noti restriction enzyme (New England Biolabs)
New England Biolabs is a verified supplier 
94
|
Name:
NotI
Description:
NotI 2 500 units
Catalog Number:
R0189L
Price:
297
Size:
2 500 units
Category:
Restriction Enzymes
Score:
85
|
Buy from Supplier |
Structured Review
New England Biolabs
noti restriction enzyme
NotI 2 500 units
https://www.bioz.com/result/noti restriction enzyme/product/New England Biolabs
Average 94 stars, based on 10 article reviews
Price from $9.99 to $1999.99
NotI 2 500 units
https://www.bioz.com/result/noti restriction enzyme/product/New England Biolabs
Average 94 stars, based on 10 article reviews
Price from $9.99 to $1999.99
noti restriction enzyme - by Bioz Stars,
2019-10
94/100 stars
Related Products / Commonly Used Together
Images
Related Articles
Clone Assay:Article Title: Characterization of Plasmodium ovale curtisi and P. ovale wallikeri in Western Kenya Utilizing a Novel Species-specific Real-time PCR Assay Article Snippet: We cloned the 74 base pair rbp2 amplicon into the pCR 2.1-TOPO TA vector (Life Technologies) following manufacturer’s guidelines and eluted the rbp2 plasmid in PCR grade water. .. The effect of the conformation of the rbp2 plasmid on standard curve linearity was analyzed by linearizing the rbp2 plasmid using the Article Title: The somite-secreted factor Maeg promotes zebrafish embryonic angiogenesis Article Snippet: Zebrafish maeg and mCherry coding sequence were cloned into PCS2+ vector. .. The vector template was linearized with Article Title: Viral oncomiR spreading between B and T cells is employed by Kaposi's sarcoma herpesvirus to induce non-cell-autonomous target gene regulation Article Snippet: These bioinformatics data were generated based on miRNA target prediction algorithms ( http://www.targetscan.org ); genomic sequence databases available from the UCSC genome browser ( http://genome.ucsc.edu ); and the Primer3 online tool ( http://frodo.wi.mit.edu/primer3 ). .. Next, the amplified fragment was cloned into pGEM T-easy vector (Promega, Madison, WI, USA), verified by sequencing and compared to the original human genome sequence. pGEM-BACH1 3′UTR was digested using Article Title: Insm1a Regulates Motor Neuron Development in Zebrafish Article Snippet: The MOs were diluted to 0.3 mM with RNase-free water and injected into the yolk of one to two-cell stage embryos and then raised in E3 medium at 28.5°C. .. The cDNAs containing the open reading frame of the target genes were cloned into PCS2+ vector respectively and then were transcribed in vitro using the mMESSAGE mMACHIN Kit (Ambion, USA) after the recombinant plasmids linearized with Article Title: Role of SV40 Integration Site at Chromosomal Interval 1q21.1 in Immortalized CRL2504 Cells Article Snippet: The BAC clones BAC RP11-364B14 and 152L6 were retrofitted with MJ0X166 to incorporate neo marker, using a vector exchange procedure ( ). .. Briefly, human DNA inserts from the BAC clones were released by digestion with Article Title: Rapid TaqMan-Based Quantification of Chlorophyll d-Containing Cyanobacteria in the Genus Acaryochloris Article Snippet: Clones were grown in LB medium with the addition of kanamycin (50 μg ml−1 ), and plasmids were extracted using the Qiagen miniprep kit (Qiagen Nordic, Sweden). .. Here, the plasmid insert was sequenced to confirm the correct insert (Macrogen, Seoul, South Korea) and then linearized using the Centrifugation:Article Title: Preserving Genome Integrity: The DdrA Protein of Deinococcus radiodurans R1Damage Response Protein Buys Time for Bacterial DNA Repair Article Snippet: After irradiation at 5.0 kGy, cells were collected by centrifugation (6,000g, 15 min, 4 °C) and resuspended in either TGY broth or 10 mM MgSO4 solution, before being placed in a shaking incubator at 30 °C for 24 h. Aliquots of these cultures were removed at various time points, and cells were washed in 0.9% NaCl and suspended in 0.125 M EDTA (pH 8.0) at a density of 5 × 108 cells/ml. .. DNA contained within the agarose plugs was digested with 10 U of Amplification:Article Title: Characterization of Plasmodium ovale curtisi and P. ovale wallikeri in Western Kenya Utilizing a Novel Species-specific Real-time PCR Assay Article Snippet: Plasmids with the rbp2 amplicon (rbp2 plasmid) were diluted in water to generate a ten-fold serial dilution from 100,000 rbp2 copies per microliter to 0.1 rbp2 copies per microliter. .. The effect of the conformation of the rbp2 plasmid on standard curve linearity was analyzed by linearizing the rbp2 plasmid using the Article Title: Viral oncomiR spreading between B and T cells is employed by Kaposi's sarcoma herpesvirus to induce non-cell-autonomous target gene regulation Article Snippet: These bioinformatics data were generated based on miRNA target prediction algorithms ( http://www.targetscan.org ); genomic sequence databases available from the UCSC genome browser ( http://genome.ucsc.edu ); and the Primer3 online tool ( http://frodo.wi.mit.edu/primer3 ). .. Next, the amplified fragment was cloned into pGEM T-easy vector (Promega, Madison, WI, USA), verified by sequencing and compared to the original human genome sequence. pGEM-BACH1 3′UTR was digested using Article Title: Crystal structures of trypanosomal histidyl-tRNA synthetase illuminate differences between eukaryotic and prokaryotic homologs Article Snippet: The resulting amplicon was ligated by TA cloning into the vector p2T7TABlue (a gift of D. Horn, London School of Hygiene and Tropical Medicine) , and the sequence was confirmed by nucleotide sequence analysis of the insert. .. The construct was linearized with the Article Title: Glycogen Synthase Kinase 3 Is a Potential Drug Target for African Trypanosomiasis Therapy Article Snippet: The nucleotide bases between the primer pairs (primer pairs 1 and 2, 3 and 4, and 5 and 6 [Table ]) were amplified from T. brucei 927 genomic DNA. .. The constructs were linearized with the Reporter Assay:Article Title: Transcription of TP0126, Treponema pallidum Putative OmpW Homolog, Is Regulated by the Length of a Homopolymeric Guanosine Repeat Article Snippet: To obtain templates for the IVT assay, DNA fragments containing variants of the TP0126 promoter [with 7- to 12-nt-long poly(G) regions] followed by the GFP gene were excised from the pGlow-TOPO TA vectors used for the GFP reporter assay (see above). .. Each of the vectors was incubated with 10 U of ZraI overnight at 37°C, purified using the QIAquick PCR purification kit (Qiagen), and then incubated with the Mass Spectrometry:Article Title: High-throughput imaging of adult fluorescent zebrafish with an LED fluorescence macroscope Article Snippet: Permission was obtained from the Massachusetts General Hospital Subcommittee on Research Animal Care for the treatment of zebrafish in our laboratory. .. Zebrafish rag2- driven mouse Myc expression vector Zebrafish rag2- driven human kRASG12D expression vector Zebrafish rag2- driven fluorescent reporter KCl (5 M; Sigma-Aldrich, cat. no. P9541) Tris-EDTA (TE, 100×; Sigma-Aldrich, cat. no. T9285) PBS (1×; Gibco, cat. no. 10010-023) FBS (Gibco, cat. no. 16000-036) Liberase TM (Roche, cat. no. 0540119001) TA Cloning:Article Title: Crystal structures of trypanosomal histidyl-tRNA synthetase illuminate differences between eukaryotic and prokaryotic homologs Article Snippet: The resulting amplicon was ligated by TA cloning into the vector p2T7TABlue (a gift of D. Horn, London School of Hygiene and Tropical Medicine) , and the sequence was confirmed by nucleotide sequence analysis of the insert. .. The construct was linearized with the Article Title: Glycogen Synthase Kinase 3 Is a Potential Drug Target for African Trypanosomiasis Therapy Article Snippet: The resultant amplicons were ligated by the use of TA cloning into the vector p2T7TABlue (a gift of D. Horn, London School of Hygiene and Tropical Medicine) , and their sequences were confirmed by nucleotide sequence analysis of the inserts. .. The constructs were linearized with the Construct:Article Title: Determinants of selective ion permeation in the epithelial Na+ channel Article Snippet: Paragraph title: Molecular constructs ... Plasmids containing rat ENaC α, β, and γ subunits ( ) were linearized with Article Title: Crystal structures of trypanosomal histidyl-tRNA synthetase illuminate differences between eukaryotic and prokaryotic homologs Article Snippet: The resulting amplicon was ligated by TA cloning into the vector p2T7TABlue (a gift of D. Horn, London School of Hygiene and Tropical Medicine) , and the sequence was confirmed by nucleotide sequence analysis of the insert. .. The construct was linearized with the Article Title: Glycogen Synthase Kinase 3 Is a Potential Drug Target for African Trypanosomiasis Therapy Article Snippet: The resultant amplicons were ligated by the use of TA cloning into the vector p2T7TABlue (a gift of D. Horn, London School of Hygiene and Tropical Medicine) , and their sequences were confirmed by nucleotide sequence analysis of the inserts. .. The constructs were linearized with the End-sequence Profiling:Article Title: Preserving Genome Integrity: The DdrA Protein of Deinococcus radiodurans R1Damage Response Protein Buys Time for Bacterial DNA Repair Article Snippet: After lysozyme treatment, agarose plugs were placed in ESP buffer (EDTA 0.5 M [pH 9–9.5], 1% lauroyl sarcosine, 1 mg/ml proteinase K) at 50 °C for 6 h, followed by a 2-d incubation at 37 °C. .. DNA contained within the agarose plugs was digested with 10 U of Electrophoresis:Article Title: Preserving Genome Integrity: The DdrA Protein of Deinococcus radiodurans R1Damage Response Protein Buys Time for Bacterial DNA Repair Article Snippet: Paragraph title: Pulsed-field gel electrophoresis ... DNA contained within the agarose plugs was digested with 10 U of Article Title: Human Leptospirosis Caused by a New, Antigenically Unique Leptospira Associated with a Rattus Species Reservoir in the Peruvian Amazon Article Snippet: Paragraph title: Pulsed Field Gel Electrophoresis (PFGE) Characterization of Isolates ... Agarose blocks containing leptospiral DNA were prepared and then digested with 30 units of Article Title: Role of SV40 Integration Site at Chromosomal Interval 1q21.1 in Immortalized CRL2504 Cells Article Snippet: The BAC clones BAC RP11-364B14 and 152L6 were retrofitted with MJ0X166 to incorporate neo marker, using a vector exchange procedure ( ). .. Briefly, human DNA inserts from the BAC clones were released by digestion with Incubation:Article Title: Preserving Genome Integrity: The DdrA Protein of Deinococcus radiodurans R1Damage Response Protein Buys Time for Bacterial DNA Repair Article Snippet: After lysozyme treatment, agarose plugs were placed in ESP buffer (EDTA 0.5 M [pH 9–9.5], 1% lauroyl sarcosine, 1 mg/ml proteinase K) at 50 °C for 6 h, followed by a 2-d incubation at 37 °C. .. DNA contained within the agarose plugs was digested with 10 U of Article Title: Functional Characterization of a Juvenile Hormone Esterase Related Gene in the Moth Sesamia nonagrioides through RNA Interference Article Snippet: The pGEM T-easy/SnJHERloop plasmid ( ) was partially digested by incubating 1 µg of it with 1/10 U of the Article Title: Transcription of TP0126, Treponema pallidum Putative OmpW Homolog, Is Regulated by the Length of a Homopolymeric Guanosine Repeat Article Snippet: To obtain templates for the IVT assay, DNA fragments containing variants of the TP0126 promoter [with 7- to 12-nt-long poly(G) regions] followed by the GFP gene were excised from the pGlow-TOPO TA vectors used for the GFP reporter assay (see above). .. Each of the vectors was incubated with 10 U of ZraI overnight at 37°C, purified using the QIAquick PCR purification kit (Qiagen), and then incubated with the Luciferase:Article Title: Viral oncomiR spreading between B and T cells is employed by Kaposi's sarcoma herpesvirus to induce non-cell-autonomous target gene regulation Article Snippet: These bioinformatics data were generated based on miRNA target prediction algorithms ( http://www.targetscan.org ); genomic sequence databases available from the UCSC genome browser ( http://genome.ucsc.edu ); and the Primer3 online tool ( http://frodo.wi.mit.edu/primer3 ). .. Next, the amplified fragment was cloned into pGEM T-easy vector (Promega, Madison, WI, USA), verified by sequencing and compared to the original human genome sequence. pGEM-BACH1 3′UTR was digested using Activity Assay:Article Title: Viral oncomiR spreading between B and T cells is employed by Kaposi's sarcoma herpesvirus to induce non-cell-autonomous target gene regulation Article Snippet: Next, the amplified fragment was cloned into pGEM T-easy vector (Promega, Madison, WI, USA), verified by sequencing and compared to the original human genome sequence. pGEM-BACH1 3′UTR was digested using Expressing:Article Title: Viral oncomiR spreading between B and T cells is employed by Kaposi's sarcoma herpesvirus to induce non-cell-autonomous target gene regulation Article Snippet: Next, the amplified fragment was cloned into pGEM T-easy vector (Promega, Madison, WI, USA), verified by sequencing and compared to the original human genome sequence. pGEM-BACH1 3′UTR was digested using Article Title: Transcription of TP0126, Treponema pallidum Putative OmpW Homolog, Is Regulated by the Length of a Homopolymeric Guanosine Repeat Article Snippet: Each of the vectors was incubated with 10 U of ZraI overnight at 37°C, purified using the QIAquick PCR purification kit (Qiagen), and then incubated with the Article Title: Glycogen Synthase Kinase 3 Is a Potential Drug Target for African Trypanosomiasis Therapy Article Snippet: The constructs were linearized with the Article Title: High-throughput imaging of adult fluorescent zebrafish with an LED fluorescence macroscope Article Snippet: Permission was obtained from the Massachusetts General Hospital Subcommittee on Research Animal Care for the treatment of zebrafish in our laboratory. .. Zebrafish rag2- driven mouse Myc expression vector Zebrafish rag2- driven human kRASG12D expression vector Zebrafish rag2- driven fluorescent reporter KCl (5 M; Sigma-Aldrich, cat. no. P9541) Tris-EDTA (TE, 100×; Sigma-Aldrich, cat. no. T9285) PBS (1×; Gibco, cat. no. 10010-023) FBS (Gibco, cat. no. 16000-036) Liberase TM (Roche, cat. no. 0540119001) Western Blot:Article Title: High-throughput imaging of adult fluorescent zebrafish with an LED fluorescence macroscope Article Snippet: Permission was obtained from the Massachusetts General Hospital Subcommittee on Research Animal Care for the treatment of zebrafish in our laboratory. .. Zebrafish rag2- driven mouse Myc expression vector Zebrafish rag2- driven human kRASG12D expression vector Zebrafish rag2- driven fluorescent reporter KCl (5 M; Sigma-Aldrich, cat. no. P9541) Tris-EDTA (TE, 100×; Sigma-Aldrich, cat. no. T9285) PBS (1×; Gibco, cat. no. 10010-023) FBS (Gibco, cat. no. 16000-036) Liberase TM (Roche, cat. no. 0540119001) Transformation Assay:Article Title: Functional Characterization of a Juvenile Hormone Esterase Related Gene in the Moth Sesamia nonagrioides through RNA Interference Article Snippet: The pGEM T-easy/SnJHERloop plasmid ( ) was partially digested by incubating 1 µg of it with 1/10 U of the Article Title: Role of SV40 Integration Site at Chromosomal Interval 1q21.1 in Immortalized CRL2504 Cells Article Snippet: Briefly, human DNA inserts from the BAC clones were released by digestion with Electroporation:Article Title: Crystal structures of trypanosomal histidyl-tRNA synthetase illuminate differences between eukaryotic and prokaryotic homologs Article Snippet: The construct was linearized with the Article Title: Glycogen Synthase Kinase 3 Is a Potential Drug Target for African Trypanosomiasis Therapy Article Snippet: The constructs were linearized with the Flow Cytometry:Article Title: Rapid TaqMan-Based Quantification of Chlorophyll d-Containing Cyanobacteria in the Genus Acaryochloris Article Snippet: Here, the plasmid insert was sequenced to confirm the correct insert (Macrogen, Seoul, South Korea) and then linearized using the Serial Dilution:Article Title: Characterization of Plasmodium ovale curtisi and P. ovale wallikeri in Western Kenya Utilizing a Novel Species-specific Real-time PCR Assay Article Snippet: The resulting non-linearized ten-fold serial dilution series was utilized as a standard curve in subsequent validation experiments including determination of the linear dynamic range, specificity, reproducibility, repeatability, and limit of detection. .. The effect of the conformation of the rbp2 plasmid on standard curve linearity was analyzed by linearizing the rbp2 plasmid using the Cell Culture:Article Title: Glycogen Synthase Kinase 3 Is a Potential Drug Target for African Trypanosomiasis Therapy Article Snippet: The constructs were linearized with the Generated:Article Title: Viral oncomiR spreading between B and T cells is employed by Kaposi's sarcoma herpesvirus to induce non-cell-autonomous target gene regulation Article Snippet: These bioinformatics data were generated based on miRNA target prediction algorithms ( http://www.targetscan.org ); genomic sequence databases available from the UCSC genome browser ( http://genome.ucsc.edu ); and the Primer3 online tool ( http://frodo.wi.mit.edu/primer3 ). .. Next, the amplified fragment was cloned into pGEM T-easy vector (Promega, Madison, WI, USA), verified by sequencing and compared to the original human genome sequence. pGEM-BACH1 3′UTR was digested using Sequencing:Article Title: The somite-secreted factor Maeg promotes zebrafish embryonic angiogenesis Article Snippet: Zebrafish maeg and mCherry coding sequence were cloned into PCS2+ vector. .. The vector template was linearized with Article Title: Viral oncomiR spreading between B and T cells is employed by Kaposi's sarcoma herpesvirus to induce non-cell-autonomous target gene regulation Article Snippet: These bioinformatics data were generated based on miRNA target prediction algorithms ( http://www.targetscan.org ); genomic sequence databases available from the UCSC genome browser ( http://genome.ucsc.edu ); and the Primer3 online tool ( http://frodo.wi.mit.edu/primer3 ). .. Next, the amplified fragment was cloned into pGEM T-easy vector (Promega, Madison, WI, USA), verified by sequencing and compared to the original human genome sequence. pGEM-BACH1 3′UTR was digested using Article Title: Insm1a Regulates Motor Neuron Development in Zebrafish Article Snippet: Translation blocking antisense Morpholino (MOs; Gene Tools) against the ATG-containing sequence was designed (5′-AAATCCTCTGGGCATCTTCGCCAGC-3′) to target the translation start site according to the manufacturer's instruction and the other MO oligo (5′-CCTCTTACCTCAGTTACAATTTATA-3′) was used as standard control. .. The cDNAs containing the open reading frame of the target genes were cloned into PCS2+ vector respectively and then were transcribed in vitro using the mMESSAGE mMACHIN Kit (Ambion, USA) after the recombinant plasmids linearized with Article Title: Crystal structures of trypanosomal histidyl-tRNA synthetase illuminate differences between eukaryotic and prokaryotic homologs Article Snippet: The resulting amplicon was ligated by TA cloning into the vector p2T7TABlue (a gift of D. Horn, London School of Hygiene and Tropical Medicine) , and the sequence was confirmed by nucleotide sequence analysis of the insert. .. The construct was linearized with the Article Title: Glycogen Synthase Kinase 3 Is a Potential Drug Target for African Trypanosomiasis Therapy Article Snippet: The resultant amplicons were ligated by the use of TA cloning into the vector p2T7TABlue (a gift of D. Horn, London School of Hygiene and Tropical Medicine) , and their sequences were confirmed by nucleotide sequence analysis of the inserts. .. The constructs were linearized with the Injection:Article Title: The somite-secreted factor Maeg promotes zebrafish embryonic angiogenesis Article Snippet: Paragraph title: Injection of morpholinos and mRNAs ... The vector template was linearized with Article Title: Insm1a Regulates Motor Neuron Development in Zebrafish Article Snippet: The MOs were diluted to 0.3 mM with RNase-free water and injected into the yolk of one to two-cell stage embryos and then raised in E3 medium at 28.5°C. .. The cDNAs containing the open reading frame of the target genes were cloned into PCS2+ vector respectively and then were transcribed in vitro using the mMESSAGE mMACHIN Kit (Ambion, USA) after the recombinant plasmids linearized with Binding Assay:Article Title: Viral oncomiR spreading between B and T cells is employed by Kaposi's sarcoma herpesvirus to induce non-cell-autonomous target gene regulation Article Snippet: BACH1 3′UTR was amplified from human genomic DNA by a specific set of primers (CCCTTGATTTCCTACCTCAGTG and CTTCGGCAGCCTCAAAAA) designed to include 3 putative hsa-miR-155 / KSHV-miR-K12-11 binding sites. .. Next, the amplified fragment was cloned into pGEM T-easy vector (Promega, Madison, WI, USA), verified by sequencing and compared to the original human genome sequence. pGEM-BACH1 3′UTR was digested using Pulsed-Field Gel:Article Title: Preserving Genome Integrity: The DdrA Protein of Deinococcus radiodurans R1Damage Response Protein Buys Time for Bacterial DNA Repair Article Snippet: Paragraph title: Pulsed-field gel electrophoresis ... DNA contained within the agarose plugs was digested with 10 U of Article Title: Human Leptospirosis Caused by a New, Antigenically Unique Leptospira Associated with a Rattus Species Reservoir in the Peruvian Amazon Article Snippet: Paragraph title: Pulsed Field Gel Electrophoresis (PFGE) Characterization of Isolates ... Agarose blocks containing leptospiral DNA were prepared and then digested with 30 units of Article Title: Role of SV40 Integration Site at Chromosomal Interval 1q21.1 in Immortalized CRL2504 Cells Article Snippet: The BAC clones BAC RP11-364B14 and 152L6 were retrofitted with MJ0X166 to incorporate neo marker, using a vector exchange procedure ( ). .. Briefly, human DNA inserts from the BAC clones were released by digestion with Nucleic Acid Electrophoresis:Article Title: Transcription of TP0126, Treponema pallidum Putative OmpW Homolog, Is Regulated by the Length of a Homopolymeric Guanosine Repeat Article Snippet: Each of the vectors was incubated with 10 U of ZraI overnight at 37°C, purified using the QIAquick PCR purification kit (Qiagen), and then incubated with the Irradiation:Article Title: Preserving Genome Integrity: The DdrA Protein of Deinococcus radiodurans R1Damage Response Protein Buys Time for Bacterial DNA Repair Article Snippet: After irradiation at 5.0 kGy, cells were collected by centrifugation (6,000g, 15 min, 4 °C) and resuspended in either TGY broth or 10 mM MgSO4 solution, before being placed in a shaking incubator at 30 °C for 24 h. Aliquots of these cultures were removed at various time points, and cells were washed in 0.9% NaCl and suspended in 0.125 M EDTA (pH 8.0) at a density of 5 × 108 cells/ml. .. DNA contained within the agarose plugs was digested with 10 U of Mutagenesis:Article Title: Viral oncomiR spreading between B and T cells is employed by Kaposi's sarcoma herpesvirus to induce non-cell-autonomous target gene regulation Article Snippet: Paragraph title: BACH1 3′UTR mutagenesis and cloning into the psiCHECK2 vector ... Next, the amplified fragment was cloned into pGEM T-easy vector (Promega, Madison, WI, USA), verified by sequencing and compared to the original human genome sequence. pGEM-BACH1 3′UTR was digested using Isolation:Article Title: Role of SV40 Integration Site at Chromosomal Interval 1q21.1 in Immortalized CRL2504 Cells Article Snippet: Briefly, human DNA inserts from the BAC clones were released by digestion with Purification:Article Title: Characterization of Plasmodium ovale curtisi and P. ovale wallikeri in Western Kenya Utilizing a Novel Species-specific Real-time PCR Assay Article Snippet: The effect of the conformation of the rbp2 plasmid on standard curve linearity was analyzed by linearizing the rbp2 plasmid using the Article Title: Insm1a Regulates Motor Neuron Development in Zebrafish Article Snippet: The MOs were diluted to 0.3 mM with RNase-free water and injected into the yolk of one to two-cell stage embryos and then raised in E3 medium at 28.5°C. .. The cDNAs containing the open reading frame of the target genes were cloned into PCS2+ vector respectively and then were transcribed in vitro using the mMESSAGE mMACHIN Kit (Ambion, USA) after the recombinant plasmids linearized with Article Title: Transcription of TP0126, Treponema pallidum Putative OmpW Homolog, Is Regulated by the Length of a Homopolymeric Guanosine Repeat Article Snippet: To obtain templates for the IVT assay, DNA fragments containing variants of the TP0126 promoter [with 7- to 12-nt-long poly(G) regions] followed by the GFP gene were excised from the pGlow-TOPO TA vectors used for the GFP reporter assay (see above). .. Each of the vectors was incubated with 10 U of ZraI overnight at 37°C, purified using the QIAquick PCR purification kit (Qiagen), and then incubated with the Article Title: Rapid TaqMan-Based Quantification of Chlorophyll d-Containing Cyanobacteria in the Genus Acaryochloris Article Snippet: The resulting 102-bp fragment was purified on an agarose gel, excised using a sterile scalpel, purified (QiaexII; Qiagen Nordic, Sweden), and cloned into the TOPO-TA cloning vector (Invitrogen, Life Technologies Europe) by following the manufacturer's recommendations. .. Here, the plasmid insert was sequenced to confirm the correct insert (Macrogen, Seoul, South Korea) and then linearized using the Polymerase Chain Reaction:Article Title: Characterization of Plasmodium ovale curtisi and P. ovale wallikeri in Western Kenya Utilizing a Novel Species-specific Real-time PCR Assay Article Snippet: We cloned the 74 base pair rbp2 amplicon into the pCR 2.1-TOPO TA vector (Life Technologies) following manufacturer’s guidelines and eluted the rbp2 plasmid in PCR grade water. .. The effect of the conformation of the rbp2 plasmid on standard curve linearity was analyzed by linearizing the rbp2 plasmid using the Article Title: Transcription of TP0126, Treponema pallidum Putative OmpW Homolog, Is Regulated by the Length of a Homopolymeric Guanosine Repeat Article Snippet: To obtain templates for the IVT assay, DNA fragments containing variants of the TP0126 promoter [with 7- to 12-nt-long poly(G) regions] followed by the GFP gene were excised from the pGlow-TOPO TA vectors used for the GFP reporter assay (see above). .. Each of the vectors was incubated with 10 U of ZraI overnight at 37°C, purified using the QIAquick PCR purification kit (Qiagen), and then incubated with the Article Title: Rapid TaqMan-Based Quantification of Chlorophyll d-Containing Cyanobacteria in the Genus Acaryochloris Article Snippet: Plasmid standards for qPCR were prepared by amplifying the 16S rRNA gene fragment using AcmRv′ and AcmFv′ in conjunction with the PCR master mix (Promega, Madison, WI, USA) and DNA originating from the A. marina MBIC11017. .. Here, the plasmid insert was sequenced to confirm the correct insert (Macrogen, Seoul, South Korea) and then linearized using the Blocking Assay:Article Title: Insm1a Regulates Motor Neuron Development in Zebrafish Article Snippet: Translation blocking antisense Morpholino (MOs; Gene Tools) against the ATG-containing sequence was designed (5′-AAATCCTCTGGGCATCTTCGCCAGC-3′) to target the translation start site according to the manufacturer's instruction and the other MO oligo (5′-CCTCTTACCTCAGTTACAATTTATA-3′) was used as standard control. .. The cDNAs containing the open reading frame of the target genes were cloned into PCS2+ vector respectively and then were transcribed in vitro using the mMESSAGE mMACHIN Kit (Ambion, USA) after the recombinant plasmids linearized with Recombinant:Article Title: Functional Characterization of a Juvenile Hormone Esterase Related Gene in the Moth Sesamia nonagrioides through RNA Interference Article Snippet: The pGEM T-easy/SnJHERloop plasmid ( ) was partially digested by incubating 1 µg of it with 1/10 U of the Article Title: Insm1a Regulates Motor Neuron Development in Zebrafish Article Snippet: The MOs were diluted to 0.3 mM with RNase-free water and injected into the yolk of one to two-cell stage embryos and then raised in E3 medium at 28.5°C. .. The cDNAs containing the open reading frame of the target genes were cloned into PCS2+ vector respectively and then were transcribed in vitro using the mMESSAGE mMACHIN Kit (Ambion, USA) after the recombinant plasmids linearized with Article Title: Transcription of TP0126, Treponema pallidum Putative OmpW Homolog, Is Regulated by the Length of a Homopolymeric Guanosine Repeat Article Snippet: Each of the vectors was incubated with 10 U of ZraI overnight at 37°C, purified using the QIAquick PCR purification kit (Qiagen), and then incubated with the Staining:Article Title: Preserving Genome Integrity: The DdrA Protein of Deinococcus radiodurans R1Damage Response Protein Buys Time for Bacterial DNA Repair Article Snippet: DNA contained within the agarose plugs was digested with 10 U of Article Title: Human Leptospirosis Caused by a New, Antigenically Unique Leptospira Associated with a Rattus Species Reservoir in the Peruvian Amazon Article Snippet: Agarose blocks containing leptospiral DNA were prepared and then digested with 30 units of Plasmid Preparation:Article Title: Characterization of Plasmodium ovale curtisi and P. ovale wallikeri in Western Kenya Utilizing a Novel Species-specific Real-time PCR Assay Article Snippet: The resulting non-linearized ten-fold serial dilution series was utilized as a standard curve in subsequent validation experiments including determination of the linear dynamic range, specificity, reproducibility, repeatability, and limit of detection. .. The effect of the conformation of the rbp2 plasmid on standard curve linearity was analyzed by linearizing the rbp2 plasmid using the Article Title: The somite-secreted factor Maeg promotes zebrafish embryonic angiogenesis Article Snippet: Zebrafish maeg and mCherry coding sequence were cloned into PCS2+ vector. .. The vector template was linearized with Article Title: Viral oncomiR spreading between B and T cells is employed by Kaposi's sarcoma herpesvirus to induce non-cell-autonomous target gene regulation Article Snippet: These bioinformatics data were generated based on miRNA target prediction algorithms ( http://www.targetscan.org ); genomic sequence databases available from the UCSC genome browser ( http://genome.ucsc.edu ); and the Primer3 online tool ( http://frodo.wi.mit.edu/primer3 ). .. Next, the amplified fragment was cloned into pGEM T-easy vector (Promega, Madison, WI, USA), verified by sequencing and compared to the original human genome sequence. pGEM-BACH1 3′UTR was digested using Article Title: Functional Characterization of a Juvenile Hormone Esterase Related Gene in the Moth Sesamia nonagrioides through RNA Interference Article Snippet: As control we used the BmNPV/BmA::GFP-BmA::dsLuciferase virus, a virus expressing double stranded molecules of the reference luciferase gene. .. The pGEM T-easy/SnJHERloop plasmid ( ) was partially digested by incubating 1 µg of it with 1/10 U of the Article Title: Insm1a Regulates Motor Neuron Development in Zebrafish Article Snippet: The MOs were diluted to 0.3 mM with RNase-free water and injected into the yolk of one to two-cell stage embryos and then raised in E3 medium at 28.5°C. .. The cDNAs containing the open reading frame of the target genes were cloned into PCS2+ vector respectively and then were transcribed in vitro using the mMESSAGE mMACHIN Kit (Ambion, USA) after the recombinant plasmids linearized with Article Title: Crystal structures of trypanosomal histidyl-tRNA synthetase illuminate differences between eukaryotic and prokaryotic homologs Article Snippet: The resulting amplicon was ligated by TA cloning into the vector p2T7TABlue (a gift of D. Horn, London School of Hygiene and Tropical Medicine) , and the sequence was confirmed by nucleotide sequence analysis of the insert. .. The construct was linearized with the Article Title: Role of SV40 Integration Site at Chromosomal Interval 1q21.1 in Immortalized CRL2504 Cells Article Snippet: The BAC clones BAC RP11-364B14 and 152L6 were retrofitted with MJ0X166 to incorporate neo marker, using a vector exchange procedure ( ). .. Briefly, human DNA inserts from the BAC clones were released by digestion with Article Title: Transcription of TP0126, Treponema pallidum Putative OmpW Homolog, Is Regulated by the Length of a Homopolymeric Guanosine Repeat Article Snippet: Each of the vectors was incubated with 10 U of ZraI overnight at 37°C, purified using the QIAquick PCR purification kit (Qiagen), and then incubated with the Article Title: Glycogen Synthase Kinase 3 Is a Potential Drug Target for African Trypanosomiasis Therapy Article Snippet: The resultant amplicons were ligated by the use of TA cloning into the vector p2T7TABlue (a gift of D. Horn, London School of Hygiene and Tropical Medicine) , and their sequences were confirmed by nucleotide sequence analysis of the inserts. .. The constructs were linearized with the Article Title: Rapid TaqMan-Based Quantification of Chlorophyll d-Containing Cyanobacteria in the Genus Acaryochloris Article Snippet: Clones were grown in LB medium with the addition of kanamycin (50 μg ml−1 ), and plasmids were extracted using the Qiagen miniprep kit (Qiagen Nordic, Sweden). .. Here, the plasmid insert was sequenced to confirm the correct insert (Macrogen, Seoul, South Korea) and then linearized using the Article Title: High-throughput imaging of adult fluorescent zebrafish with an LED fluorescence macroscope Article Snippet: Permission was obtained from the Massachusetts General Hospital Subcommittee on Research Animal Care for the treatment of zebrafish in our laboratory. .. Zebrafish rag2- driven mouse Myc expression vector Zebrafish rag2- driven human kRASG12D expression vector Zebrafish rag2- driven fluorescent reporter KCl (5 M; Sigma-Aldrich, cat. no. P9541) Tris-EDTA (TE, 100×; Sigma-Aldrich, cat. no. T9285) PBS (1×; Gibco, cat. no. 10010-023) FBS (Gibco, cat. no. 16000-036) Liberase TM (Roche, cat. no. 0540119001) Real-time Polymerase Chain Reaction:Article Title: Characterization of Plasmodium ovale curtisi and P. ovale wallikeri in Western Kenya Utilizing a Novel Species-specific Real-time PCR Assay Article Snippet: Paragraph title: Real-time PCR assay to detect P. ovale ... The effect of the conformation of the rbp2 plasmid on standard curve linearity was analyzed by linearizing the rbp2 plasmid using the Article Title: Rapid TaqMan-Based Quantification of Chlorophyll d-Containing Cyanobacteria in the Genus Acaryochloris Article Snippet: Plasmid standards for qPCR were prepared by amplifying the 16S rRNA gene fragment using AcmRv′ and AcmFv′ in conjunction with the PCR master mix (Promega, Madison, WI, USA) and DNA originating from the A. marina MBIC11017. .. Here, the plasmid insert was sequenced to confirm the correct insert (Macrogen, Seoul, South Korea) and then linearized using the Selection:Article Title: Crystal structures of trypanosomal histidyl-tRNA synthetase illuminate differences between eukaryotic and prokaryotic homologs Article Snippet: The region within the gene coding sequence to be used for RNAi was selected using the RNA target selection program RNAit to ensure that there was no significant sequence homology with other genes within the genome. .. The construct was linearized with the Article Title: Glycogen Synthase Kinase 3 Is a Potential Drug Target for African Trypanosomiasis Therapy Article Snippet: The regions within the T. brucei GSK-3 short and long gene-coding sequences selected for RNAi plasmid construction were determined by using the RNA target selection program RNAit , to ensure that there was no significant sequence homology with other genes within the genome. .. The constructs were linearized with the Agarose Gel Electrophoresis:Article Title: Rapid TaqMan-Based Quantification of Chlorophyll d-Containing Cyanobacteria in the Genus Acaryochloris Article Snippet: The resulting 102-bp fragment was purified on an agarose gel, excised using a sterile scalpel, purified (QiaexII; Qiagen Nordic, Sweden), and cloned into the TOPO-TA cloning vector (Invitrogen, Life Technologies Europe) by following the manufacturer's recommendations. .. Here, the plasmid insert was sequenced to confirm the correct insert (Macrogen, Seoul, South Korea) and then linearized using the In Vitro:Article Title: Insm1a Regulates Motor Neuron Development in Zebrafish Article Snippet: The MOs were diluted to 0.3 mM with RNase-free water and injected into the yolk of one to two-cell stage embryos and then raised in E3 medium at 28.5°C. .. The cDNAs containing the open reading frame of the target genes were cloned into PCS2+ vector respectively and then were transcribed in vitro using the mMESSAGE mMACHIN Kit (Ambion, USA) after the recombinant plasmids linearized with Article Title: Transcription of TP0126, Treponema pallidum Putative OmpW Homolog, Is Regulated by the Length of a Homopolymeric Guanosine Repeat Article Snippet: An in vitro transcription (IVT) assay was developed to further confirm the results of the GFP reporter assay and to investigate whether the T. pallidum σ70 factor initiates TP0126 transcription, as predicted by BProm. .. Each of the vectors was incubated with 10 U of ZraI overnight at 37°C, purified using the QIAquick PCR purification kit (Qiagen), and then incubated with the Transgenic Assay:Article Title: High-throughput imaging of adult fluorescent zebrafish with an LED fluorescence macroscope Article Snippet: For the experiments outlined in this protocol, the wild-type strain AB (Zebrafish International Resource Center, cat. no. ZL1) and the syngeneic strain CG1 (refs. , ) were used, as were transgenic fish expressing a fluorescent reporter under the mylz2 muscle promoter ▲ CRITICAL All zebrafish experiments should be performed in accordance with relevant guidelines and regulations approved by institutional animal care and use committees. .. Zebrafish rag2- driven mouse Myc expression vector Zebrafish rag2- driven human kRASG12D expression vector Zebrafish rag2- driven fluorescent reporter KCl (5 M; Sigma-Aldrich, cat. no. P9541) Tris-EDTA (TE, 100×; Sigma-Aldrich, cat. no. T9285) PBS (1×; Gibco, cat. no. 10010-023) FBS (Gibco, cat. no. 16000-036) Liberase TM (Roche, cat. no. 0540119001) Spectrophotometry:Article Title: Characterization of Plasmodium ovale curtisi and P. ovale wallikeri in Western Kenya Utilizing a Novel Species-specific Real-time PCR Assay Article Snippet: The approximate rbp2 amplicon copy number per microliter was determined based on spectrophotometer (Nanodrop 2000c) concentration in nanograms per microliter. .. The effect of the conformation of the rbp2 plasmid on standard curve linearity was analyzed by linearizing the rbp2 plasmid using the Concentration Assay:Article Title: Characterization of Plasmodium ovale curtisi and P. ovale wallikeri in Western Kenya Utilizing a Novel Species-specific Real-time PCR Assay Article Snippet: The approximate rbp2 amplicon copy number per microliter was determined based on spectrophotometer (Nanodrop 2000c) concentration in nanograms per microliter. .. The effect of the conformation of the rbp2 plasmid on standard curve linearity was analyzed by linearizing the rbp2 plasmid using the Article Title: Preserving Genome Integrity: The DdrA Protein of Deinococcus radiodurans R1Damage Response Protein Buys Time for Bacterial DNA Repair Article Snippet: The suspensions were mixed with low-melting-point agarose (Sigma) to obtain a final concentration of 0.8% agarose. .. DNA contained within the agarose plugs was digested with 10 U of Article Title: The somite-secreted factor Maeg promotes zebrafish embryonic angiogenesis Article Snippet: Morpholino antisense oligos (MOs; Gene Tools) were prepared at a stock concentration of 1 mM according to the manufacturer's instruction. .. The vector template was linearized with Article Title: Rapid TaqMan-Based Quantification of Chlorophyll d-Containing Cyanobacteria in the Genus Acaryochloris Article Snippet: Here, the plasmid insert was sequenced to confirm the correct insert (Macrogen, Seoul, South Korea) and then linearized using the BAC Assay:Article Title: Role of SV40 Integration Site at Chromosomal Interval 1q21.1 in Immortalized CRL2504 Cells Article Snippet: The BAC clones BAC RP11-364B14 and 152L6 were retrofitted with MJ0X166 to incorporate neo marker, using a vector exchange procedure ( ). .. Briefly, human DNA inserts from the BAC clones were released by digestion with Marker:Article Title: Role of SV40 Integration Site at Chromosomal Interval 1q21.1 in Immortalized CRL2504 Cells Article Snippet: The BAC clones BAC RP11-364B14 and 152L6 were retrofitted with MJ0X166 to incorporate neo marker, using a vector exchange procedure ( ). .. Briefly, human DNA inserts from the BAC clones were released by digestion with Article Title: Glycogen Synthase Kinase 3 Is a Potential Drug Target for African Trypanosomiasis Therapy Article Snippet: The constructs were linearized with the Gel Extraction:Article Title: Transcription of TP0126, Treponema pallidum Putative OmpW Homolog, Is Regulated by the Length of a Homopolymeric Guanosine Repeat Article Snippet: Each of the vectors was incubated with 10 U of ZraI overnight at 37°C, purified using the QIAquick PCR purification kit (Qiagen), and then incubated with the Fluorescence In Situ Hybridization:Article Title: High-throughput imaging of adult fluorescent zebrafish with an LED fluorescence macroscope Article Snippet: For the experiments outlined in this protocol, the wild-type strain AB (Zebrafish International Resource Center, cat. no. ZL1) and the syngeneic strain CG1 (refs. , ) were used, as were transgenic fish expressing a fluorescent reporter under the mylz2 muscle promoter ▲ CRITICAL All zebrafish experiments should be performed in accordance with relevant guidelines and regulations approved by institutional animal care and use committees. .. Zebrafish rag2- driven mouse Myc expression vector Zebrafish rag2- driven human kRASG12D expression vector Zebrafish rag2- driven fluorescent reporter KCl (5 M; Sigma-Aldrich, cat. no. P9541) Tris-EDTA (TE, 100×; Sigma-Aldrich, cat. no. T9285) PBS (1×; Gibco, cat. no. 10010-023) FBS (Gibco, cat. no. 16000-036) Liberase TM (Roche, cat. no. 0540119001) Hood:Article Title: Rapid TaqMan-Based Quantification of Chlorophyll d-Containing Cyanobacteria in the Genus Acaryochloris Article Snippet: Here, the plasmid insert was sequenced to confirm the correct insert (Macrogen, Seoul, South Korea) and then linearized using the |