, MA) site as templates (the former for C422S, the latter for C622S), two synthetic oligonucleotide primers containing specific mutations (C422S-S and AS, 5’-CATTATGCCTCTAGGCAGGGG-3’ and 5’-CCCCTGCCTAGAGGCATAATG-3’, C622S-S and AS, 5’-CCCGAGTCCATGAAAGTTCTT-3’ and 5’-AAGAACTTTCATGGACTCGGG-3’), and primestar™ HS DNA polymerase (TAKARA, Kusatsu, Japan). .. The PCR products were digested with Dpn I (New England BioLabs, Beverly, MA) at 37 °C for one hour, and transformed into DH5a competent cells.

    Modification:

    Article Title: Designer diatom episomes delivered by bacterial conjugation
    Article Snippet: Plasmid-safe experiments Plasmids from P. tricornutum lines containing the p0521s plasmid were extracted using the modified alkaline lysis extraction protocol described above. .. First, ClaI restriction digest or mock reaction was performed on samples using 1–2 μg total DNA in a 100-μl total reaction with 1 × CutSmart buffer and ClaI (NEB) or water in digested or mock-digested samples, respectively.

    Article Title: Unusual pungency from extra-virgin olive oil is due to restricted spatial expression of oleocanthal's receptor
    Article Snippet: These mutations were made by using a modified Quickchange Site-directed Mutagenesis method (Stratagene, La Jolla, CA). .. Briefly, PCR was performed using two residues of mouse TRPA1 expression vector divided at the Cla I (New England Biolabs, Beverly, MA) site as templates (the former for C422S, the latter for C622S), two synthetic oligonucleotide primers containing specific mutations (C422S-S and AS, 5’-CATTATGCCTCTAGGCAGGGG-3’ and 5’-CCCCTGCCTAGAGGCATAATG-3’, C622S-S and AS, 5’-CCCGAGTCCATGAAAGTTCTT-3’ and 5’-AAGAACTTTCATGGACTCGGG-3’), and primestar™ HS DNA polymerase (TAKARA, Kusatsu, Japan).

    Article Title: Identification and Characterization of Leuconostoc carnosum, Associated with Production and Spoilage of Vacuum-Packaged, Sliced, Cooked Ham
    Article Snippet: Reference strains and the five randomly selected industrial isolates, already known to possess similar Eco RI and Hin dIII ribotypes, were characterized with Cla I, Eco RI, and Hin dIII (New England BioLabs, Beverly, Mass.). .. DNA was isolated by the guanidium thiocyanate method of Pitcher et al. ( ) as modified by Björkroth and Korkeala ( ) by combined lysozyme and mutanolysin treatments.

    Article Title: Characterization of Leuconostoc gasicomitatum sp. nov., Associated with Spoiled Raw Tomato-Marinated Broiler Meat Strips Packaged under Modified-Atmosphere Conditions
    Article Snippet: Cla I, Eco RI, and Hin dIII restriction enzymes (New England Biolabs, Beverly, Mass.) were used for ribotyping. .. DNA was isolated by the guanidium thiocyanate method of Pitcher et al. ( ) as modified by Björkroth and Korkeala ( ) by the combined lysozyme and mutanolysin (Sigma, St. Louis, Mo.) treatment.

    Western Blot:

    Article Title: Initiation of DNA repair mediated by a stalled RNA polymerase IIO
    Article Snippet: Cax-Pt was then cut by Cla I (New England Biolabs) in a reaction volume of 40 ml. .. Washed beads in transcription buffer 50 are further analyzed for bound proteins either functionally or by Western blot.

    Article Title: Differences in virulence of pneumolysin and autolysin mutants constructed by insertion duplication mutagenesis and in-frame deletion in Streptococcus pneumoniae
    Article Snippet: Paragraph title: Validation of TGR from the results of previous PCR assay of IDM mutants by using real-time PCR assay, southern blot hybridization and western blotting ... Kit (Qiagen, Hilden, Germany) and were then digested by Cla I (New England Biolabs, Ipswich, MA, USA) according to the manufactures’ instruction.

    Transformation Assay:

    Article Title: Biochemical reconstitution of abasic DNA lesion replication in Xenopus extracts
    Article Snippet: Half of the DNA was analyzed by TAE agarose gel electrophoresis and the remaining DNA was introduced into Maxi Efficiency DH5α (Invitrogen, CA, USA) by transformation. .. For the determination of nucleotides on replicated DNA that still carried the AP lesion, the DNA (after 75 min of incubation in NPE) was digested with DpnI, ClaI and APE (NEB, MA, USA), purified by Qiagen column, and re-digested with KpnI.

    Article Title: Designer diatom episomes delivered by bacterial conjugation
    Article Snippet: First, ClaI restriction digest or mock reaction was performed on samples using 1–2 μg total DNA in a 100-μl total reaction with 1 × CutSmart buffer and ClaI (NEB) or water in digested or mock-digested samples, respectively. .. Treated DNA was precipitated, resuspended in water and transformed into E. coli strain Epi300.

    Article Title: Unusual pungency from extra-virgin olive oil is due to restricted spatial expression of oleocanthal's receptor
    Article Snippet: Briefly, PCR was performed using two residues of mouse TRPA1 expression vector divided at the Cla I (New England Biolabs, Beverly, MA) site as templates (the former for C422S, the latter for C622S), two synthetic oligonucleotide primers containing specific mutations (C422S-S and AS, 5’-CATTATGCCTCTAGGCAGGGG-3’ and 5’-CCCCTGCCTAGAGGCATAATG-3’, C622S-S and AS, 5’-CCCGAGTCCATGAAAGTTCTT-3’ and 5’-AAGAACTTTCATGGACTCGGG-3’), and primestar™ HS DNA polymerase (TAKARA, Kusatsu, Japan). .. The PCR products were digested with Dpn I (New England BioLabs, Beverly, MA) at 37 °C for one hour, and transformed into DH5a competent cells.

    Derivative Assay:

    Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes
    Article Snippet: .. For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Cla I (New England Biolabs, Ipswich, MA) that cleave within the probe region of the YCD gene of the iPSYCD cells and randomly within the genomic DNA to produce fragments that were detectable by the 473 bp probe binding within the YCD gene. .. Plasmid encoding the YCD- containing lentiviral vector was used as positive control and DNA from iPSGFP cells was used as negative control.

    Gel Purification:

    Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes
    Article Snippet: For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Cla I (New England Biolabs, Ipswich, MA) that cleave within the probe region of the YCD gene of the iPSYCD cells and randomly within the genomic DNA to produce fragments that were detectable by the 473 bp probe binding within the YCD gene. .. The 473 bp YCD -probe was generated via PCR amplification from 10 pg vector plasmid DNA using a forward primer with the sequence ATGGTGACAGGGGGAATG and a reverse primer with the sequence CAATATCTTCAAACCAATCCTG followed by gel-purification.

    Immunohistochemistry:

    Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes
    Article Snippet: Any detectable tumors were harvested 3 weeks after drug supplementation, measured, and characterized via hematoxalin and eosin stain as well as by immunohistochemistry and subsequent microscopic analysis (YCD antibody was purchased from GenWay, San Diego, CA). .. For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Cla I (New England Biolabs, Ipswich, MA) that cleave within the probe region of the YCD gene of the iPSYCD cells and randomly within the genomic DNA to produce fragments that were detectable by the 473 bp probe binding within the YCD gene.

    Southern Blot:

    Article Title: Transduction of human embryonic stem cells by ecotropic retroviral vectors
    Article Snippet: Paragraph title: Southern blot analysis ... DNA was digested overnight using EcoRI and ClaI (both NEB) restriction enzymes and separated on an agarose gel.

    Article Title: Differences in virulence of pneumolysin and autolysin mutants constructed by insertion duplication mutagenesis and in-frame deletion in Streptococcus pneumoniae
    Article Snippet: Paragraph title: Validation of TGR from the results of previous PCR assay of IDM mutants by using real-time PCR assay, southern blot hybridization and western blotting ... Kit (Qiagen, Hilden, Germany) and were then digested by Cla I (New England Biolabs, Ipswich, MA, USA) according to the manufactures’ instruction.

    Article Title: Vpma phase variation is important for survival and persistence of Mycoplasma agalactiae in the immunocompetent host
    Article Snippet: .. Confirming xer1 disruption via Southern blot analyses Mycoplasma genomic DNA was isolated by QIAamp DNA Mini Kit (Qiagen) and digested with Cla I (New England Biolabs) at 37°C for at least 6–7 h before subjecting to electrophoresis on a 1% agarose gel. .. This was followed by standard Southern blotting procedures and hybridization using Digoxigenin (DIG)-labelling system (Roche) as described previously [ ].

    Article Title: A Natural Mutation Involving both Pathogenicity and Perithecium Formation in the Fusarium graminearum Species Complex
    Article Snippet: Paragraph title: Southern blot hybridization ... Genomic DNA digested with Cla I (New England Biolabs, Beverly, MA) was subjected to agarose gel electrophoresis together with DNA Molecular Weight Marker III, DIG-labeled (Roche Diagnostics), and transferred to a nylon membrane.

    Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes
    Article Snippet: .. For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Cla I (New England Biolabs, Ipswich, MA) that cleave within the probe region of the YCD gene of the iPSYCD cells and randomly within the genomic DNA to produce fragments that were detectable by the 473 bp probe binding within the YCD gene. .. Plasmid encoding the YCD- containing lentiviral vector was used as positive control and DNA from iPSGFP cells was used as negative control.

    Article Title: Characterization of Leuconostoc gasicomitatum sp. nov., Associated with Spoiled Raw Tomato-Marinated Broiler Meat Strips Packaged under Modified-Atmosphere Conditions
    Article Snippet: Cla I, Eco RI, and Hin dIII restriction enzymes (New England Biolabs, Beverly, Mass.) were used for ribotyping. .. Before Southern blotting, the REA patterns were inspected visually in order to obtain preliminary information about clonal variation.

    Serial Dilution:

    Article Title: Differences in virulence of pneumolysin and autolysin mutants constructed by insertion duplication mutagenesis and in-frame deletion in Streptococcus pneumoniae
    Article Snippet: Serial dilution of the cultures were spread to BA to eneumate the viable colonies. .. Kit (Qiagen, Hilden, Germany) and were then digested by Cla I (New England Biolabs, Ipswich, MA, USA) according to the manufactures’ instruction.

    Generated:

    Article Title: Construction of a Single Lentiviral Vector Containing Tetracycline-Inducible Alb-uPA for Transduction of uPA Expression in Murine Hepatocytes
    Article Snippet: The T vector containing 2399 bp fragment and the pTet-On Advanced Vector plasmid were respectively digested by Cla I and BamH I restriction enzyme (New England Bio Labs, Mass, USA). .. The generated plasmid was termed as CN360.

    Article Title: Unusual pungency from extra-virgin olive oil is due to restricted spatial expression of oleocanthal's receptor
    Article Snippet: A double cysteine mutant of mouse TRPA1 (C422S/C622S) was generated by cysteine-serine substitutions at C422 and C622, residues which are thought to be covalently modified by several electrophilic agonists, in the N terminal domain. .. Briefly, PCR was performed using two residues of mouse TRPA1 expression vector divided at the Cla I (New England Biolabs, Beverly, MA) site as templates (the former for C422S, the latter for C622S), two synthetic oligonucleotide primers containing specific mutations (C422S-S and AS, 5’-CATTATGCCTCTAGGCAGGGG-3’ and 5’-CCCCTGCCTAGAGGCATAATG-3’, C622S-S and AS, 5’-CCCGAGTCCATGAAAGTTCTT-3’ and 5’-AAGAACTTTCATGGACTCGGG-3’), and primestar™ HS DNA polymerase (TAKARA, Kusatsu, Japan).

    Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes
    Article Snippet: For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Cla I (New England Biolabs, Ipswich, MA) that cleave within the probe region of the YCD gene of the iPSYCD cells and randomly within the genomic DNA to produce fragments that were detectable by the 473 bp probe binding within the YCD gene. .. The 473 bp YCD -probe was generated via PCR amplification from 10 pg vector plasmid DNA using a forward primer with the sequence ATGGTGACAGGGGGAATG and a reverse primer with the sequence CAATATCTTCAAACCAATCCTG followed by gel-purification.

    DNA Labeling:

    Article Title: A Natural Mutation Involving both Pathogenicity and Perithecium Formation in the Fusarium graminearum Species Complex
    Article Snippet: Genomic DNA digested with Cla I (New England Biolabs, Beverly, MA) was subjected to agarose gel electrophoresis together with DNA Molecular Weight Marker III, DIG-labeled (Roche Diagnostics), and transferred to a nylon membrane. .. The signal was detected by using DIG High Prime DNA Labeling and Detection Starter Kit I, according to the manufacturer’s instructions.

    Sequencing:

    Article Title: Construction of a Single Lentiviral Vector Containing Tetracycline-Inducible Alb-uPA for Transduction of uPA Expression in Murine Hepatocytes
    Article Snippet: Construction of CN360 and CN361 Lentiviral Plasmid The coding sequence rtTA2S -M2 was excised from the pTet-On Advanced Vector plasmid (SunBio Shanghai, China). .. The T vector containing 2399 bp fragment and the pTet-On Advanced Vector plasmid were respectively digested by Cla I and BamH I restriction enzyme (New England Bio Labs, Mass, USA).

    Article Title: Biochemical reconstitution of abasic DNA lesion replication in Xenopus extracts
    Article Snippet: For the determination of nucleotides on replicated DNA that still carried the AP lesion, the DNA (after 75 min of incubation in NPE) was digested with DpnI, ClaI and APE (NEB, MA, USA), purified by Qiagen column, and re-digested with KpnI. .. The DNA was isolated from the transformants and analyzed by restriction enzyme digestion and sequencing.

    Article Title: The Genome of Melanoplus sanguinipes Entomopoxvirus
    Article Snippet: MsEPV genome organization was confirmed by comparing observed Bam HI, Hin dIII, and Sca I restriction fragments to the consensus sequence data. .. Right and left ends of the genome were confirmed by using Alu I, Bgl II, Cla I, Nhe I, Pml I, and Sau 3AI restriction digests (New England Biolabs).

    Article Title: Global structure and mechanical properties of a 10-bp nucleosome positioning motif
    Article Snippet: This is followed in the 156-bp B-DNA molecule by (91)CGAAT TCTAGACCTAGGTGGATGACTCATTTTTTT TTGCTCGAGCTACAACGTGCTGCCATGGAAT(156) and, in the variable phasing linker sequences, by 12_156 CGAAT TATAAACGCCTATAAACGCCTATAAACGCC TTGCTCGA GCTACAACGTGCTGCCATGGAAT 16_156 CGAAT TTGC TATAAACGCCTATAAACGCCTATAAACGCC TCGA GCTACAACGTGCTGCCATGGAAT 20_156 CGAAT TTGCTCGA TATAAACGCCTATAAACGCCTATAAACGCC GCTACAACGTGCTGCCATGGAAT in which the 30-bp segment is indicated in boldface, and the sequence elements that differ in the phasing linkers are underlined. .. Cyclization substrates were prepared by PCR amplification in the presence of [α-32 P]dATP, purified by using the Qiagen (Chatsworth, CA) PCR purification kit, and digested at 37°C overnight with 2.5 units of Cla I (New England Biolabs) per 100 μl.

    Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes
    Article Snippet: For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Cla I (New England Biolabs, Ipswich, MA) that cleave within the probe region of the YCD gene of the iPSYCD cells and randomly within the genomic DNA to produce fragments that were detectable by the 473 bp probe binding within the YCD gene. .. The 473 bp YCD -probe was generated via PCR amplification from 10 pg vector plasmid DNA using a forward primer with the sequence ATGGTGACAGGGGGAATG and a reverse primer with the sequence CAATATCTTCAAACCAATCCTG followed by gel-purification.

    Injection:

    Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes
    Article Snippet: When tumors reached an average of 0.2 cm3 , three mice each from both the iPSGFP - and iPSYCD -injected groups were administered 500 mg/kg/day for 10 consecutive days. .. For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Cla I (New England Biolabs, Ipswich, MA) that cleave within the probe region of the YCD gene of the iPSYCD cells and randomly within the genomic DNA to produce fragments that were detectable by the 473 bp probe binding within the YCD gene.

    Binding Assay:

    Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes
    Article Snippet: .. For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Cla I (New England Biolabs, Ipswich, MA) that cleave within the probe region of the YCD gene of the iPSYCD cells and randomly within the genomic DNA to produce fragments that were detectable by the 473 bp probe binding within the YCD gene. .. Plasmid encoding the YCD- containing lentiviral vector was used as positive control and DNA from iPSGFP cells was used as negative control.

    Molecular Weight:

    Article Title: A Natural Mutation Involving both Pathogenicity and Perithecium Formation in the Fusarium graminearum Species Complex
    Article Snippet: .. Genomic DNA digested with Cla I (New England Biolabs, Beverly, MA) was subjected to agarose gel electrophoresis together with DNA Molecular Weight Marker III, DIG-labeled (Roche Diagnostics), and transferred to a nylon membrane. .. The signal was detected by using DIG High Prime DNA Labeling and Detection Starter Kit I, according to the manufacturer’s instructions.

    DNA Extraction:

    Article Title: The Genome of Melanoplus sanguinipes Entomopoxvirus
    Article Snippet: Paragraph title: MsEPV DNA isolation and cloning. ... Right and left ends of the genome were confirmed by using Alu I, Bgl II, Cla I, Nhe I, Pml I, and Sau 3AI restriction digests (New England Biolabs).

    Radioactivity:

    Article Title: Global structure and mechanical properties of a 10-bp nucleosome positioning motif
    Article Snippet: Cyclization substrates were prepared by PCR amplification in the presence of [α-32 P]dATP, purified by using the Qiagen (Chatsworth, CA) PCR purification kit, and digested at 37°C overnight with 2.5 units of Cla I (New England Biolabs) per 100 μl. .. After purification on nondenaturing 10% polyacrylamide gels and electroelution, the radioactivity was monitored by scintillation counting and the concentration was determined by UV absorbance.

    Mutagenesis:

    Article Title: Unusual pungency from extra-virgin olive oil is due to restricted spatial expression of oleocanthal's receptor
    Article Snippet: Paragraph title: Method for mutagenesis ... Briefly, PCR was performed using two residues of mouse TRPA1 expression vector divided at the Cla I (New England Biolabs, Beverly, MA) site as templates (the former for C422S, the latter for C622S), two synthetic oligonucleotide primers containing specific mutations (C422S-S and AS, 5’-CATTATGCCTCTAGGCAGGGG-3’ and 5’-CCCCTGCCTAGAGGCATAATG-3’, C622S-S and AS, 5’-CCCGAGTCCATGAAAGTTCTT-3’ and 5’-AAGAACTTTCATGGACTCGGG-3’), and primestar™ HS DNA polymerase (TAKARA, Kusatsu, Japan).

    Isolation:

    Article Title: Biochemical reconstitution of abasic DNA lesion replication in Xenopus extracts
    Article Snippet: The plasmids from the transformants were isolated and the AP lesion region was sequenced to determine the nucleotides inserted opposite AP. .. For the determination of nucleotides on replicated DNA that still carried the AP lesion, the DNA (after 75 min of incubation in NPE) was digested with DpnI, ClaI and APE (NEB, MA, USA), purified by Qiagen column, and re-digested with KpnI.

    Article Title: Vpma phase variation is important for survival and persistence of Mycoplasma agalactiae in the immunocompetent host
    Article Snippet: .. Confirming xer1 disruption via Southern blot analyses Mycoplasma genomic DNA was isolated by QIAamp DNA Mini Kit (Qiagen) and digested with Cla I (New England Biolabs) at 37°C for at least 6–7 h before subjecting to electrophoresis on a 1% agarose gel. .. This was followed by standard Southern blotting procedures and hybridization using Digoxigenin (DIG)-labelling system (Roche) as described previously [ ].

    Article Title: Identification and Characterization of Leuconostoc carnosum, Associated with Production and Spoilage of Vacuum-Packaged, Sliced, Cooked Ham
    Article Snippet: Paragraph title: In vitro isolation of DNA and ribotyping for species identification. ... Reference strains and the five randomly selected industrial isolates, already known to possess similar Eco RI and Hin dIII ribotypes, were characterized with Cla I, Eco RI, and Hin dIII (New England BioLabs, Beverly, Mass.).

    Article Title: Characterization of Leuconostoc gasicomitatum sp. nov., Associated with Spoiled Raw Tomato-Marinated Broiler Meat Strips Packaged under Modified-Atmosphere Conditions
    Article Snippet: Paragraph title: Isolation of DNA, REA, and 16 and 23S rDNA RFLP (ribotyping). ... Cla I, Eco RI, and Hin dIII restriction enzymes (New England Biolabs, Beverly, Mass.) were used for ribotyping.

    Functional Assay:

    Article Title: Initiation of DNA repair mediated by a stalled RNA polymerase IIO
    Article Snippet: Cax-Pt was then cut by Cla I (New England Biolabs) in a reaction volume of 40 ml. .. Functional protein-binding studies are carried out as described previously ( ) by omission of the factor interest in the subsequent dual incision reaction, with the equivalent of one dual incision reaction volume.

    Labeling:

    Article Title: A Natural Mutation Involving both Pathogenicity and Perithecium Formation in the Fusarium graminearum Species Complex
    Article Snippet: A 186 bp-DNA fragment amplified from the Fg0407011 genome by PCR using primer pair HS601/HS602 was labeled with digoxigenin (DIG) by using a PCR DIG Probe Synthesis Kit (Roche Diagnostics). .. Genomic DNA digested with Cla I (New England Biolabs, Beverly, MA) was subjected to agarose gel electrophoresis together with DNA Molecular Weight Marker III, DIG-labeled (Roche Diagnostics), and transferred to a nylon membrane.

    Purification:

    Article Title: Biochemical reconstitution of abasic DNA lesion replication in Xenopus extracts
    Article Snippet: .. For the determination of nucleotides on replicated DNA that still carried the AP lesion, the DNA (after 75 min of incubation in NPE) was digested with DpnI, ClaI and APE (NEB, MA, USA), purified by Qiagen column, and re-digested with KpnI. .. This DNA was then used as template for PCR with two primers (5′ AGCGAGG AAGCGGAAGAGC 3′ and 5′ TGGTTGCCGCCACT TCACC 3′) that bracket the ClaI and KpnI sites.

    Article Title: Initiation of DNA repair mediated by a stalled RNA polymerase IIO
    Article Snippet: Cax-Pt was then cut by Cla I (New England Biolabs) in a reaction volume of 40 ml. .. The transcribed and Cla I-cut immobilized Cax-Pt is washed again in transcription buffer 400 and 50, before incubation with either purified NER factors or XPC-WCE under dual incision assay condition for 30 min at 30°C.

    Article Title: Global structure and mechanical properties of a 10-bp nucleosome positioning motif
    Article Snippet: .. Cyclization substrates were prepared by PCR amplification in the presence of [α-32 P]dATP, purified by using the Qiagen (Chatsworth, CA) PCR purification kit, and digested at 37°C overnight with 2.5 units of Cla I (New England Biolabs) per 100 μl. .. After purification on nondenaturing 10% polyacrylamide gels and electroelution, the radioactivity was monitored by scintillation counting and the concentration was determined by UV absorbance.

    Article Title: Development of Translating Ribosome Affinity Purification for Zebrafish
    Article Snippet: .. The 668 bp amplicon was digested with EcoRI and ClaI restriction endonucleases (New England Biolabs, Ipswich, MA) and gel purified (Qiagen, Verlo, NL). .. Vector s296 containing the murine EGFP- Rpl10a fusion was digested with AgeI and EcoRI restriction endonucleases.

    Article Title: Vpma phase variation is important for survival and persistence of Mycoplasma agalactiae in the immunocompetent host
    Article Snippet: Confirming xer1 disruption via Southern blot analyses Mycoplasma genomic DNA was isolated by QIAamp DNA Mini Kit (Qiagen) and digested with Cla I (New England Biolabs) at 37°C for at least 6–7 h before subjecting to electrophoresis on a 1% agarose gel. .. A DIG-labelled probe corresponding to a 513 bp partial xer1 fragment was prepared by PCR amplification of genomic DNA of type strain PG2 using primers XerR and XerS in presence of 2.5 mM MgCl2 using 30 cycles of 95°C for 43 s, 56°C for 43 s and 72°C for 43 s. After purification with the QIAquick PCR Purification Kit (Qiagen), hybridization and subsequent chemiluminescent detection of the DIG-labelled nucleic acids using Anti-DIG -AP was carried out according to the manufacturer’s instructions (Roche).

    Article Title: A Natural Mutation Involving both Pathogenicity and Perithecium Formation in the Fusarium graminearum Species Complex
    Article Snippet: The probe was used after purification by Mini Quick Spin DNA Columns (Roche Diagnostics). .. Genomic DNA digested with Cla I (New England Biolabs, Beverly, MA) was subjected to agarose gel electrophoresis together with DNA Molecular Weight Marker III, DIG-labeled (Roche Diagnostics), and transferred to a nylon membrane.

    Polymerase Chain Reaction:

    Article Title: Construction of a Single Lentiviral Vector Containing Tetracycline-Inducible Alb-uPA for Transduction of uPA Expression in Murine Hepatocytes
    Article Snippet: PCR conditions were 5 minutes at 94°C, 30 cycles of 10 seconds at 98°C, 15 seconds at 55°C and 2.5 minutes at 72°C, and a final 10-minute extension at 72°C. .. The T vector containing 2399 bp fragment and the pTet-On Advanced Vector plasmid were respectively digested by Cla I and BamH I restriction enzyme (New England Bio Labs, Mass, USA).

    Article Title: Biochemical reconstitution of abasic DNA lesion replication in Xenopus extracts
    Article Snippet: For the determination of nucleotides on replicated DNA that still carried the AP lesion, the DNA (after 75 min of incubation in NPE) was digested with DpnI, ClaI and APE (NEB, MA, USA), purified by Qiagen column, and re-digested with KpnI. .. This DNA was then used as template for PCR with two primers (5′ AGCGAGG AAGCGGAAGAGC 3′ and 5′ TGGTTGCCGCCACT TCACC 3′) that bracket the ClaI and KpnI sites.

    Article Title: Differences in virulence of pneumolysin and autolysin mutants constructed by insertion duplication mutagenesis and in-frame deletion in Streptococcus pneumoniae
    Article Snippet: Paragraph title: Validation of TGR from the results of previous PCR assay of IDM mutants by using real-time PCR assay, southern blot hybridization and western blotting ... Kit (Qiagen, Hilden, Germany) and were then digested by Cla I (New England Biolabs, Ipswich, MA, USA) according to the manufactures’ instruction.

    Article Title: Global structure and mechanical properties of a 10-bp nucleosome positioning motif
    Article Snippet: .. Cyclization substrates were prepared by PCR amplification in the presence of [α-32 P]dATP, purified by using the Qiagen (Chatsworth, CA) PCR purification kit, and digested at 37°C overnight with 2.5 units of Cla I (New England Biolabs) per 100 μl. .. After purification on nondenaturing 10% polyacrylamide gels and electroelution, the radioactivity was monitored by scintillation counting and the concentration was determined by UV absorbance.

    Article Title: Unusual pungency from extra-virgin olive oil is due to restricted spatial expression of oleocanthal's receptor
    Article Snippet: .. Briefly, PCR was performed using two residues of mouse TRPA1 expression vector divided at the Cla I (New England Biolabs, Beverly, MA) site as templates (the former for C422S, the latter for C622S), two synthetic oligonucleotide primers containing specific mutations (C422S-S and AS, 5’-CATTATGCCTCTAGGCAGGGG-3’ and 5’-CCCCTGCCTAGAGGCATAATG-3’, C622S-S and AS, 5’-CCCGAGTCCATGAAAGTTCTT-3’ and 5’-AAGAACTTTCATGGACTCGGG-3’), and primestar™ HS DNA polymerase (TAKARA, Kusatsu, Japan). .. The PCR products were digested with Dpn I (New England BioLabs, Beverly, MA) at 37 °C for one hour, and transformed into DH5a competent cells.

    Article Title: Vpma phase variation is important for survival and persistence of Mycoplasma agalactiae in the immunocompetent host
    Article Snippet: Confirming xer1 disruption via Southern blot analyses Mycoplasma genomic DNA was isolated by QIAamp DNA Mini Kit (Qiagen) and digested with Cla I (New England Biolabs) at 37°C for at least 6–7 h before subjecting to electrophoresis on a 1% agarose gel. .. A DIG-labelled probe corresponding to a 513 bp partial xer1 fragment was prepared by PCR amplification of genomic DNA of type strain PG2 using primers XerR and XerS in presence of 2.5 mM MgCl2 using 30 cycles of 95°C for 43 s, 56°C for 43 s and 72°C for 43 s. After purification with the QIAquick PCR Purification Kit (Qiagen), hybridization and subsequent chemiluminescent detection of the DIG-labelled nucleic acids using Anti-DIG -AP was carried out according to the manufacturer’s instructions (Roche).

    Article Title: A Natural Mutation Involving both Pathogenicity and Perithecium Formation in the Fusarium graminearum Species Complex
    Article Snippet: A 186 bp-DNA fragment amplified from the Fg0407011 genome by PCR using primer pair HS601/HS602 was labeled with digoxigenin (DIG) by using a PCR DIG Probe Synthesis Kit (Roche Diagnostics). .. Genomic DNA digested with Cla I (New England Biolabs, Beverly, MA) was subjected to agarose gel electrophoresis together with DNA Molecular Weight Marker III, DIG-labeled (Roche Diagnostics), and transferred to a nylon membrane.

    Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes
    Article Snippet: For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Cla I (New England Biolabs, Ipswich, MA) that cleave within the probe region of the YCD gene of the iPSYCD cells and randomly within the genomic DNA to produce fragments that were detectable by the 473 bp probe binding within the YCD gene. .. The 473 bp YCD -probe was generated via PCR amplification from 10 pg vector plasmid DNA using a forward primer with the sequence ATGGTGACAGGGGGAATG and a reverse primer with the sequence CAATATCTTCAAACCAATCCTG followed by gel-purification.

    Lysis:

    Article Title: Transduction of human embryonic stem cells by ecotropic retroviral vectors
    Article Snippet: Southern blot analysis Genomic DNA was extracted from cells by lysis with SDS and proteinase K digestion followed by isopropanol precipitation. .. DNA was digested overnight using EcoRI and ClaI (both NEB) restriction enzymes and separated on an agarose gel.

    cDNA Library Assay:

    Article Title: Development of Translating Ribosome Affinity Purification for Zebrafish
    Article Snippet: Zebrafish rpl10a was amplified from a cDNA library with primers 5′ RPL10A Link: CGTTCGAATTCAGCAAGG TCTCGAGAGACACG and 3′ RPL10A ClaI: GCATCGATCC TAGTAGAGGCGCTGTGGTT using Phusion High Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA). .. The 668 bp amplicon was digested with EcoRI and ClaI restriction endonucleases (New England Biolabs, Ipswich, MA) and gel purified (Qiagen, Verlo, NL).

    Mouse Assay:

    Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes
    Article Snippet: All experiments using mice received approval from the Institutional Animal Care and Use Committee at the Fred Hutchinson Cancer Research Center. .. For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Cla I (New England Biolabs, Ipswich, MA) that cleave within the probe region of the YCD gene of the iPSYCD cells and randomly within the genomic DNA to produce fragments that were detectable by the 473 bp probe binding within the YCD gene.

    Plasmid Preparation:

    Article Title: Construction of a Single Lentiviral Vector Containing Tetracycline-Inducible Alb-uPA for Transduction of uPA Expression in Murine Hepatocytes
    Article Snippet: .. The T vector containing 2399 bp fragment and the pTet-On Advanced Vector plasmid were respectively digested by Cla I and BamH I restriction enzyme (New England Bio Labs, Mass, USA). .. The resulted fragments were separated by 1.0% agarose gel electrophoresis and retrieved by DNA retrieve KIT (Tiangen, China).

    Article Title: Designer diatom episomes delivered by bacterial conjugation
    Article Snippet: Paragraph title: Plasmid-safe experiments ... First, ClaI restriction digest or mock reaction was performed on samples using 1–2 μg total DNA in a 100-μl total reaction with 1 × CutSmart buffer and ClaI (NEB) or water in digested or mock-digested samples, respectively.

    Article Title: Unusual pungency from extra-virgin olive oil is due to restricted spatial expression of oleocanthal's receptor
    Article Snippet: .. Briefly, PCR was performed using two residues of mouse TRPA1 expression vector divided at the Cla I (New England Biolabs, Beverly, MA) site as templates (the former for C422S, the latter for C622S), two synthetic oligonucleotide primers containing specific mutations (C422S-S and AS, 5’-CATTATGCCTCTAGGCAGGGG-3’ and 5’-CCCCTGCCTAGAGGCATAATG-3’, C622S-S and AS, 5’-CCCGAGTCCATGAAAGTTCTT-3’ and 5’-AAGAACTTTCATGGACTCGGG-3’), and primestar™ HS DNA polymerase (TAKARA, Kusatsu, Japan). .. The PCR products were digested with Dpn I (New England BioLabs, Beverly, MA) at 37 °C for one hour, and transformed into DH5a competent cells.

    Article Title: Development of Translating Ribosome Affinity Purification for Zebrafish
    Article Snippet: Paragraph title: Zebrafish TRAP Plasmid Construction ... The 668 bp amplicon was digested with EcoRI and ClaI restriction endonucleases (New England Biolabs, Ipswich, MA) and gel purified (Qiagen, Verlo, NL).

    Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes
    Article Snippet: For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Cla I (New England Biolabs, Ipswich, MA) that cleave within the probe region of the YCD gene of the iPSYCD cells and randomly within the genomic DNA to produce fragments that were detectable by the 473 bp probe binding within the YCD gene. .. Plasmid encoding the YCD- containing lentiviral vector was used as positive control and DNA from iPSGFP cells was used as negative control.

    Software:

    Article Title: Transduction of human embryonic stem cells by ecotropic retroviral vectors
    Article Snippet: DNA was digested overnight using EcoRI and ClaI (both NEB) restriction enzymes and separated on an agarose gel. .. After exposure to X-ray film bands were quantified using the AIDA software (Raytest).

    Article Title: The Genome of Melanoplus sanguinipes Entomopoxvirus
    Article Snippet: The sequences were assembled with Phrap software , using the quality files and default settings to produce a consensus sequence. .. Right and left ends of the genome were confirmed by using Alu I, Bgl II, Cla I, Nhe I, Pml I, and Sau 3AI restriction digests (New England Biolabs).

    Hybridization:

    Article Title: Differences in virulence of pneumolysin and autolysin mutants constructed by insertion duplication mutagenesis and in-frame deletion in Streptococcus pneumoniae
    Article Snippet: Paragraph title: Validation of TGR from the results of previous PCR assay of IDM mutants by using real-time PCR assay, southern blot hybridization and western blotting ... Kit (Qiagen, Hilden, Germany) and were then digested by Cla I (New England Biolabs, Ipswich, MA, USA) according to the manufactures’ instruction.

    Article Title: Vpma phase variation is important for survival and persistence of Mycoplasma agalactiae in the immunocompetent host
    Article Snippet: Confirming xer1 disruption via Southern blot analyses Mycoplasma genomic DNA was isolated by QIAamp DNA Mini Kit (Qiagen) and digested with Cla I (New England Biolabs) at 37°C for at least 6–7 h before subjecting to electrophoresis on a 1% agarose gel. .. This was followed by standard Southern blotting procedures and hybridization using Digoxigenin (DIG)-labelling system (Roche) as described previously [ ].

    Article Title: A Natural Mutation Involving both Pathogenicity and Perithecium Formation in the Fusarium graminearum Species Complex
    Article Snippet: Paragraph title: Southern blot hybridization ... Genomic DNA digested with Cla I (New England Biolabs, Beverly, MA) was subjected to agarose gel electrophoresis together with DNA Molecular Weight Marker III, DIG-labeled (Roche Diagnostics), and transferred to a nylon membrane.

    Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes
    Article Snippet: For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Cla I (New England Biolabs, Ipswich, MA) that cleave within the probe region of the YCD gene of the iPSYCD cells and randomly within the genomic DNA to produce fragments that were detectable by the 473 bp probe binding within the YCD gene. .. Following digestion, ~10 µg DNA was electrophoresed, transferred to a Hybond-N+ membrane (GE Healthcare, Waukesha, WI), and hybridized using QuickHyb hybridization solution (Stratagene, La Jolla, CA) following the manufacturers' recommendations.

    Electrophoresis:

    Article Title: Vpma phase variation is important for survival and persistence of Mycoplasma agalactiae in the immunocompetent host
    Article Snippet: .. Confirming xer1 disruption via Southern blot analyses Mycoplasma genomic DNA was isolated by QIAamp DNA Mini Kit (Qiagen) and digested with Cla I (New England Biolabs) at 37°C for at least 6–7 h before subjecting to electrophoresis on a 1% agarose gel. .. This was followed by standard Southern blotting procedures and hybridization using Digoxigenin (DIG)-labelling system (Roche) as described previously [ ].

    Negative Control:

    Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes
    Article Snippet: For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Cla I (New England Biolabs, Ipswich, MA) that cleave within the probe region of the YCD gene of the iPSYCD cells and randomly within the genomic DNA to produce fragments that were detectable by the 473 bp probe binding within the YCD gene. .. Plasmid encoding the YCD- containing lentiviral vector was used as positive control and DNA from iPSGFP cells was used as negative control.

    Agarose Gel Electrophoresis:

    Article Title: Transduction of human embryonic stem cells by ecotropic retroviral vectors
    Article Snippet: .. DNA was digested overnight using EcoRI and ClaI (both NEB) restriction enzymes and separated on an agarose gel. ..

    Article Title: Construction of a Single Lentiviral Vector Containing Tetracycline-Inducible Alb-uPA for Transduction of uPA Expression in Murine Hepatocytes
    Article Snippet: The T vector containing 2399 bp fragment and the pTet-On Advanced Vector plasmid were respectively digested by Cla I and BamH I restriction enzyme (New England Bio Labs, Mass, USA). .. The T vector containing 2399 bp fragment and the pTet-On Advanced Vector plasmid were respectively digested by Cla I and BamH I restriction enzyme (New England Bio Labs, Mass, USA).

    Article Title: Biochemical reconstitution of abasic DNA lesion replication in Xenopus extracts
    Article Snippet: Half of the DNA was analyzed by TAE agarose gel electrophoresis and the remaining DNA was introduced into Maxi Efficiency DH5α (Invitrogen, CA, USA) by transformation. .. For the determination of nucleotides on replicated DNA that still carried the AP lesion, the DNA (after 75 min of incubation in NPE) was digested with DpnI, ClaI and APE (NEB, MA, USA), purified by Qiagen column, and re-digested with KpnI.

    Article Title: Vpma phase variation is important for survival and persistence of Mycoplasma agalactiae in the immunocompetent host
    Article Snippet: .. Confirming xer1 disruption via Southern blot analyses Mycoplasma genomic DNA was isolated by QIAamp DNA Mini Kit (Qiagen) and digested with Cla I (New England Biolabs) at 37°C for at least 6–7 h before subjecting to electrophoresis on a 1% agarose gel. .. This was followed by standard Southern blotting procedures and hybridization using Digoxigenin (DIG)-labelling system (Roche) as described previously [ ].

    Article Title: A Natural Mutation Involving both Pathogenicity and Perithecium Formation in the Fusarium graminearum Species Complex
    Article Snippet: .. Genomic DNA digested with Cla I (New England Biolabs, Beverly, MA) was subjected to agarose gel electrophoresis together with DNA Molecular Weight Marker III, DIG-labeled (Roche Diagnostics), and transferred to a nylon membrane. .. The signal was detected by using DIG High Prime DNA Labeling and Detection Starter Kit I, according to the manufacturer’s instructions.

    In Vitro:

    Article Title: Identification and Characterization of Leuconostoc carnosum, Associated with Production and Spoilage of Vacuum-Packaged, Sliced, Cooked Ham
    Article Snippet: Paragraph title: In vitro isolation of DNA and ribotyping for species identification. ... Reference strains and the five randomly selected industrial isolates, already known to possess similar Eco RI and Hin dIII ribotypes, were characterized with Cla I, Eco RI, and Hin dIII (New England BioLabs, Beverly, Mass.).

    Protein Binding:

    Article Title: Initiation of DNA repair mediated by a stalled RNA polymerase IIO
    Article Snippet: Paragraph title: Protein binding studies on immobilized DNA ... Cax-Pt was then cut by Cla I (New England Biolabs) in a reaction volume of 40 ml.

    Produced:

    Article Title: The Genome of Melanoplus sanguinipes Entomopoxvirus
    Article Snippet: Chromatogram traces were base called with Phred software , which also produced a quality file containing a predicted probability of error at each base position. .. Right and left ends of the genome were confirmed by using Alu I, Bgl II, Cla I, Nhe I, Pml I, and Sau 3AI restriction digests (New England Biolabs).

    Concentration Assay:

    Article Title: Global structure and mechanical properties of a 10-bp nucleosome positioning motif
    Article Snippet: Cyclization substrates were prepared by PCR amplification in the presence of [α-32 P]dATP, purified by using the Qiagen (Chatsworth, CA) PCR purification kit, and digested at 37°C overnight with 2.5 units of Cla I (New England Biolabs) per 100 μl. .. After purification on nondenaturing 10% polyacrylamide gels and electroelution, the radioactivity was monitored by scintillation counting and the concentration was determined by UV absorbance.

    Alkaline Lysis:

    Article Title: Designer diatom episomes delivered by bacterial conjugation
    Article Snippet: Plasmid-safe experiments Plasmids from P. tricornutum lines containing the p0521s plasmid were extracted using the modified alkaline lysis extraction protocol described above. .. First, ClaI restriction digest or mock reaction was performed on samples using 1–2 μg total DNA in a 100-μl total reaction with 1 × CutSmart buffer and ClaI (NEB) or water in digested or mock-digested samples, respectively.

    Marker:

    Article Title: A Natural Mutation Involving both Pathogenicity and Perithecium Formation in the Fusarium graminearum Species Complex
    Article Snippet: .. Genomic DNA digested with Cla I (New England Biolabs, Beverly, MA) was subjected to agarose gel electrophoresis together with DNA Molecular Weight Marker III, DIG-labeled (Roche Diagnostics), and transferred to a nylon membrane. .. The signal was detected by using DIG High Prime DNA Labeling and Detection Starter Kit I, according to the manufacturer’s instructions.

    Staining:

    Article Title: Safeguarding Nonhuman Primate iPS Cells With Suicide Genes
    Article Snippet: Any detectable tumors were harvested 3 weeks after drug supplementation, measured, and characterized via hematoxalin and eosin stain as well as by immunohistochemistry and subsequent microscopic analysis (YCD antibody was purchased from GenWay, San Diego, CA). .. For Southern blot analysis, genomic DNA from iPS cells derived from a sorted and expanded single clone was digested with the restriction enzymes EcoN I and Cla I (New England Biolabs, Ipswich, MA) that cleave within the probe region of the YCD gene of the iPSYCD cells and randomly within the genomic DNA to produce fragments that were detectable by the 473 bp probe binding within the YCD gene.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs clai
    Clai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 47 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/clai/product/New England Biolabs
    Average 99 stars, based on 47 article reviews
    Price from $9.99 to $1999.99
    clai - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results