r0190  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Name:
    NaeI
    Description:

    Catalog Number:
    R0190
    Price:
    262
    Category:
    Restriction Enzymes
    Applications:
    DNA Manipulation
    Size:
    2500 units
    Buy from Supplier


    Structured Review

    New England Biolabs r0190
    NaeI

    https://www.bioz.com/result/r0190/product/New England Biolabs
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    r0190 - by Bioz Stars, 2021-08
    92/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Identification of the Selenoprotein S Positive UGA Recoding (SPUR) element and its position-dependent activity
    Article Snippet: .. To remove contaminating plasmid DNA, RNA samples were digested with NaeI (New England Biolabs) followed by RQI DNase (Promega). ..

    Article Title: Xrn1p Acts at Multiple Steps in the Budding-Yeast RNAi Pathway to Enhance the Efficiency of Silencing
    Article Snippet: .. To construct pRS403-ScerURA3hp-HIS3-PEST, the integrating plasmid containing the URA3 -silencing construct, the N. castellii genomic sequence downstream of the ORF NCAS0C02950 was amplified (primers: Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 ( ) using PsiI and NaeI restriction enzymes (New England Biolabs, NEB). ..

    Polymerase Chain Reaction:

    Article Title: TALEN-Based Mutagenesis of Lipoxygenase LOX3 Enhances the Storage Tolerance of Rice (Oryza sativa) Seeds
    Article Snippet: .. In total, 400 ng of PCR product was digested by NaeI (NEB) and was separated via 1% agarose gel electrophoresis. ..

    Article Title: Telomere length in myelodysplastic syndromes
    Article Snippet: .. Four ul of each PCR sample was digested with 5 units of NaeI (New England Biolabs) at 37C overnight and resolved on 8% native polyacrylamide gels to detect differences in RFLP patterns. ..

    Agarose Gel Electrophoresis:

    Article Title: TALEN-Based Mutagenesis of Lipoxygenase LOX3 Enhances the Storage Tolerance of Rice (Oryza sativa) Seeds
    Article Snippet: .. In total, 400 ng of PCR product was digested by NaeI (NEB) and was separated via 1% agarose gel electrophoresis. ..

    Amplification:

    Article Title: Genomic Pathogen Typing Using Solid-State Nanopores
    Article Snippet: .. We chose a restriction enzyme specific to the single nucleotide variation: for the mazG gene in H37Rv, NaeI (New England Biolabs) will cut the amplicon into two pieces of 321 and 621 bp, whereas the mazG gene from H37Ra will not be digested with this enzyme (942 bp). ..

    Article Title: Xrn1p Acts at Multiple Steps in the Budding-Yeast RNAi Pathway to Enhance the Efficiency of Silencing
    Article Snippet: .. To construct pRS403-ScerURA3hp-HIS3-PEST, the integrating plasmid containing the URA3 -silencing construct, the N. castellii genomic sequence downstream of the ORF NCAS0C02950 was amplified (primers: Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 ( ) using PsiI and NaeI restriction enzymes (New England Biolabs, NEB). ..

    Construct:

    Article Title: Xrn1p Acts at Multiple Steps in the Budding-Yeast RNAi Pathway to Enhance the Efficiency of Silencing
    Article Snippet: .. To construct pRS403-ScerURA3hp-HIS3-PEST, the integrating plasmid containing the URA3 -silencing construct, the N. castellii genomic sequence downstream of the ORF NCAS0C02950 was amplified (primers: Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 ( ) using PsiI and NaeI restriction enzymes (New England Biolabs, NEB). ..

    Sequencing:

    Article Title: Xrn1p Acts at Multiple Steps in the Budding-Yeast RNAi Pathway to Enhance the Efficiency of Silencing
    Article Snippet: .. To construct pRS403-ScerURA3hp-HIS3-PEST, the integrating plasmid containing the URA3 -silencing construct, the N. castellii genomic sequence downstream of the ORF NCAS0C02950 was amplified (primers: Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 ( ) using PsiI and NaeI restriction enzymes (New England Biolabs, NEB). ..

    Clone Assay:

    Article Title: Xrn1p Acts at Multiple Steps in the Budding-Yeast RNAi Pathway to Enhance the Efficiency of Silencing
    Article Snippet: .. To construct pRS403-ScerURA3hp-HIS3-PEST, the integrating plasmid containing the URA3 -silencing construct, the N. castellii genomic sequence downstream of the ORF NCAS0C02950 was amplified (primers: Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 ( ) using PsiI and NaeI restriction enzymes (New England Biolabs, NEB). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    New England Biolabs naei
    Gaussian Mixture Models of DNA Fragments for Actual Mode II Pathogen Typing at the SNV Level. (a) Diagram of the main steps in sample preparation, detection, and classification: PCR fragments from isolated pathogens are subjected to a restriction digest, which recognizes and cuts only one genomic variant. Nanopore translocations are used to classify the pathogen according to the combination of fragment lengths detected. (b) The <t>mazG</t> gene of the avirulent M . tuberculosis strain H37Ra is not cut by <t>NaeI</t> (942 bp), while the same gene in the closely related virulent strain H37Rv, which differs by only a single A-to-C mutation, is cut by NaeI (621bp + 321 bp). (c) Gaussian mixture model (one component) fit to translocations of mazG fragments from H37Ra. (d) Gaussian mixture model (two components) fit to translocations of mazG fragments from H37Rv. (e) Posterior probabilities for correctly identifying the H37Ra and H37Rv strains as a function of number of translocation events collected from an unknown sample, simulated using bootstrap sampling from nanopore translocation data. (f) The parC gene of the multi-drug-resistant MRSA strain FPR3757 is not cut by BseRI (886 bp) due to a single C-to-A mutation, while the closely related and less resistant strain HOU-MR is cut by BseRI (640bp + 245 bp). (g) Gaussian mixture model (one component) fit to translocations of parC fragments from FPR3757. (h) Gaussian mixture model (two components) fit to translocations of parC fragments from HOU-MR. (i) Posterior probabilities for correctly identifying the FPR3757 and HOU-MR strains as a function of number of translocation events collected from an unknown sample, simulated using bootstrap sampling from nanopore translocation data.
    Naei, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/naei/product/New England Biolabs
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    naei - by Bioz Stars, 2021-08
    92/100 stars
      Buy from Supplier

    Image Search Results


    Gaussian Mixture Models of DNA Fragments for Actual Mode II Pathogen Typing at the SNV Level. (a) Diagram of the main steps in sample preparation, detection, and classification: PCR fragments from isolated pathogens are subjected to a restriction digest, which recognizes and cuts only one genomic variant. Nanopore translocations are used to classify the pathogen according to the combination of fragment lengths detected. (b) The mazG gene of the avirulent M . tuberculosis strain H37Ra is not cut by NaeI (942 bp), while the same gene in the closely related virulent strain H37Rv, which differs by only a single A-to-C mutation, is cut by NaeI (621bp + 321 bp). (c) Gaussian mixture model (one component) fit to translocations of mazG fragments from H37Ra. (d) Gaussian mixture model (two components) fit to translocations of mazG fragments from H37Rv. (e) Posterior probabilities for correctly identifying the H37Ra and H37Rv strains as a function of number of translocation events collected from an unknown sample, simulated using bootstrap sampling from nanopore translocation data. (f) The parC gene of the multi-drug-resistant MRSA strain FPR3757 is not cut by BseRI (886 bp) due to a single C-to-A mutation, while the closely related and less resistant strain HOU-MR is cut by BseRI (640bp + 245 bp). (g) Gaussian mixture model (one component) fit to translocations of parC fragments from FPR3757. (h) Gaussian mixture model (two components) fit to translocations of parC fragments from HOU-MR. (i) Posterior probabilities for correctly identifying the FPR3757 and HOU-MR strains as a function of number of translocation events collected from an unknown sample, simulated using bootstrap sampling from nanopore translocation data.

    Journal: PLoS ONE

    Article Title: Genomic Pathogen Typing Using Solid-State Nanopores

    doi: 10.1371/journal.pone.0142944

    Figure Lengend Snippet: Gaussian Mixture Models of DNA Fragments for Actual Mode II Pathogen Typing at the SNV Level. (a) Diagram of the main steps in sample preparation, detection, and classification: PCR fragments from isolated pathogens are subjected to a restriction digest, which recognizes and cuts only one genomic variant. Nanopore translocations are used to classify the pathogen according to the combination of fragment lengths detected. (b) The mazG gene of the avirulent M . tuberculosis strain H37Ra is not cut by NaeI (942 bp), while the same gene in the closely related virulent strain H37Rv, which differs by only a single A-to-C mutation, is cut by NaeI (621bp + 321 bp). (c) Gaussian mixture model (one component) fit to translocations of mazG fragments from H37Ra. (d) Gaussian mixture model (two components) fit to translocations of mazG fragments from H37Rv. (e) Posterior probabilities for correctly identifying the H37Ra and H37Rv strains as a function of number of translocation events collected from an unknown sample, simulated using bootstrap sampling from nanopore translocation data. (f) The parC gene of the multi-drug-resistant MRSA strain FPR3757 is not cut by BseRI (886 bp) due to a single C-to-A mutation, while the closely related and less resistant strain HOU-MR is cut by BseRI (640bp + 245 bp). (g) Gaussian mixture model (one component) fit to translocations of parC fragments from FPR3757. (h) Gaussian mixture model (two components) fit to translocations of parC fragments from HOU-MR. (i) Posterior probabilities for correctly identifying the FPR3757 and HOU-MR strains as a function of number of translocation events collected from an unknown sample, simulated using bootstrap sampling from nanopore translocation data.

    Article Snippet: We chose a restriction enzyme specific to the single nucleotide variation: for the mazG gene in H37Rv, NaeI (New England Biolabs) will cut the amplicon into two pieces of 321 and 621 bp, whereas the mazG gene from H37Ra will not be digested with this enzyme (942 bp).

    Techniques: Sample Prep, Polymerase Chain Reaction, Isolation, Variant Assay, Mutagenesis, Translocation Assay, Sampling