ecorv restriction endonuclease  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    EcoRV
    Description:
    EcoRV 20 000 units
    Catalog Number:
    r0195l
    Price:
    249
    Size:
    20 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs ecorv restriction endonuclease
    EcoRV
    EcoRV 20 000 units
    https://www.bioz.com/result/ecorv restriction endonuclease/product/New England Biolabs
    Average 90 stars, based on 677 article reviews
    Price from $9.99 to $1999.99
    ecorv restriction endonuclease - by Bioz Stars, 2020-04
    90/100 stars

    Images

    1) Product Images from "Solution parameters modulating DNA binding specificity of the restriction endonuclease EcoRV"

    Article Title: Solution parameters modulating DNA binding specificity of the restriction endonuclease EcoRV

    Journal: The FEBS journal

    doi: 10.1111/j.1742-4658.2011.08198.x

    pH dependence of the EcoRV specific-nonspecific free binding energy difference. The pH dependence of ln(K nsp-sp ) is shown for the range 5.5 to 8.0. Mixtures of EcoRV, the 310 bp specific site DNA fragment, and the nonspecific oligonucleotide competitor
    Figure Legend Snippet: pH dependence of the EcoRV specific-nonspecific free binding energy difference. The pH dependence of ln(K nsp-sp ) is shown for the range 5.5 to 8.0. Mixtures of EcoRV, the 310 bp specific site DNA fragment, and the nonspecific oligonucleotide competitor

    Techniques Used: Binding Assay

    Kinetics of the EcoRV-DNA complex formation. The kinetics of DNA-protein complex formation was measured using the self-cleavage assay at different conditions of pH: pH 6.3 (▲); pH 7.6 (■). The binding of the EcoRV proceeds in at least
    Figure Legend Snippet: Kinetics of the EcoRV-DNA complex formation. The kinetics of DNA-protein complex formation was measured using the self-cleavage assay at different conditions of pH: pH 6.3 (▲); pH 7.6 (■). The binding of the EcoRV proceeds in at least

    Techniques Used: Cleavage Assay, Binding Assay

    A direct comparison of EcoRV-DNA binding analyzed by the gel mobility shift assay and by the self-cleavage assay. (A ) A gel image is shown illustrating a direct comparison of the EcoRV-DNA binding by the gel mobility shift assay (left), and by the self-cleavage
    Figure Legend Snippet: A direct comparison of EcoRV-DNA binding analyzed by the gel mobility shift assay and by the self-cleavage assay. (A ) A gel image is shown illustrating a direct comparison of the EcoRV-DNA binding by the gel mobility shift assay (left), and by the self-cleavage

    Techniques Used: Binding Assay, Mobility Shift, Cleavage Assay

    Equilibrium competition between specific and nonspecific DNA sequences for the EcoRV binding. Mixtures of EcoRV, the 310 bp DNA fragment with a specific recognition site, and nonspecific oligonucleotide competitor were incubated at 20 °C overnight
    Figure Legend Snippet: Equilibrium competition between specific and nonspecific DNA sequences for the EcoRV binding. Mixtures of EcoRV, the 310 bp DNA fragment with a specific recognition site, and nonspecific oligonucleotide competitor were incubated at 20 °C overnight

    Techniques Used: Binding Assay, Incubation

    The dependence of the EcoRV specific-nonspecific binding free energy difference, ln(K nsp-sp ) in the units of kT, on solute osmolal concentration is shown for four neutral osmolytes. Mixtures of the specific site DNA fragment, nonspecific oligonucleotide,
    Figure Legend Snippet: The dependence of the EcoRV specific-nonspecific binding free energy difference, ln(K nsp-sp ) in the units of kT, on solute osmolal concentration is shown for four neutral osmolytes. Mixtures of the specific site DNA fragment, nonspecific oligonucleotide,

    Techniques Used: Binding Assay, Concentration Assay

    The pH dependence of Knsp-sp for EcoRV-DNA binding
    Figure Legend Snippet: The pH dependence of Knsp-sp for EcoRV-DNA binding

    Techniques Used: Binding Assay

    The dependence of the EcoRV specific-nonspecific binding free energy difference on triethylene glycol concentration is shown for different pH values. Mixtures of EcoRV, the 310 bp specific site DNA fragment, and the nonspecific oligonucleotide competitor
    Figure Legend Snippet: The dependence of the EcoRV specific-nonspecific binding free energy difference on triethylene glycol concentration is shown for different pH values. Mixtures of EcoRV, the 310 bp specific site DNA fragment, and the nonspecific oligonucleotide competitor

    Techniques Used: Binding Assay, Concentration Assay

    2) Product Images from "CRISPR/Cas9 Targets Chicken Embryonic Somatic Cells In Vitro and In Vivo and generates Phenotypic Abnormalities"

    Article Title: CRISPR/Cas9 Targets Chicken Embryonic Somatic Cells In Vitro and In Vivo and generates Phenotypic Abnormalities

    Journal: Scientific Reports

    doi: 10.1038/srep34524

    In vitro analysis of NHEJ and HDR genome modification (arrows) mediated by sgRNA-Cas9 system in chicken cell lines. ( a ) Frequency (%) of NHEJ mutation mediated by KIAA1279, Cdkn1b and Mbd3 -targeting sgRNA-Cas9 system in chicken DF-1 cells by PCR and T7E1 assay. 1kM- 1 kbp DNA ladder, M- 100 bp DNA ladder. ( b ) Frequency (%) of NHEJ mutation mediated by KIAA1279 and Cdkn1b -targeting sgRNA-CRISPR/Cas9 system in chicken lymphoma B DT40 cells by PCR and T7E1 assay. ( c ) Representative gel from DF-1 cells transfected with the RET-targeting sgRNA-Cas9 and the ssODN showing efficient integration of the HDR-based BamHI and EcoRV sequence. The frequency of HDR is represented in percentages. 1-No sgRNA, 2- MEN2B sgRNA #1 plus ssODN, 3- MEN2B sgRNA #1 and #2 plus ssODN and 4- MEN2A/HSCR sgRNA 1 plus ssODN. ( d ) Representative gel for single cell clones derived from DF-1 cells transfected with the RET-targeting sgRNA-Cas9 and the ssODN for the MEN2B and MEN2A/HSCR HDR modifications respectively. The table shows the ratio of the monoallelic and biallelic HDR-based mutations detected with single cell clones and the overall efficiency in percentage: N = 19 for MEN2B and N = 12 for MEN2A/HSCR.
    Figure Legend Snippet: In vitro analysis of NHEJ and HDR genome modification (arrows) mediated by sgRNA-Cas9 system in chicken cell lines. ( a ) Frequency (%) of NHEJ mutation mediated by KIAA1279, Cdkn1b and Mbd3 -targeting sgRNA-Cas9 system in chicken DF-1 cells by PCR and T7E1 assay. 1kM- 1 kbp DNA ladder, M- 100 bp DNA ladder. ( b ) Frequency (%) of NHEJ mutation mediated by KIAA1279 and Cdkn1b -targeting sgRNA-CRISPR/Cas9 system in chicken lymphoma B DT40 cells by PCR and T7E1 assay. ( c ) Representative gel from DF-1 cells transfected with the RET-targeting sgRNA-Cas9 and the ssODN showing efficient integration of the HDR-based BamHI and EcoRV sequence. The frequency of HDR is represented in percentages. 1-No sgRNA, 2- MEN2B sgRNA #1 plus ssODN, 3- MEN2B sgRNA #1 and #2 plus ssODN and 4- MEN2A/HSCR sgRNA 1 plus ssODN. ( d ) Representative gel for single cell clones derived from DF-1 cells transfected with the RET-targeting sgRNA-Cas9 and the ssODN for the MEN2B and MEN2A/HSCR HDR modifications respectively. The table shows the ratio of the monoallelic and biallelic HDR-based mutations detected with single cell clones and the overall efficiency in percentage: N = 19 for MEN2B and N = 12 for MEN2A/HSCR.

    Techniques Used: In Vitro, Non-Homologous End Joining, Modification, Mutagenesis, Polymerase Chain Reaction, CRISPR, Transfection, Sequencing, Clone Assay, Derivative Assay

    3) Product Images from "Flexible and scalable genotyping-by-sequencing strategies for population studies"

    Article Title: Flexible and scalable genotyping-by-sequencing strategies for population studies

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-15-979

    Effect of read count on marker dataset size and imputation. Fraction of shared post-filter, pre-imputation genetic markers and fraction of post-imputation shared genome with original sample for subsamplings of A) RsaI F 2 -44 and B) HincII F 2 -23. C) Imputed genomes for each subsample in RsaI F 2 -44 displayed in concentric rings. Sample read count declines from the outermost ring to the innermost. D) Imputed genomes for each subsample in HincII F 2 -23 displayed in concentric circles. Sample read count declines from the outermost ring to the innermost.
    Figure Legend Snippet: Effect of read count on marker dataset size and imputation. Fraction of shared post-filter, pre-imputation genetic markers and fraction of post-imputation shared genome with original sample for subsamplings of A) RsaI F 2 -44 and B) HincII F 2 -23. C) Imputed genomes for each subsample in RsaI F 2 -44 displayed in concentric rings. Sample read count declines from the outermost ring to the innermost. D) Imputed genomes for each subsample in HincII F 2 -23 displayed in concentric circles. Sample read count declines from the outermost ring to the innermost.

    Techniques Used: Marker

    Trait mapping for yellowy ( y1 ) and sugary ( su1 ) in an F 2 admixture population. A green line in the plots annotates the locations of both genes. Pre-imputation markers are shown in black and grey. Markers, post-imputation and error correction are shown in color. A) RsaI GBS dataset, su1 map. B) RsaI GBS dataset, y1 map. C) HincII GBS dataset, su1 map. D) RsaI GBS dataset, y1 map.
    Figure Legend Snippet: Trait mapping for yellowy ( y1 ) and sugary ( su1 ) in an F 2 admixture population. A green line in the plots annotates the locations of both genes. Pre-imputation markers are shown in black and grey. Markers, post-imputation and error correction are shown in color. A) RsaI GBS dataset, su1 map. B) RsaI GBS dataset, y1 map. C) HincII GBS dataset, su1 map. D) RsaI GBS dataset, y1 map.

    Techniques Used:

    Fraction of predicted sites covered in samples from a F 2 admixture population. Reads from each F 2 sample were aligned to predicted sites, then predicted sites were placed in 2 bp bins, with the fraction covered in each bin indicated by the heatmap. A) The RsaI dataset, aligned against total predicted sites. B) RsaI dataset, aligned against the subset of predicted sites with sequencing coverage in the original RsaI B73 GBS experiment. C) HincII dataset, aligned against total predicted sites. D) HincII dataset, aligned against predicted sites with at least one read coverage in the original HincII experiment. Sample order is given, left to right, in Additional file 5 : Table S1.
    Figure Legend Snippet: Fraction of predicted sites covered in samples from a F 2 admixture population. Reads from each F 2 sample were aligned to predicted sites, then predicted sites were placed in 2 bp bins, with the fraction covered in each bin indicated by the heatmap. A) The RsaI dataset, aligned against total predicted sites. B) RsaI dataset, aligned against the subset of predicted sites with sequencing coverage in the original RsaI B73 GBS experiment. C) HincII dataset, aligned against total predicted sites. D) HincII dataset, aligned against predicted sites with at least one read coverage in the original HincII experiment. Sample order is given, left to right, in Additional file 5 : Table S1.

    Techniques Used: Sequencing

    4) Product Images from "Wild-type p53 binds to MYC promoter G-quadruplex"

    Article Title: Wild-type p53 binds to MYC promoter G-quadruplex

    Journal: Bioscience Reports

    doi: 10.1042/BSR20160232

    Full-length wild-type p53 binds to MYC G-quadruplex more efficiently than its isolated C-terminal and central regions The role of p53 domains in MYC G-quadruplex binding was studied by EMSA. Oligonucleotides (1 pmol) Pu52 ( A ), Pu33 ( B ) and Pu22 ( C ) were incubated with wtp53 (lanes 2–5; 50, 100, 200, 400 ng), p53-320 (lanes 6–9; 25, 50, 100, 200 ng) or p53CD (lanes 10–13; 12.5, 25, 50, 100 ng) in the presence of 10 ng of non-specific competitor pBSK/EcoRV. Binding of full-length wtp53, central DBD and C-terminal construct of p53 to double-stranded oligonucleotides containing p53CON was studied by EMSA. Oligonucleotides (0.25 pmol) ( D ) P1-50, ( E ) P1-30 and ( F ) P1-22 were incubated with wtp53 (lanes 2–5; 12.5, 25, 50, 100 ng), p53-320 (lanes 6–9; 6, 12.5, 25, 50 ng) or p53CD (lanes 10–13; 3, 6, 12.5, 25 ng) in the presence of 2.5 ng of non-specific competitor pBSK/EcoRV.
    Figure Legend Snippet: Full-length wild-type p53 binds to MYC G-quadruplex more efficiently than its isolated C-terminal and central regions The role of p53 domains in MYC G-quadruplex binding was studied by EMSA. Oligonucleotides (1 pmol) Pu52 ( A ), Pu33 ( B ) and Pu22 ( C ) were incubated with wtp53 (lanes 2–5; 50, 100, 200, 400 ng), p53-320 (lanes 6–9; 25, 50, 100, 200 ng) or p53CD (lanes 10–13; 12.5, 25, 50, 100 ng) in the presence of 10 ng of non-specific competitor pBSK/EcoRV. Binding of full-length wtp53, central DBD and C-terminal construct of p53 to double-stranded oligonucleotides containing p53CON was studied by EMSA. Oligonucleotides (0.25 pmol) ( D ) P1-50, ( E ) P1-30 and ( F ) P1-22 were incubated with wtp53 (lanes 2–5; 12.5, 25, 50, 100 ng), p53-320 (lanes 6–9; 6, 12.5, 25, 50 ng) or p53CD (lanes 10–13; 3, 6, 12.5, 25 ng) in the presence of 2.5 ng of non-specific competitor pBSK/EcoRV.

    Techniques Used: Isolation, Binding Assay, Incubation, Construct

    Full-length wild-type p53 binding to the parallel G-quadruplex from MYC promoter NHE III 1 region is comparable with p53CON binding ( A ) Comparison of sequence-specific and MYC G-quadruplex Pu52 binding of p53 by EMSA. Oligonucelotides P1-50 (0.25 pmol, lanes 1–5), Pu52 (1 pmol, lanes 6–10) and A50 (0.25 pmol, lanes 11–15) were incubated with wtp53 protein (50, 100, 200, 400 ng/1 pmol of oligonucleotide) in the presence of 20 ng (per 1 pmol of oligonucleotide) of non-specific competitor pBSK/EcoRV. ( B ) CD spectra of Pu52 oligonucleotide measured in 5 mM Tris pH 7.6 (dotted line) and after addition of 10 mM KCl (dashed line) and 50 mM KCl respectively (solid line). ( C ) DMS footprinting of Pu52 oligonucleotide. Pu52 was annealed in 50 mM KCl without subsequent DMS treatment (lane 1), annealed in the absence of KCl and treated with DMS (lane 2) or annealed in 50 mM KCl and treated with DMS (lane 3). ( D ) Comparison of sequence-specific and MYC G-quadruplex Pu22 binding of p53 by EMSA. Oligonucelotides P1-22 (0.25 pmol, lanes 1–5), Pu22 (1 pmol, lanes 6–10) and A25 (0.25 pmol, lanes 11–15) were incubated with wtp53 protein (50, 100, 200, 400 ng/1 pmol of oligonucleotide) in the presence of 20 ng (per 1 pmol of oligonucleotide) of non-specific competitor pBSK/EcoRV. ( E ) CD spectra of Pu22 oligonucleotide measured in 5 mM Tris pH 7.6 (dotted line) and after addition of 10 mM KCl (dashed line) and 50 mM KCl respectively (solid line). ( F ) DMS footprinting of Pu22 oligonucleotide. Pu22 was annealed in 50 mM KCl without subsequent DMS treatment (lane 1), annealed in the absence of KCl and treated with DMS (lane 2) or annealed in 50 mM KCl and treated with DMS (lane 3).
    Figure Legend Snippet: Full-length wild-type p53 binding to the parallel G-quadruplex from MYC promoter NHE III 1 region is comparable with p53CON binding ( A ) Comparison of sequence-specific and MYC G-quadruplex Pu52 binding of p53 by EMSA. Oligonucelotides P1-50 (0.25 pmol, lanes 1–5), Pu52 (1 pmol, lanes 6–10) and A50 (0.25 pmol, lanes 11–15) were incubated with wtp53 protein (50, 100, 200, 400 ng/1 pmol of oligonucleotide) in the presence of 20 ng (per 1 pmol of oligonucleotide) of non-specific competitor pBSK/EcoRV. ( B ) CD spectra of Pu52 oligonucleotide measured in 5 mM Tris pH 7.6 (dotted line) and after addition of 10 mM KCl (dashed line) and 50 mM KCl respectively (solid line). ( C ) DMS footprinting of Pu52 oligonucleotide. Pu52 was annealed in 50 mM KCl without subsequent DMS treatment (lane 1), annealed in the absence of KCl and treated with DMS (lane 2) or annealed in 50 mM KCl and treated with DMS (lane 3). ( D ) Comparison of sequence-specific and MYC G-quadruplex Pu22 binding of p53 by EMSA. Oligonucelotides P1-22 (0.25 pmol, lanes 1–5), Pu22 (1 pmol, lanes 6–10) and A25 (0.25 pmol, lanes 11–15) were incubated with wtp53 protein (50, 100, 200, 400 ng/1 pmol of oligonucleotide) in the presence of 20 ng (per 1 pmol of oligonucleotide) of non-specific competitor pBSK/EcoRV. ( E ) CD spectra of Pu22 oligonucleotide measured in 5 mM Tris pH 7.6 (dotted line) and after addition of 10 mM KCl (dashed line) and 50 mM KCl respectively (solid line). ( F ) DMS footprinting of Pu22 oligonucleotide. Pu22 was annealed in 50 mM KCl without subsequent DMS treatment (lane 1), annealed in the absence of KCl and treated with DMS (lane 2) or annealed in 50 mM KCl and treated with DMS (lane 3).

    Techniques Used: Binding Assay, Sequencing, Incubation, Footprinting

    Wild-type p53 and C-terminal region of p53 bind G-quadruplex Pu52 with higher affinity than double-stranded Pu52/Py52 Binding of various p53 protein constructs to MYC promoter G-quadruplexes from was studied by EMSA. Oligonucleotides ( A ) P1-40 (0.5 pmol), ( B ) Pu52 (1 pmol) and ( C ) dsPu52/Py52 (0.5 pmol) were incubated with wtp53 (lanes 2–4; 25, 50, 100 ng/1 pmol of oligonucleotide), CΔ30 (lanes 5–7; 25, 50, 100 ng/1 pmol of oligonucleotide), p53CT (lanes 8–10; 50, 100, 200 ng/1 pmol of oligonucleotide), p53T (lanes 11–13; 50, 100, 200 ng/1 pmol of oligonucleotide) or p53CD (lanes 14 and 15; 100, 200 ng/1 pmol of oligonucleotide) in the presence of 20 ng (per 1 pmol of oligonucleotide) of non-specific competitor pBSK/EcoRV.
    Figure Legend Snippet: Wild-type p53 and C-terminal region of p53 bind G-quadruplex Pu52 with higher affinity than double-stranded Pu52/Py52 Binding of various p53 protein constructs to MYC promoter G-quadruplexes from was studied by EMSA. Oligonucleotides ( A ) P1-40 (0.5 pmol), ( B ) Pu52 (1 pmol) and ( C ) dsPu52/Py52 (0.5 pmol) were incubated with wtp53 (lanes 2–4; 25, 50, 100 ng/1 pmol of oligonucleotide), CΔ30 (lanes 5–7; 25, 50, 100 ng/1 pmol of oligonucleotide), p53CT (lanes 8–10; 50, 100, 200 ng/1 pmol of oligonucleotide), p53T (lanes 11–13; 50, 100, 200 ng/1 pmol of oligonucleotide) or p53CD (lanes 14 and 15; 100, 200 ng/1 pmol of oligonucleotide) in the presence of 20 ng (per 1 pmol of oligonucleotide) of non-specific competitor pBSK/EcoRV.

    Techniques Used: Binding Assay, Construct, Incubation

    5) Product Images from "Flexible and scalable genotyping-by-sequencing strategies for population studies"

    Article Title: Flexible and scalable genotyping-by-sequencing strategies for population studies

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-15-979

    Fraction of predicted sites covered in samples from a F 2 admixture population. Reads from each F 2 sample were aligned to predicted sites, then predicted sites were placed in 2 bp bins, with the fraction covered in each bin indicated by the heatmap. A) The RsaI dataset, aligned against total predicted sites. B) RsaI dataset, aligned against the subset of predicted sites with sequencing coverage in the original RsaI B73 GBS experiment. C) HincII dataset, aligned against total predicted sites. D) HincII dataset, aligned against predicted sites with at least one read coverage in the original HincII experiment. Sample order is given, left to right, in Additional file 5 : Table S1.
    Figure Legend Snippet: Fraction of predicted sites covered in samples from a F 2 admixture population. Reads from each F 2 sample were aligned to predicted sites, then predicted sites were placed in 2 bp bins, with the fraction covered in each bin indicated by the heatmap. A) The RsaI dataset, aligned against total predicted sites. B) RsaI dataset, aligned against the subset of predicted sites with sequencing coverage in the original RsaI B73 GBS experiment. C) HincII dataset, aligned against total predicted sites. D) HincII dataset, aligned against predicted sites with at least one read coverage in the original HincII experiment. Sample order is given, left to right, in Additional file 5 : Table S1.

    Techniques Used: Sequencing

    Related Articles

    Clone Assay:

    Article Title: Reconstruction of a replication-competent ancestral murine endogenous retrovirus-L
    Article Snippet: Briefly, gDNA was extracted from expanded single cell clones of CHO cells following transfection with a plasmid containing ancML and selected in G418. .. The gDNA was digested with EcoRV (New England Biolabs) and ligated to adaptors.

    Article Title: CRISPR/Cas9 Targets Chicken Embryonic Somatic Cells In Vitro and In Vivo and generates Phenotypic Abnormalities
    Article Snippet: For MEN2B HDR templates, the PCR products were digested in BamHI restriction enzyme (New England Biolabs, Ipswich, MA) and in EcoRV restriction enzyme (New England Biolabs, Ipswich, MA) for MEN2A/HSCR HDR experiments. .. Positive clones were cloned into the pGEM-T Easy vector (Promega, Madison, WI) and cloned products were sequenced.

    Amplification:

    Article Title: Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants
    Article Snippet: Paragraph title: Confirmation of transgenic plants through PCR amplification and southern blot analysis ... DNA from putative transgenic and UT plants was digested with EcoR V (NEB, UK).

    Article Title: Regulated Expression of the Beta2-Toxin Gene (cpb2) in Clostridium perfringens Type A Isolates from Horses with Gastrointestinal Diseases
    Article Snippet: A 318-bp digoxigenin (DIG)-labeled cpb2 -specific DNA probe was prepared by using a two-step PCR amplification method as previously described ( ). .. Isolated C. perfringens DNA samples, prepared as previously described ( , ), were digested with EcoRV or HpaI (New England Biolabs), separated by electrophoresis on 1% agarose gels, and Southern transferred.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Solution parameters modulating DNA binding specificity of the restriction endonuclease EcoRV
    Article Snippet: The purity of the double-stranded oligonucleotides was confirmed by polyacrylamide gel electrophoresis. .. DNA binding and cleavage experiments were performed with highly purified EcoRV restriction endonuclease (described below) or with commercial EcoRV sample purchased from New England Biolabs.

    Construct:

    Article Title: A dual-fluorescence reporter system for high-throughput clone characterization and selection by cell sorting
    Article Snippet: Library construction The SU66E20 bacterial artificial chromosome (BAC) from the sea urchin S.purpuratus was prepared using the Large Construct Plasmid Isolation kit (Qiagen). .. The pGRFP plasmid was cut with EcoRV (NEB), 5′ dephosphorylated with CIAP, and gel purified.

    Electrophoresis:

    Article Title: Significance of the Bacteriophage Treatment Schedule in Reducing Salmonella Colonization of Poultry
    Article Snippet: Bacteriophage DNA was obtained from lysates (1011 PFU/ml) as described previously ( ) and digested with the restriction enzymes EcoRI, EcoRV, and HindIII (New England BioLabs), according to the manufacturer's recommendations. .. Samples were analyzed by electrophoresis in 0.7% agarose gels and visualized by staining with ethidium bromide.

    Article Title: Integrative and Sequence Characteristics of a Novel Genetic Element, ICE6013, in Staphylococcus aureus
    Article Snippet: .. Genomic DNA was digested with EcoRV (New England Biolabs), and restriction fragments were separated by electrophoresis in 0.5% agarose. .. The fragments were blotted onto nylon membranes (Bio-Rad) by capillary transfer.

    Article Title: Regulated Expression of the Beta2-Toxin Gene (cpb2) in Clostridium perfringens Type A Isolates from Horses with Gastrointestinal Diseases
    Article Snippet: .. Isolated C. perfringens DNA samples, prepared as previously described ( , ), were digested with EcoRV or HpaI (New England Biolabs), separated by electrophoresis on 1% agarose gels, and Southern transferred. .. The blots were hybridized with the DIG-labeled cpb2 probe, which was then detected using a DIG chemiluminescence detection system utilizing CSPD [disodium 3-(4-methoxyspiro{1,2-dioxetane-3,2′-(5-chloro)tricyclo[3,3.1.13.7]decane}-4-yl)phenyl phosphate] ready-to-use substrate (Roche) as described earlier ( ).

    Incubation:

    Article Title: CRISPR/Cas9 Targets Chicken Embryonic Somatic Cells In Vitro and In Vivo and generates Phenotypic Abnormalities
    Article Snippet: Restriction Enzyme digestion (RFLP) Six μl of the PCR product was digested with 0.5 μl of the required restriction enzyme in a 20 μl reaction and incubated for 4–8 hrs at 37 °C. .. For MEN2B HDR templates, the PCR products were digested in BamHI restriction enzyme (New England Biolabs, Ipswich, MA) and in EcoRV restriction enzyme (New England Biolabs, Ipswich, MA) for MEN2A/HSCR HDR experiments.

    Over Expression:

    Article Title: Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants
    Article Snippet: Confirmation of transgenic plants through PCR amplification and southern blot analysis Genomic DNA extracted from the immature leaves of putative transgenic kenaf and untransformed (UT) plants, following the method described by , was amplified for hygromycin resistant gene and the coding region of AtGA20ox gene, as well as 35S promoter regions with the primer sets Hygro- (Forward) 5′TGCTGCTCCATACAAGCCAACA3′; Hygro (Reverse) 5′CGACAGCGTCTCCGACCTGAT3′; GA20ox-I (Forward) 5′GAGCCGCTTCTTTGATATGC3′; GA20oX-I (Reverse) 5′ATGGTCTTGGTGAAGGATGG3′; 35S (Forward) 5′GCTCCTACAAATGCCATCA3′; 35S (Reverse) 5′GATAGTGGGATTGTGCGTCA3′ to confirm the gene insertion and the presence of 35S promoter for the overexpression of the gene, respectively. .. DNA from putative transgenic and UT plants was digested with EcoR V (NEB, UK).

    Hybridization:

    Article Title: Integrative and Sequence Characteristics of a Novel Genetic Element, ICE6013, in Staphylococcus aureus
    Article Snippet: Genomic DNA was digested with EcoRV (New England Biolabs), and restriction fragments were separated by electrophoresis in 0.5% agarose. .. The digoxigenin (DIG)-labeling and detection system (Roche) was used for Southern hybridization and chemiluminescent detection.

    Transfection:

    Article Title: Reconstruction of a replication-competent ancestral murine endogenous retrovirus-L
    Article Snippet: Briefly, gDNA was extracted from expanded single cell clones of CHO cells following transfection with a plasmid containing ancML and selected in G418. .. The gDNA was digested with EcoRV (New England Biolabs) and ligated to adaptors.

    Sequencing:

    Article Title: Reconstruction of a replication-competent ancestral murine endogenous retrovirus-L
    Article Snippet: The gDNA was digested with EcoRV (New England Biolabs) and ligated to adaptors. .. Nested PCRs were performed using forward primers that were designed to anneal to the R region of the 3′LTR and the reverse primers to the adaptor sequence, thereby amplifying 3′ flanking sequences.

    Article Title: Isolation and characterization of HepP: a virulence-related Pseudomonas aeruginosa heparinase
    Article Snippet: PCR analysis was conducted using primers matching sequences 94-bp upstream and 179-bp downstream of the hepP sequence (zbdP- For3/hepP- Rev3, respectively) (Table , Additional file : Figure S3) and chromosomal DNA from PA14 and PA14ΔhepP as templates. .. Therefore, to further confirm the mutation of hepP in PA14ΔhepP , we performed restriction enzyme digestion on the PCR products with EcoR V (New England Biolabs).

    Article Title: Solution parameters modulating DNA binding specificity of the restriction endonuclease EcoRV
    Article Snippet: The specific sequence double-stranded oligonucleotide was additionally purified on a Protein Pak anion exchange column (Waters) using AKTA Purifier (GE Healthcare Life Sciences). .. DNA binding and cleavage experiments were performed with highly purified EcoRV restriction endonuclease (described below) or with commercial EcoRV sample purchased from New England Biolabs.

    Southern Blot:

    Article Title: Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants
    Article Snippet: Paragraph title: Confirmation of transgenic plants through PCR amplification and southern blot analysis ... DNA from putative transgenic and UT plants was digested with EcoR V (NEB, UK).

    Article Title: Integrative and Sequence Characteristics of a Novel Genetic Element, ICE6013, in Staphylococcus aureus
    Article Snippet: Paragraph title: Southern blotting. ... Genomic DNA was digested with EcoRV (New England Biolabs), and restriction fragments were separated by electrophoresis in 0.5% agarose.

    Article Title: Regulated Expression of the Beta2-Toxin Gene (cpb2) in Clostridium perfringens Type A Isolates from Horses with Gastrointestinal Diseases
    Article Snippet: Paragraph title: Restriction fragment length polymorphism (RFLP) and Southern blot analyses. ... Isolated C. perfringens DNA samples, prepared as previously described ( , ), were digested with EcoRV or HpaI (New England Biolabs), separated by electrophoresis on 1% agarose gels, and Southern transferred.

    Generated:

    Article Title: Integrative and Sequence Characteristics of a Novel Genetic Element, ICE6013, in Staphylococcus aureus
    Article Snippet: Genomic DNA was digested with EcoRV (New England Biolabs), and restriction fragments were separated by electrophoresis in 0.5% agarose. .. A DIG-labeled PCR probe, generated from strain HDG2 with primers O131 and O132 (see Table S1 in the supplemental material), was used to screen strains for the presence of ICE 6013 .

    Polymerase Chain Reaction:

    Article Title: Reconstruction of a replication-competent ancestral murine endogenous retrovirus-L
    Article Snippet: The gDNA was digested with EcoRV (New England Biolabs) and ligated to adaptors. .. Bands from second round PCR reactions were gel purified and inserted into pCR-Blunt II-TOPO using the Zero Blunt TOPO PCR cloning Kit (Life technologies) for sequencing.

    Article Title: Isolation and characterization of HepP: a virulence-related Pseudomonas aeruginosa heparinase
    Article Snippet: .. Therefore, to further confirm the mutation of hepP in PA14ΔhepP , we performed restriction enzyme digestion on the PCR products with EcoR V (New England Biolabs). ..

    Article Title: Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants
    Article Snippet: Paragraph title: Confirmation of transgenic plants through PCR amplification and southern blot analysis ... DNA from putative transgenic and UT plants was digested with EcoR V (NEB, UK).

    Article Title: Integrative and Sequence Characteristics of a Novel Genetic Element, ICE6013, in Staphylococcus aureus
    Article Snippet: Genomic DNA was digested with EcoRV (New England Biolabs), and restriction fragments were separated by electrophoresis in 0.5% agarose. .. A DIG-labeled PCR probe, generated from strain HDG2 with primers O131 and O132 (see Table S1 in the supplemental material), was used to screen strains for the presence of ICE 6013 .

    Article Title: CRISPR/Cas9 Targets Chicken Embryonic Somatic Cells In Vitro and In Vivo and generates Phenotypic Abnormalities
    Article Snippet: .. For MEN2B HDR templates, the PCR products were digested in BamHI restriction enzyme (New England Biolabs, Ipswich, MA) and in EcoRV restriction enzyme (New England Biolabs, Ipswich, MA) for MEN2A/HSCR HDR experiments. ..

    Article Title: Regulated Expression of the Beta2-Toxin Gene (cpb2) in Clostridium perfringens Type A Isolates from Horses with Gastrointestinal Diseases
    Article Snippet: A 318-bp digoxigenin (DIG)-labeled cpb2 -specific DNA probe was prepared by using a two-step PCR amplification method as previously described ( ). .. Isolated C. perfringens DNA samples, prepared as previously described ( , ), were digested with EcoRV or HpaI (New England Biolabs), separated by electrophoresis on 1% agarose gels, and Southern transferred.

    Sonication:

    Article Title: A dual-fluorescence reporter system for high-throughput clone characterization and selection by cell sorting
    Article Snippet: The template DNA was sonicated and end repaired with T4 DNA polymerase (Fermentas), Klenow fragment (Fermentas) and T4 polynucleotide kinase (Fermentas). .. The pGRFP plasmid was cut with EcoRV (NEB), 5′ dephosphorylated with CIAP, and gel purified.

    Binding Assay:

    Article Title: Solution parameters modulating DNA binding specificity of the restriction endonuclease EcoRV
    Article Snippet: .. DNA binding and cleavage experiments were performed with highly purified EcoRV restriction endonuclease (described below) or with commercial EcoRV sample purchased from New England Biolabs. .. Active protein concentrations of the EcoRV were determined by the direct titration with the specific site 310 bp DNA fragment under conditions of stoichiometric binding as described previously [ , ].

    Molecular Weight:

    Article Title: Structural diversity of supercoiled DNA
    Article Snippet: .. BbvCI, EcoRV, Nb.BbvCI, NdeI, Nuclease Bal-31, T4 DNA Ligase, low molecular weight DNA ladder and 100 bp DNA ladder were purchased from New England Biolabs (Ipswich, MA). .. Proteinase K was purchased from Roche Molecular Biochemicals (Mannheim, Germany).

    Mutagenesis:

    Article Title: Isolation and characterization of HepP: a virulence-related Pseudomonas aeruginosa heparinase
    Article Snippet: .. Therefore, to further confirm the mutation of hepP in PA14ΔhepP , we performed restriction enzyme digestion on the PCR products with EcoR V (New England Biolabs). ..

    Isolation:

    Article Title: Regulated Expression of the Beta2-Toxin Gene (cpb2) in Clostridium perfringens Type A Isolates from Horses with Gastrointestinal Diseases
    Article Snippet: .. Isolated C. perfringens DNA samples, prepared as previously described ( , ), were digested with EcoRV or HpaI (New England Biolabs), separated by electrophoresis on 1% agarose gels, and Southern transferred. .. The blots were hybridized with the DIG-labeled cpb2 probe, which was then detected using a DIG chemiluminescence detection system utilizing CSPD [disodium 3-(4-methoxyspiro{1,2-dioxetane-3,2′-(5-chloro)tricyclo[3,3.1.13.7]decane}-4-yl)phenyl phosphate] ready-to-use substrate (Roche) as described earlier ( ).

    Titration:

    Article Title: Solution parameters modulating DNA binding specificity of the restriction endonuclease EcoRV
    Article Snippet: DNA binding and cleavage experiments were performed with highly purified EcoRV restriction endonuclease (described below) or with commercial EcoRV sample purchased from New England Biolabs. .. Active protein concentrations of the EcoRV were determined by the direct titration with the specific site 310 bp DNA fragment under conditions of stoichiometric binding as described previously [ , ].

    Transgenic Assay:

    Article Title: Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants
    Article Snippet: .. DNA from putative transgenic and UT plants was digested with EcoR V (NEB, UK). ..

    Spectroscopy:

    Article Title: Enzymatic- and temperature-sensitive controlled release of ultrasmall superparamagnetic iron oxides (USPIOs)
    Article Snippet: The restriction enzymes EcoRI and EcoRV were purchased from New England Biolabs (Ipswich, MA). .. Polymer samples were prepared for FT-IR spectroscopy by mixing with IR-grade KBr and pelleting on a KBr press.

    Purification:

    Article Title: Reconstruction of a replication-competent ancestral murine endogenous retrovirus-L
    Article Snippet: The gDNA was digested with EcoRV (New England Biolabs) and ligated to adaptors. .. Bands from second round PCR reactions were gel purified and inserted into pCR-Blunt II-TOPO using the Zero Blunt TOPO PCR cloning Kit (Life technologies) for sequencing.

    Article Title: Enzymatic- and temperature-sensitive controlled release of ultrasmall superparamagnetic iron oxides (USPIOs)
    Article Snippet: Methyl acrylate was purchased from Sigma-Aldrich (St. Louis, MO) and was purified by distillation prior to use. .. The restriction enzymes EcoRI and EcoRV were purchased from New England Biolabs (Ipswich, MA).

    Article Title: A dual-fluorescence reporter system for high-throughput clone characterization and selection by cell sorting
    Article Snippet: .. The pGRFP plasmid was cut with EcoRV (NEB), 5′ dephosphorylated with CIAP, and gel purified. .. The linearized vector was blunt-end ligated to the SU66E20 BAC library inserts using T4 DNA ligase.

    Article Title: Solution parameters modulating DNA binding specificity of the restriction endonuclease EcoRV
    Article Snippet: .. DNA binding and cleavage experiments were performed with highly purified EcoRV restriction endonuclease (described below) or with commercial EcoRV sample purchased from New England Biolabs. .. Active protein concentrations of the EcoRV were determined by the direct titration with the specific site 310 bp DNA fragment under conditions of stoichiometric binding as described previously [ , ].

    Plasmid Preparation:

    Article Title: Reconstruction of a replication-competent ancestral murine endogenous retrovirus-L
    Article Snippet: Briefly, gDNA was extracted from expanded single cell clones of CHO cells following transfection with a plasmid containing ancML and selected in G418. .. The gDNA was digested with EcoRV (New England Biolabs) and ligated to adaptors.

    Article Title: A dual-fluorescence reporter system for high-throughput clone characterization and selection by cell sorting
    Article Snippet: .. The pGRFP plasmid was cut with EcoRV (NEB), 5′ dephosphorylated with CIAP, and gel purified. .. The linearized vector was blunt-end ligated to the SU66E20 BAC library inserts using T4 DNA ligase.

    Article Title: CRISPR/Cas9 Targets Chicken Embryonic Somatic Cells In Vitro and In Vivo and generates Phenotypic Abnormalities
    Article Snippet: For MEN2B HDR templates, the PCR products were digested in BamHI restriction enzyme (New England Biolabs, Ipswich, MA) and in EcoRV restriction enzyme (New England Biolabs, Ipswich, MA) for MEN2A/HSCR HDR experiments. .. Positive clones were cloned into the pGEM-T Easy vector (Promega, Madison, WI) and cloned products were sequenced.

    Distillation:

    Article Title: Enzymatic- and temperature-sensitive controlled release of ultrasmall superparamagnetic iron oxides (USPIOs)
    Article Snippet: Methyl acrylate was purchased from Sigma-Aldrich (St. Louis, MO) and was purified by distillation prior to use. .. The restriction enzymes EcoRI and EcoRV were purchased from New England Biolabs (Ipswich, MA).

    Produced:

    Article Title: Isolation and characterization of HepP: a virulence-related Pseudomonas aeruginosa heparinase
    Article Snippet: Therefore, to further confirm the mutation of hepP in PA14ΔhepP , we performed restriction enzyme digestion on the PCR products with EcoR V (New England Biolabs). .. In contrast, digestion of the PCR product from PA14ΔhepP produced two fragments of 800 bp and 2120 bp (Fig. ).

    Pulsed-Field Gel:

    Article Title: Significance of the Bacteriophage Treatment Schedule in Reducing Salmonella Colonization of Poultry
    Article Snippet: Bacteriophage lysates at 1011 PFU/ml were used to determine the genome sizes of the three bacteriophages by pulsed-field gel electrophoresis (PFGE), as previously described ( ). .. Bacteriophage DNA was obtained from lysates (1011 PFU/ml) as described previously ( ) and digested with the restriction enzymes EcoRI, EcoRV, and HindIII (New England BioLabs), according to the manufacturer's recommendations.

    BAC Assay:

    Article Title: A dual-fluorescence reporter system for high-throughput clone characterization and selection by cell sorting
    Article Snippet: Library construction The SU66E20 bacterial artificial chromosome (BAC) from the sea urchin S.purpuratus was prepared using the Large Construct Plasmid Isolation kit (Qiagen). .. The pGRFP plasmid was cut with EcoRV (NEB), 5′ dephosphorylated with CIAP, and gel purified.

    Staining:

    Article Title: Significance of the Bacteriophage Treatment Schedule in Reducing Salmonella Colonization of Poultry
    Article Snippet: Bacteriophage DNA was obtained from lysates (1011 PFU/ml) as described previously ( ) and digested with the restriction enzymes EcoRI, EcoRV, and HindIII (New England BioLabs), according to the manufacturer's recommendations. .. Samples were analyzed by electrophoresis in 0.7% agarose gels and visualized by staining with ethidium bromide.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs ecorv restriction endonuclease
    pH dependence of the <t>EcoRV</t> specific-nonspecific free binding energy difference. The pH dependence of ln(K nsp-sp ) is shown for the range 5.5 to 8.0. Mixtures of EcoRV, the 310 bp specific site <t>DNA</t> fragment, and the nonspecific oligonucleotide competitor
    Ecorv Restriction Endonuclease, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 163 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ecorv restriction endonuclease/product/New England Biolabs
    Average 90 stars, based on 163 article reviews
    Price from $9.99 to $1999.99
    ecorv restriction endonuclease - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    Image Search Results


    pH dependence of the EcoRV specific-nonspecific free binding energy difference. The pH dependence of ln(K nsp-sp ) is shown for the range 5.5 to 8.0. Mixtures of EcoRV, the 310 bp specific site DNA fragment, and the nonspecific oligonucleotide competitor

    Journal: The FEBS journal

    Article Title: Solution parameters modulating DNA binding specificity of the restriction endonuclease EcoRV

    doi: 10.1111/j.1742-4658.2011.08198.x

    Figure Lengend Snippet: pH dependence of the EcoRV specific-nonspecific free binding energy difference. The pH dependence of ln(K nsp-sp ) is shown for the range 5.5 to 8.0. Mixtures of EcoRV, the 310 bp specific site DNA fragment, and the nonspecific oligonucleotide competitor

    Article Snippet: DNA binding and cleavage experiments were performed with highly purified EcoRV restriction endonuclease (described below) or with commercial EcoRV sample purchased from New England Biolabs.

    Techniques: Binding Assay

    Kinetics of the EcoRV-DNA complex formation. The kinetics of DNA-protein complex formation was measured using the self-cleavage assay at different conditions of pH: pH 6.3 (▲); pH 7.6 (■). The binding of the EcoRV proceeds in at least

    Journal: The FEBS journal

    Article Title: Solution parameters modulating DNA binding specificity of the restriction endonuclease EcoRV

    doi: 10.1111/j.1742-4658.2011.08198.x

    Figure Lengend Snippet: Kinetics of the EcoRV-DNA complex formation. The kinetics of DNA-protein complex formation was measured using the self-cleavage assay at different conditions of pH: pH 6.3 (▲); pH 7.6 (■). The binding of the EcoRV proceeds in at least

    Article Snippet: DNA binding and cleavage experiments were performed with highly purified EcoRV restriction endonuclease (described below) or with commercial EcoRV sample purchased from New England Biolabs.

    Techniques: Cleavage Assay, Binding Assay

    A direct comparison of EcoRV-DNA binding analyzed by the gel mobility shift assay and by the self-cleavage assay. (A ) A gel image is shown illustrating a direct comparison of the EcoRV-DNA binding by the gel mobility shift assay (left), and by the self-cleavage

    Journal: The FEBS journal

    Article Title: Solution parameters modulating DNA binding specificity of the restriction endonuclease EcoRV

    doi: 10.1111/j.1742-4658.2011.08198.x

    Figure Lengend Snippet: A direct comparison of EcoRV-DNA binding analyzed by the gel mobility shift assay and by the self-cleavage assay. (A ) A gel image is shown illustrating a direct comparison of the EcoRV-DNA binding by the gel mobility shift assay (left), and by the self-cleavage

    Article Snippet: DNA binding and cleavage experiments were performed with highly purified EcoRV restriction endonuclease (described below) or with commercial EcoRV sample purchased from New England Biolabs.

    Techniques: Binding Assay, Mobility Shift, Cleavage Assay

    Equilibrium competition between specific and nonspecific DNA sequences for the EcoRV binding. Mixtures of EcoRV, the 310 bp DNA fragment with a specific recognition site, and nonspecific oligonucleotide competitor were incubated at 20 °C overnight

    Journal: The FEBS journal

    Article Title: Solution parameters modulating DNA binding specificity of the restriction endonuclease EcoRV

    doi: 10.1111/j.1742-4658.2011.08198.x

    Figure Lengend Snippet: Equilibrium competition between specific and nonspecific DNA sequences for the EcoRV binding. Mixtures of EcoRV, the 310 bp DNA fragment with a specific recognition site, and nonspecific oligonucleotide competitor were incubated at 20 °C overnight

    Article Snippet: DNA binding and cleavage experiments were performed with highly purified EcoRV restriction endonuclease (described below) or with commercial EcoRV sample purchased from New England Biolabs.

    Techniques: Binding Assay, Incubation

    The dependence of the EcoRV specific-nonspecific binding free energy difference, ln(K nsp-sp ) in the units of kT, on solute osmolal concentration is shown for four neutral osmolytes. Mixtures of the specific site DNA fragment, nonspecific oligonucleotide,

    Journal: The FEBS journal

    Article Title: Solution parameters modulating DNA binding specificity of the restriction endonuclease EcoRV

    doi: 10.1111/j.1742-4658.2011.08198.x

    Figure Lengend Snippet: The dependence of the EcoRV specific-nonspecific binding free energy difference, ln(K nsp-sp ) in the units of kT, on solute osmolal concentration is shown for four neutral osmolytes. Mixtures of the specific site DNA fragment, nonspecific oligonucleotide,

    Article Snippet: DNA binding and cleavage experiments were performed with highly purified EcoRV restriction endonuclease (described below) or with commercial EcoRV sample purchased from New England Biolabs.

    Techniques: Binding Assay, Concentration Assay

    The pH dependence of Knsp-sp for EcoRV-DNA binding

    Journal: The FEBS journal

    Article Title: Solution parameters modulating DNA binding specificity of the restriction endonuclease EcoRV

    doi: 10.1111/j.1742-4658.2011.08198.x

    Figure Lengend Snippet: The pH dependence of Knsp-sp for EcoRV-DNA binding

    Article Snippet: DNA binding and cleavage experiments were performed with highly purified EcoRV restriction endonuclease (described below) or with commercial EcoRV sample purchased from New England Biolabs.

    Techniques: Binding Assay

    The dependence of the EcoRV specific-nonspecific binding free energy difference on triethylene glycol concentration is shown for different pH values. Mixtures of EcoRV, the 310 bp specific site DNA fragment, and the nonspecific oligonucleotide competitor

    Journal: The FEBS journal

    Article Title: Solution parameters modulating DNA binding specificity of the restriction endonuclease EcoRV

    doi: 10.1111/j.1742-4658.2011.08198.x

    Figure Lengend Snippet: The dependence of the EcoRV specific-nonspecific binding free energy difference on triethylene glycol concentration is shown for different pH values. Mixtures of EcoRV, the 310 bp specific site DNA fragment, and the nonspecific oligonucleotide competitor

    Article Snippet: DNA binding and cleavage experiments were performed with highly purified EcoRV restriction endonuclease (described below) or with commercial EcoRV sample purchased from New England Biolabs.

    Techniques: Binding Assay, Concentration Assay

    In vitro analysis of NHEJ and HDR genome modification (arrows) mediated by sgRNA-Cas9 system in chicken cell lines. ( a ) Frequency (%) of NHEJ mutation mediated by KIAA1279, Cdkn1b and Mbd3 -targeting sgRNA-Cas9 system in chicken DF-1 cells by PCR and T7E1 assay. 1kM- 1 kbp DNA ladder, M- 100 bp DNA ladder. ( b ) Frequency (%) of NHEJ mutation mediated by KIAA1279 and Cdkn1b -targeting sgRNA-CRISPR/Cas9 system in chicken lymphoma B DT40 cells by PCR and T7E1 assay. ( c ) Representative gel from DF-1 cells transfected with the RET-targeting sgRNA-Cas9 and the ssODN showing efficient integration of the HDR-based BamHI and EcoRV sequence. The frequency of HDR is represented in percentages. 1-No sgRNA, 2- MEN2B sgRNA #1 plus ssODN, 3- MEN2B sgRNA #1 and #2 plus ssODN and 4- MEN2A/HSCR sgRNA 1 plus ssODN. ( d ) Representative gel for single cell clones derived from DF-1 cells transfected with the RET-targeting sgRNA-Cas9 and the ssODN for the MEN2B and MEN2A/HSCR HDR modifications respectively. The table shows the ratio of the monoallelic and biallelic HDR-based mutations detected with single cell clones and the overall efficiency in percentage: N = 19 for MEN2B and N = 12 for MEN2A/HSCR.

    Journal: Scientific Reports

    Article Title: CRISPR/Cas9 Targets Chicken Embryonic Somatic Cells In Vitro and In Vivo and generates Phenotypic Abnormalities

    doi: 10.1038/srep34524

    Figure Lengend Snippet: In vitro analysis of NHEJ and HDR genome modification (arrows) mediated by sgRNA-Cas9 system in chicken cell lines. ( a ) Frequency (%) of NHEJ mutation mediated by KIAA1279, Cdkn1b and Mbd3 -targeting sgRNA-Cas9 system in chicken DF-1 cells by PCR and T7E1 assay. 1kM- 1 kbp DNA ladder, M- 100 bp DNA ladder. ( b ) Frequency (%) of NHEJ mutation mediated by KIAA1279 and Cdkn1b -targeting sgRNA-CRISPR/Cas9 system in chicken lymphoma B DT40 cells by PCR and T7E1 assay. ( c ) Representative gel from DF-1 cells transfected with the RET-targeting sgRNA-Cas9 and the ssODN showing efficient integration of the HDR-based BamHI and EcoRV sequence. The frequency of HDR is represented in percentages. 1-No sgRNA, 2- MEN2B sgRNA #1 plus ssODN, 3- MEN2B sgRNA #1 and #2 plus ssODN and 4- MEN2A/HSCR sgRNA 1 plus ssODN. ( d ) Representative gel for single cell clones derived from DF-1 cells transfected with the RET-targeting sgRNA-Cas9 and the ssODN for the MEN2B and MEN2A/HSCR HDR modifications respectively. The table shows the ratio of the monoallelic and biallelic HDR-based mutations detected with single cell clones and the overall efficiency in percentage: N = 19 for MEN2B and N = 12 for MEN2A/HSCR.

    Article Snippet: For MEN2B HDR templates, the PCR products were digested in BamHI restriction enzyme (New England Biolabs, Ipswich, MA) and in EcoRV restriction enzyme (New England Biolabs, Ipswich, MA) for MEN2A/HSCR HDR experiments.

    Techniques: In Vitro, Non-Homologous End Joining, Modification, Mutagenesis, Polymerase Chain Reaction, CRISPR, Transfection, Sequencing, Clone Assay, Derivative Assay

    Full-length wild-type p53 binds to MYC G-quadruplex more efficiently than its isolated C-terminal and central regions The role of p53 domains in MYC G-quadruplex binding was studied by EMSA. Oligonucleotides (1 pmol) Pu52 ( A ), Pu33 ( B ) and Pu22 ( C ) were incubated with wtp53 (lanes 2–5; 50, 100, 200, 400 ng), p53-320 (lanes 6–9; 25, 50, 100, 200 ng) or p53CD (lanes 10–13; 12.5, 25, 50, 100 ng) in the presence of 10 ng of non-specific competitor pBSK/EcoRV. Binding of full-length wtp53, central DBD and C-terminal construct of p53 to double-stranded oligonucleotides containing p53CON was studied by EMSA. Oligonucleotides (0.25 pmol) ( D ) P1-50, ( E ) P1-30 and ( F ) P1-22 were incubated with wtp53 (lanes 2–5; 12.5, 25, 50, 100 ng), p53-320 (lanes 6–9; 6, 12.5, 25, 50 ng) or p53CD (lanes 10–13; 3, 6, 12.5, 25 ng) in the presence of 2.5 ng of non-specific competitor pBSK/EcoRV.

    Journal: Bioscience Reports

    Article Title: Wild-type p53 binds to MYC promoter G-quadruplex

    doi: 10.1042/BSR20160232

    Figure Lengend Snippet: Full-length wild-type p53 binds to MYC G-quadruplex more efficiently than its isolated C-terminal and central regions The role of p53 domains in MYC G-quadruplex binding was studied by EMSA. Oligonucleotides (1 pmol) Pu52 ( A ), Pu33 ( B ) and Pu22 ( C ) were incubated with wtp53 (lanes 2–5; 50, 100, 200, 400 ng), p53-320 (lanes 6–9; 25, 50, 100, 200 ng) or p53CD (lanes 10–13; 12.5, 25, 50, 100 ng) in the presence of 10 ng of non-specific competitor pBSK/EcoRV. Binding of full-length wtp53, central DBD and C-terminal construct of p53 to double-stranded oligonucleotides containing p53CON was studied by EMSA. Oligonucleotides (0.25 pmol) ( D ) P1-50, ( E ) P1-30 and ( F ) P1-22 were incubated with wtp53 (lanes 2–5; 12.5, 25, 50, 100 ng), p53-320 (lanes 6–9; 6, 12.5, 25, 50 ng) or p53CD (lanes 10–13; 3, 6, 12.5, 25 ng) in the presence of 2.5 ng of non-specific competitor pBSK/EcoRV.

    Article Snippet: Non-specific competitor plasmid pBSK/EcoRV was prepared by EcoRV restriction endonuclease (New England Biolabs) cleavage of pBSK.

    Techniques: Isolation, Binding Assay, Incubation, Construct

    Full-length wild-type p53 binding to the parallel G-quadruplex from MYC promoter NHE III 1 region is comparable with p53CON binding ( A ) Comparison of sequence-specific and MYC G-quadruplex Pu52 binding of p53 by EMSA. Oligonucelotides P1-50 (0.25 pmol, lanes 1–5), Pu52 (1 pmol, lanes 6–10) and A50 (0.25 pmol, lanes 11–15) were incubated with wtp53 protein (50, 100, 200, 400 ng/1 pmol of oligonucleotide) in the presence of 20 ng (per 1 pmol of oligonucleotide) of non-specific competitor pBSK/EcoRV. ( B ) CD spectra of Pu52 oligonucleotide measured in 5 mM Tris pH 7.6 (dotted line) and after addition of 10 mM KCl (dashed line) and 50 mM KCl respectively (solid line). ( C ) DMS footprinting of Pu52 oligonucleotide. Pu52 was annealed in 50 mM KCl without subsequent DMS treatment (lane 1), annealed in the absence of KCl and treated with DMS (lane 2) or annealed in 50 mM KCl and treated with DMS (lane 3). ( D ) Comparison of sequence-specific and MYC G-quadruplex Pu22 binding of p53 by EMSA. Oligonucelotides P1-22 (0.25 pmol, lanes 1–5), Pu22 (1 pmol, lanes 6–10) and A25 (0.25 pmol, lanes 11–15) were incubated with wtp53 protein (50, 100, 200, 400 ng/1 pmol of oligonucleotide) in the presence of 20 ng (per 1 pmol of oligonucleotide) of non-specific competitor pBSK/EcoRV. ( E ) CD spectra of Pu22 oligonucleotide measured in 5 mM Tris pH 7.6 (dotted line) and after addition of 10 mM KCl (dashed line) and 50 mM KCl respectively (solid line). ( F ) DMS footprinting of Pu22 oligonucleotide. Pu22 was annealed in 50 mM KCl without subsequent DMS treatment (lane 1), annealed in the absence of KCl and treated with DMS (lane 2) or annealed in 50 mM KCl and treated with DMS (lane 3).

    Journal: Bioscience Reports

    Article Title: Wild-type p53 binds to MYC promoter G-quadruplex

    doi: 10.1042/BSR20160232

    Figure Lengend Snippet: Full-length wild-type p53 binding to the parallel G-quadruplex from MYC promoter NHE III 1 region is comparable with p53CON binding ( A ) Comparison of sequence-specific and MYC G-quadruplex Pu52 binding of p53 by EMSA. Oligonucelotides P1-50 (0.25 pmol, lanes 1–5), Pu52 (1 pmol, lanes 6–10) and A50 (0.25 pmol, lanes 11–15) were incubated with wtp53 protein (50, 100, 200, 400 ng/1 pmol of oligonucleotide) in the presence of 20 ng (per 1 pmol of oligonucleotide) of non-specific competitor pBSK/EcoRV. ( B ) CD spectra of Pu52 oligonucleotide measured in 5 mM Tris pH 7.6 (dotted line) and after addition of 10 mM KCl (dashed line) and 50 mM KCl respectively (solid line). ( C ) DMS footprinting of Pu52 oligonucleotide. Pu52 was annealed in 50 mM KCl without subsequent DMS treatment (lane 1), annealed in the absence of KCl and treated with DMS (lane 2) or annealed in 50 mM KCl and treated with DMS (lane 3). ( D ) Comparison of sequence-specific and MYC G-quadruplex Pu22 binding of p53 by EMSA. Oligonucelotides P1-22 (0.25 pmol, lanes 1–5), Pu22 (1 pmol, lanes 6–10) and A25 (0.25 pmol, lanes 11–15) were incubated with wtp53 protein (50, 100, 200, 400 ng/1 pmol of oligonucleotide) in the presence of 20 ng (per 1 pmol of oligonucleotide) of non-specific competitor pBSK/EcoRV. ( E ) CD spectra of Pu22 oligonucleotide measured in 5 mM Tris pH 7.6 (dotted line) and after addition of 10 mM KCl (dashed line) and 50 mM KCl respectively (solid line). ( F ) DMS footprinting of Pu22 oligonucleotide. Pu22 was annealed in 50 mM KCl without subsequent DMS treatment (lane 1), annealed in the absence of KCl and treated with DMS (lane 2) or annealed in 50 mM KCl and treated with DMS (lane 3).

    Article Snippet: Non-specific competitor plasmid pBSK/EcoRV was prepared by EcoRV restriction endonuclease (New England Biolabs) cleavage of pBSK.

    Techniques: Binding Assay, Sequencing, Incubation, Footprinting

    Wild-type p53 and C-terminal region of p53 bind G-quadruplex Pu52 with higher affinity than double-stranded Pu52/Py52 Binding of various p53 protein constructs to MYC promoter G-quadruplexes from was studied by EMSA. Oligonucleotides ( A ) P1-40 (0.5 pmol), ( B ) Pu52 (1 pmol) and ( C ) dsPu52/Py52 (0.5 pmol) were incubated with wtp53 (lanes 2–4; 25, 50, 100 ng/1 pmol of oligonucleotide), CΔ30 (lanes 5–7; 25, 50, 100 ng/1 pmol of oligonucleotide), p53CT (lanes 8–10; 50, 100, 200 ng/1 pmol of oligonucleotide), p53T (lanes 11–13; 50, 100, 200 ng/1 pmol of oligonucleotide) or p53CD (lanes 14 and 15; 100, 200 ng/1 pmol of oligonucleotide) in the presence of 20 ng (per 1 pmol of oligonucleotide) of non-specific competitor pBSK/EcoRV.

    Journal: Bioscience Reports

    Article Title: Wild-type p53 binds to MYC promoter G-quadruplex

    doi: 10.1042/BSR20160232

    Figure Lengend Snippet: Wild-type p53 and C-terminal region of p53 bind G-quadruplex Pu52 with higher affinity than double-stranded Pu52/Py52 Binding of various p53 protein constructs to MYC promoter G-quadruplexes from was studied by EMSA. Oligonucleotides ( A ) P1-40 (0.5 pmol), ( B ) Pu52 (1 pmol) and ( C ) dsPu52/Py52 (0.5 pmol) were incubated with wtp53 (lanes 2–4; 25, 50, 100 ng/1 pmol of oligonucleotide), CΔ30 (lanes 5–7; 25, 50, 100 ng/1 pmol of oligonucleotide), p53CT (lanes 8–10; 50, 100, 200 ng/1 pmol of oligonucleotide), p53T (lanes 11–13; 50, 100, 200 ng/1 pmol of oligonucleotide) or p53CD (lanes 14 and 15; 100, 200 ng/1 pmol of oligonucleotide) in the presence of 20 ng (per 1 pmol of oligonucleotide) of non-specific competitor pBSK/EcoRV.

    Article Snippet: Non-specific competitor plasmid pBSK/EcoRV was prepared by EcoRV restriction endonuclease (New England Biolabs) cleavage of pBSK.

    Techniques: Binding Assay, Construct, Incubation