noti restriction enzyme  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Name:
    NotI
    Description:
    NotI 2 500 units
    Catalog Number:
    R0189L
    Price:
    297
    Size:
    2 500 units
    Category:
    Restriction Enzymes
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs noti restriction enzyme
    NotI
    NotI 2 500 units
    https://www.bioz.com/result/noti restriction enzyme/product/New England Biolabs
    Average 94 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    noti restriction enzyme - by Bioz Stars, 2019-10
    94/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Characterization of Plasmodium ovale curtisi and P. ovale wallikeri in Western Kenya Utilizing a Novel Species-specific Real-time PCR Assay
    Article Snippet: We cloned the 74 base pair rbp2 amplicon into the pCR 2.1-TOPO TA vector (Life Technologies) following manufacturer’s guidelines and eluted the rbp2 plasmid in PCR grade water. .. The effect of the conformation of the rbp2 plasmid on standard curve linearity was analyzed by linearizing the rbp2 plasmid using the NotI restriction enzyme (New England BioLabs Inc, Ipswich, MA, USA) according to the manufacturer’s protocol.

    Article Title: The somite-secreted factor Maeg promotes zebrafish embryonic angiogenesis
    Article Snippet: Zebrafish maeg and mCherry coding sequence were cloned into PCS2+ vector. .. The vector template was linearized with NotI Restriction Enzyme (NEB).

    Article Title: Viral oncomiR spreading between B and T cells is employed by Kaposi's sarcoma herpesvirus to induce non-cell-autonomous target gene regulation
    Article Snippet: These bioinformatics data were generated based on miRNA target prediction algorithms ( http://www.targetscan.org ); genomic sequence databases available from the UCSC genome browser ( http://genome.ucsc.edu ); and the Primer3 online tool ( http://frodo.wi.mit.edu/primer3 ). .. Next, the amplified fragment was cloned into pGEM T-easy vector (Promega, Madison, WI, USA), verified by sequencing and compared to the original human genome sequence. pGEM-BACH1 3′UTR was digested using NotI restriction enzyme (New England Biolabs Ltd.) and cloned into the psiCHECK2 vector (Promega, Madison, WI, USA) into the multiple cloning region located 3′ to the synthetic Renilla luciferase (hRluc) gene. .. Thereafter, a clone where the BACH1 3′UTR was inserted in the correct orientation was selected for future in vitro studies.

    Article Title: Insm1a Regulates Motor Neuron Development in Zebrafish
    Article Snippet: The MOs were diluted to 0.3 mM with RNase-free water and injected into the yolk of one to two-cell stage embryos and then raised in E3 medium at 28.5°C. .. The cDNAs containing the open reading frame of the target genes were cloned into PCS2+ vector respectively and then were transcribed in vitro using the mMESSAGE mMACHIN Kit (Ambion, USA) after the recombinant plasmids linearized with NotI Restriction Enzyme (NEB, England), and then the capped mRNAs were purified by RNeasy Mini Kit (Qiagen, Germany). .. 2 nl target genes and mCherry mRNA mixture (1:1) were injected at 20 ng/μl into 1/2-cell stage embryos.

    Article Title: Role of SV40 Integration Site at Chromosomal Interval 1q21.1 in Immortalized CRL2504 Cells
    Article Snippet: The BAC clones BAC RP11-364B14 and 152L6 were retrofitted with MJ0X166 to incorporate neo marker, using a vector exchange procedure ( ). .. Briefly, human DNA inserts from the BAC clones were released by digestion with NotI restriction enzyme (New England Biolab, Beverly, MA) and separated by pulsed- field gel electrophoresis (PFGE). .. The purified inserts were mixed separately with NotI digested and dephosphorylated retrofitting vector pJMOX166 at a molar ratio of 2:1 or 4:1 and ligated using T4 DNA ligase at 16° C for 16 hours.

    Article Title: Rapid TaqMan-Based Quantification of Chlorophyll d-Containing Cyanobacteria in the Genus Acaryochloris
    Article Snippet: Clones were grown in LB medium with the addition of kanamycin (50 μg ml−1 ), and plasmids were extracted using the Qiagen miniprep kit (Qiagen Nordic, Sweden). .. Here, the plasmid insert was sequenced to confirm the correct insert (Macrogen, Seoul, South Korea) and then linearized using the NotI restriction enzyme (New England BioLabs, Ipswich, MA, USA), in order to avoid template overestimation due to plasmid supercoiling ( ).

    Centrifugation:

    Article Title: Preserving Genome Integrity: The DdrA Protein of Deinococcus radiodurans R1Damage Response Protein Buys Time for Bacterial DNA Repair
    Article Snippet: After irradiation at 5.0 kGy, cells were collected by centrifugation (6,000g, 15 min, 4 °C) and resuspended in either TGY broth or 10 mM MgSO4 solution, before being placed in a shaking incubator at 30 °C for 24 h. Aliquots of these cultures were removed at various time points, and cells were washed in 0.9% NaCl and suspended in 0.125 M EDTA (pH 8.0) at a density of 5 × 108 cells/ml. .. DNA contained within the agarose plugs was digested with 10 U of NotI restriction enzyme (New England Biolabs, Beverly, Massachusetts, United States) overnight at 37 °C.

    Amplification:

    Article Title: Characterization of Plasmodium ovale curtisi and P. ovale wallikeri in Western Kenya Utilizing a Novel Species-specific Real-time PCR Assay
    Article Snippet: Plasmids with the rbp2 amplicon (rbp2 plasmid) were diluted in water to generate a ten-fold serial dilution from 100,000 rbp2 copies per microliter to 0.1 rbp2 copies per microliter. .. The effect of the conformation of the rbp2 plasmid on standard curve linearity was analyzed by linearizing the rbp2 plasmid using the NotI restriction enzyme (New England BioLabs Inc, Ipswich, MA, USA) according to the manufacturer’s protocol.

    Article Title: Viral oncomiR spreading between B and T cells is employed by Kaposi's sarcoma herpesvirus to induce non-cell-autonomous target gene regulation
    Article Snippet: These bioinformatics data were generated based on miRNA target prediction algorithms ( http://www.targetscan.org ); genomic sequence databases available from the UCSC genome browser ( http://genome.ucsc.edu ); and the Primer3 online tool ( http://frodo.wi.mit.edu/primer3 ). .. Next, the amplified fragment was cloned into pGEM T-easy vector (Promega, Madison, WI, USA), verified by sequencing and compared to the original human genome sequence. pGEM-BACH1 3′UTR was digested using NotI restriction enzyme (New England Biolabs Ltd.) and cloned into the psiCHECK2 vector (Promega, Madison, WI, USA) into the multiple cloning region located 3′ to the synthetic Renilla luciferase (hRluc) gene. .. Thereafter, a clone where the BACH1 3′UTR was inserted in the correct orientation was selected for future in vitro studies.

    Article Title: Crystal structures of trypanosomal histidyl-tRNA synthetase illuminate differences between eukaryotic and prokaryotic homologs
    Article Snippet: The resulting amplicon was ligated by TA cloning into the vector p2T7TABlue (a gift of D. Horn, London School of Hygiene and Tropical Medicine) , and the sequence was confirmed by nucleotide sequence analysis of the insert. .. The construct was linearized with the NotI restriction enzyme (New England Biolabs, Ipswich, MA).

    Article Title: Glycogen Synthase Kinase 3 Is a Potential Drug Target for African Trypanosomiasis Therapy
    Article Snippet: The nucleotide bases between the primer pairs (primer pairs 1 and 2, 3 and 4, and 5 and 6 [Table ]) were amplified from T. brucei 927 genomic DNA. .. The constructs were linearized with the NotI restriction enzyme (New England Biolabs, Ipswich, MA).

    Reporter Assay:

    Article Title: Transcription of TP0126, Treponema pallidum Putative OmpW Homolog, Is Regulated by the Length of a Homopolymeric Guanosine Repeat
    Article Snippet: To obtain templates for the IVT assay, DNA fragments containing variants of the TP0126 promoter [with 7- to 12-nt-long poly(G) regions] followed by the GFP gene were excised from the pGlow-TOPO TA vectors used for the GFP reporter assay (see above). .. Each of the vectors was incubated with 10 U of ZraI overnight at 37°C, purified using the QIAquick PCR purification kit (Qiagen), and then incubated with the NotI restriction enzyme (both enzymes were from New England Biolabs, Ipswich, MA) overnight at 37°C.

    Mass Spectrometry:

    Article Title: High-throughput imaging of adult fluorescent zebrafish with an LED fluorescence macroscope
    Article Snippet: Permission was obtained from the Massachusetts General Hospital Subcommittee on Research Animal Care for the treatment of zebrafish in our laboratory. .. Zebrafish rag2- driven mouse Myc expression vector Zebrafish rag2- driven human kRASG12D expression vector Zebrafish rag2- driven fluorescent reporter KCl (5 M; Sigma-Aldrich, cat. no. P9541) Tris-EDTA (TE, 100×; Sigma-Aldrich, cat. no. T9285) PBS (1×; Gibco, cat. no. 10010-023) FBS (Gibco, cat. no. 16000-036) Liberase TM (Roche, cat. no. 0540119001) NotI restriction enzyme (New England Biolabs, cat. no. R0189) MassRuler High-Range DNA ladder (Fermentas, cat. no. R0621) Trypan Blue Vital Dye (1×; Gibco, cat. no. 15250-061) Phenol/chloroform (EMD Biochemicals, cat. no. 6805-OP) Tricaine-S (Western Chemical, cat. no. MS-222) Visible Implant Elastomer kit (Northwest Marine Technology, cat. no. IVIFE0004) Agarose HS (Denville Scientific, cat. no. CA3510-8) Ethidium Bromide (Sigma-Aldrich, cat. no. E1510) Ethanol (Pharmco-AAPER, cat. no. 111ACS200) Mineral oil (Fisher Scientific, cat. no. O121-1) Distilled water .. Microsyringe (no. 701N; Hamilton, cat. no. 80366) Nylon cell strainer (40 μm; BD Falcon, cat. no. 352340) Petri dishes (100 mm × 15 mm; BD Falcon, cat. no. 351029) Luer-slip syringe (1 ml; Fisher Scientific, cat. no. 03-377-20) Insulin needles (28 gauge; Fisher Scientific, cat. no. 20-023-377) Hemocytometer (Fisher Scientific, cat. no. 0261710) Stage Micrometer (Fisher Scientific, cat. no. 12561SM1) Common zebrafish equipment (tanks, mating chambers, egg strainers) Paramecia for feeding fish (Paramecia VAP Company, ) QuickTime Player, version 7.0 (Apple Freeware, )

    TA Cloning:

    Article Title: Crystal structures of trypanosomal histidyl-tRNA synthetase illuminate differences between eukaryotic and prokaryotic homologs
    Article Snippet: The resulting amplicon was ligated by TA cloning into the vector p2T7TABlue (a gift of D. Horn, London School of Hygiene and Tropical Medicine) , and the sequence was confirmed by nucleotide sequence analysis of the insert. .. The construct was linearized with the NotI restriction enzyme (New England Biolabs, Ipswich, MA).

    Article Title: Glycogen Synthase Kinase 3 Is a Potential Drug Target for African Trypanosomiasis Therapy
    Article Snippet: The resultant amplicons were ligated by the use of TA cloning into the vector p2T7TABlue (a gift of D. Horn, London School of Hygiene and Tropical Medicine) , and their sequences were confirmed by nucleotide sequence analysis of the inserts. .. The constructs were linearized with the NotI restriction enzyme (New England Biolabs, Ipswich, MA).

    Construct:

    Article Title: Determinants of selective ion permeation in the epithelial Na+ channel
    Article Snippet: Paragraph title: Molecular constructs ... Plasmids containing rat ENaC α, β, and γ subunits ( ) were linearized with NotI restriction enzyme (New England Biolabs); complementary RNAs were transcribed with T7 RNA polymerase using the mMESSAGE mMACHINE kit (Ambion).

    Article Title: Crystal structures of trypanosomal histidyl-tRNA synthetase illuminate differences between eukaryotic and prokaryotic homologs
    Article Snippet: The resulting amplicon was ligated by TA cloning into the vector p2T7TABlue (a gift of D. Horn, London School of Hygiene and Tropical Medicine) , and the sequence was confirmed by nucleotide sequence analysis of the insert. .. The construct was linearized with the NotI restriction enzyme (New England Biolabs, Ipswich, MA). .. T. brucei bloodstream-form parasites (provided by G. Cross, Rockefeller University) expressing the T7 RNA polymerase and Tet repressor under a single selection marker (SM), G418 resistance, were cultured in HMI-9 medium with 10% heat-inactivated fetal bovine serum and G418 at 2.5 μ g/ml at 37°C in a 5% CO2 atmosphere .

    Article Title: Glycogen Synthase Kinase 3 Is a Potential Drug Target for African Trypanosomiasis Therapy
    Article Snippet: The resultant amplicons were ligated by the use of TA cloning into the vector p2T7TABlue (a gift of D. Horn, London School of Hygiene and Tropical Medicine) , and their sequences were confirmed by nucleotide sequence analysis of the inserts. .. The constructs were linearized with the NotI restriction enzyme (New England Biolabs, Ipswich, MA). .. T. brucei bloodstream-form (BSF) parasites (provided by.

    End-sequence Profiling:

    Article Title: Preserving Genome Integrity: The DdrA Protein of Deinococcus radiodurans R1Damage Response Protein Buys Time for Bacterial DNA Repair
    Article Snippet: After lysozyme treatment, agarose plugs were placed in ESP buffer (EDTA 0.5 M [pH 9–9.5], 1% lauroyl sarcosine, 1 mg/ml proteinase K) at 50 °C for 6 h, followed by a 2-d incubation at 37 °C. .. DNA contained within the agarose plugs was digested with 10 U of NotI restriction enzyme (New England Biolabs, Beverly, Massachusetts, United States) overnight at 37 °C.

    Electrophoresis:

    Article Title: Preserving Genome Integrity: The DdrA Protein of Deinococcus radiodurans R1Damage Response Protein Buys Time for Bacterial DNA Repair
    Article Snippet: Paragraph title: Pulsed-field gel electrophoresis ... DNA contained within the agarose plugs was digested with 10 U of NotI restriction enzyme (New England Biolabs, Beverly, Massachusetts, United States) overnight at 37 °C.

    Article Title: Human Leptospirosis Caused by a New, Antigenically Unique Leptospira Associated with a Rattus Species Reservoir in the Peruvian Amazon
    Article Snippet: Paragraph title: Pulsed Field Gel Electrophoresis (PFGE) Characterization of Isolates ... Agarose blocks containing leptospiral DNA were prepared and then digested with 30 units of NotI restriction enzyme (New England Biolabs, USA) for 2 hours at 37°C.

    Article Title: Role of SV40 Integration Site at Chromosomal Interval 1q21.1 in Immortalized CRL2504 Cells
    Article Snippet: The BAC clones BAC RP11-364B14 and 152L6 were retrofitted with MJ0X166 to incorporate neo marker, using a vector exchange procedure ( ). .. Briefly, human DNA inserts from the BAC clones were released by digestion with NotI restriction enzyme (New England Biolab, Beverly, MA) and separated by pulsed- field gel electrophoresis (PFGE). .. The purified inserts were mixed separately with NotI digested and dephosphorylated retrofitting vector pJMOX166 at a molar ratio of 2:1 or 4:1 and ligated using T4 DNA ligase at 16° C for 16 hours.

    Incubation:

    Article Title: Preserving Genome Integrity: The DdrA Protein of Deinococcus radiodurans R1Damage Response Protein Buys Time for Bacterial DNA Repair
    Article Snippet: After lysozyme treatment, agarose plugs were placed in ESP buffer (EDTA 0.5 M [pH 9–9.5], 1% lauroyl sarcosine, 1 mg/ml proteinase K) at 50 °C for 6 h, followed by a 2-d incubation at 37 °C. .. DNA contained within the agarose plugs was digested with 10 U of NotI restriction enzyme (New England Biolabs, Beverly, Massachusetts, United States) overnight at 37 °C.

    Article Title: Functional Characterization of a Juvenile Hormone Esterase Related Gene in the Moth Sesamia nonagrioides through RNA Interference
    Article Snippet: The pGEM T-easy/SnJHERloop plasmid ( ) was partially digested by incubating 1 µg of it with 1/10 U of the NotI restriction enzyme (New England Biolabs) for 5 minutes at 37°C. .. The recombinant plasmid pFastBac Actin-BGH /SnJHERloop , was transformed into competent DH10Bac/BmNPV-BmA::GFP cells.

    Article Title: Transcription of TP0126, Treponema pallidum Putative OmpW Homolog, Is Regulated by the Length of a Homopolymeric Guanosine Repeat
    Article Snippet: To obtain templates for the IVT assay, DNA fragments containing variants of the TP0126 promoter [with 7- to 12-nt-long poly(G) regions] followed by the GFP gene were excised from the pGlow-TOPO TA vectors used for the GFP reporter assay (see above). .. Each of the vectors was incubated with 10 U of ZraI overnight at 37°C, purified using the QIAquick PCR purification kit (Qiagen), and then incubated with the NotI restriction enzyme (both enzymes were from New England Biolabs, Ipswich, MA) overnight at 37°C. .. As positive and negative controls, respectively, a lac promoter-GFP fragment and the TP0574-GFP fragment (the no-promoter control) were also excised.

    Luciferase:

    Article Title: Viral oncomiR spreading between B and T cells is employed by Kaposi's sarcoma herpesvirus to induce non-cell-autonomous target gene regulation
    Article Snippet: These bioinformatics data were generated based on miRNA target prediction algorithms ( http://www.targetscan.org ); genomic sequence databases available from the UCSC genome browser ( http://genome.ucsc.edu ); and the Primer3 online tool ( http://frodo.wi.mit.edu/primer3 ). .. Next, the amplified fragment was cloned into pGEM T-easy vector (Promega, Madison, WI, USA), verified by sequencing and compared to the original human genome sequence. pGEM-BACH1 3′UTR was digested using NotI restriction enzyme (New England Biolabs Ltd.) and cloned into the psiCHECK2 vector (Promega, Madison, WI, USA) into the multiple cloning region located 3′ to the synthetic Renilla luciferase (hRluc) gene. .. Thereafter, a clone where the BACH1 3′UTR was inserted in the correct orientation was selected for future in vitro studies.

    Activity Assay:

    Article Title: Viral oncomiR spreading between B and T cells is employed by Kaposi's sarcoma herpesvirus to induce non-cell-autonomous target gene regulation
    Article Snippet: Next, the amplified fragment was cloned into pGEM T-easy vector (Promega, Madison, WI, USA), verified by sequencing and compared to the original human genome sequence. pGEM-BACH1 3′UTR was digested using NotI restriction enzyme (New England Biolabs Ltd.) and cloned into the psiCHECK2 vector (Promega, Madison, WI, USA) into the multiple cloning region located 3′ to the synthetic Renilla luciferase (hRluc) gene. .. Next, the amplified fragment was cloned into pGEM T-easy vector (Promega, Madison, WI, USA), verified by sequencing and compared to the original human genome sequence. pGEM-BACH1 3′UTR was digested using NotI restriction enzyme (New England Biolabs Ltd.) and cloned into the psiCHECK2 vector (Promega, Madison, WI, USA) into the multiple cloning region located 3′ to the synthetic Renilla luciferase (hRluc) gene.

    Expressing:

    Article Title: Viral oncomiR spreading between B and T cells is employed by Kaposi's sarcoma herpesvirus to induce non-cell-autonomous target gene regulation
    Article Snippet: Next, the amplified fragment was cloned into pGEM T-easy vector (Promega, Madison, WI, USA), verified by sequencing and compared to the original human genome sequence. pGEM-BACH1 3′UTR was digested using NotI restriction enzyme (New England Biolabs Ltd.) and cloned into the psiCHECK2 vector (Promega, Madison, WI, USA) into the multiple cloning region located 3′ to the synthetic Renilla luciferase (hRluc) gene. .. Thereafter, a clone where the BACH1 3′UTR was inserted in the correct orientation was selected for future in vitro studies.

    Article Title: Transcription of TP0126, Treponema pallidum Putative OmpW Homolog, Is Regulated by the Length of a Homopolymeric Guanosine Repeat
    Article Snippet: Each of the vectors was incubated with 10 U of ZraI overnight at 37°C, purified using the QIAquick PCR purification kit (Qiagen), and then incubated with the NotI restriction enzyme (both enzymes were from New England Biolabs, Ipswich, MA) overnight at 37°C. .. Excised fragments were separated from the vector through gel electrophoresis, purified using the QIAquick gel extraction kit (Qiagen), and quantitated spectrophotometrically.

    Article Title: Glycogen Synthase Kinase 3 Is a Potential Drug Target for African Trypanosomiasis Therapy
    Article Snippet: The constructs were linearized with the NotI restriction enzyme (New England Biolabs, Ipswich, MA). .. The constructs were linearized with the NotI restriction enzyme (New England Biolabs, Ipswich, MA).

    Article Title: High-throughput imaging of adult fluorescent zebrafish with an LED fluorescence macroscope
    Article Snippet: Permission was obtained from the Massachusetts General Hospital Subcommittee on Research Animal Care for the treatment of zebrafish in our laboratory. .. Zebrafish rag2- driven mouse Myc expression vector Zebrafish rag2- driven human kRASG12D expression vector Zebrafish rag2- driven fluorescent reporter KCl (5 M; Sigma-Aldrich, cat. no. P9541) Tris-EDTA (TE, 100×; Sigma-Aldrich, cat. no. T9285) PBS (1×; Gibco, cat. no. 10010-023) FBS (Gibco, cat. no. 16000-036) Liberase TM (Roche, cat. no. 0540119001) NotI restriction enzyme (New England Biolabs, cat. no. R0189) MassRuler High-Range DNA ladder (Fermentas, cat. no. R0621) Trypan Blue Vital Dye (1×; Gibco, cat. no. 15250-061) Phenol/chloroform (EMD Biochemicals, cat. no. 6805-OP) Tricaine-S (Western Chemical, cat. no. MS-222) Visible Implant Elastomer kit (Northwest Marine Technology, cat. no. IVIFE0004) Agarose HS (Denville Scientific, cat. no. CA3510-8) Ethidium Bromide (Sigma-Aldrich, cat. no. E1510) Ethanol (Pharmco-AAPER, cat. no. 111ACS200) Mineral oil (Fisher Scientific, cat. no. O121-1) Distilled water .. Microsyringe (no. 701N; Hamilton, cat. no. 80366) Nylon cell strainer (40 μm; BD Falcon, cat. no. 352340) Petri dishes (100 mm × 15 mm; BD Falcon, cat. no. 351029) Luer-slip syringe (1 ml; Fisher Scientific, cat. no. 03-377-20) Insulin needles (28 gauge; Fisher Scientific, cat. no. 20-023-377) Hemocytometer (Fisher Scientific, cat. no. 0261710) Stage Micrometer (Fisher Scientific, cat. no. 12561SM1) Common zebrafish equipment (tanks, mating chambers, egg strainers) Paramecia for feeding fish (Paramecia VAP Company, ) QuickTime Player, version 7.0 (Apple Freeware, )

    Western Blot:

    Article Title: High-throughput imaging of adult fluorescent zebrafish with an LED fluorescence macroscope
    Article Snippet: Permission was obtained from the Massachusetts General Hospital Subcommittee on Research Animal Care for the treatment of zebrafish in our laboratory. .. Zebrafish rag2- driven mouse Myc expression vector Zebrafish rag2- driven human kRASG12D expression vector Zebrafish rag2- driven fluorescent reporter KCl (5 M; Sigma-Aldrich, cat. no. P9541) Tris-EDTA (TE, 100×; Sigma-Aldrich, cat. no. T9285) PBS (1×; Gibco, cat. no. 10010-023) FBS (Gibco, cat. no. 16000-036) Liberase TM (Roche, cat. no. 0540119001) NotI restriction enzyme (New England Biolabs, cat. no. R0189) MassRuler High-Range DNA ladder (Fermentas, cat. no. R0621) Trypan Blue Vital Dye (1×; Gibco, cat. no. 15250-061) Phenol/chloroform (EMD Biochemicals, cat. no. 6805-OP) Tricaine-S (Western Chemical, cat. no. MS-222) Visible Implant Elastomer kit (Northwest Marine Technology, cat. no. IVIFE0004) Agarose HS (Denville Scientific, cat. no. CA3510-8) Ethidium Bromide (Sigma-Aldrich, cat. no. E1510) Ethanol (Pharmco-AAPER, cat. no. 111ACS200) Mineral oil (Fisher Scientific, cat. no. O121-1) Distilled water .. Microsyringe (no. 701N; Hamilton, cat. no. 80366) Nylon cell strainer (40 μm; BD Falcon, cat. no. 352340) Petri dishes (100 mm × 15 mm; BD Falcon, cat. no. 351029) Luer-slip syringe (1 ml; Fisher Scientific, cat. no. 03-377-20) Insulin needles (28 gauge; Fisher Scientific, cat. no. 20-023-377) Hemocytometer (Fisher Scientific, cat. no. 0261710) Stage Micrometer (Fisher Scientific, cat. no. 12561SM1) Common zebrafish equipment (tanks, mating chambers, egg strainers) Paramecia for feeding fish (Paramecia VAP Company, ) QuickTime Player, version 7.0 (Apple Freeware, )

    Transformation Assay:

    Article Title: Functional Characterization of a Juvenile Hormone Esterase Related Gene in the Moth Sesamia nonagrioides through RNA Interference
    Article Snippet: The pGEM T-easy/SnJHERloop plasmid ( ) was partially digested by incubating 1 µg of it with 1/10 U of the NotI restriction enzyme (New England Biolabs) for 5 minutes at 37°C. .. The pFastBac Actin-BGH transfer plasmid ( ) was digested with NotI and after dephosphorylation (0.5 U of Alkaline Phosphatase in 50 µl of restriction reaction for 30 min) was ligated with the NotI digested SnJHERloop construct ( ).

    Article Title: Role of SV40 Integration Site at Chromosomal Interval 1q21.1 in Immortalized CRL2504 Cells
    Article Snippet: Briefly, human DNA inserts from the BAC clones were released by digestion with NotI restriction enzyme (New England Biolab, Beverly, MA) and separated by pulsed- field gel electrophoresis (PFGE). .. The purified inserts were mixed separately with NotI digested and dephosphorylated retrofitting vector pJMOX166 at a molar ratio of 2:1 or 4:1 and ligated using T4 DNA ligase at 16° C for 16 hours.

    Electroporation:

    Article Title: Crystal structures of trypanosomal histidyl-tRNA synthetase illuminate differences between eukaryotic and prokaryotic homologs
    Article Snippet: The construct was linearized with the NotI restriction enzyme (New England Biolabs, Ipswich, MA). .. The construct was linearized with the NotI restriction enzyme (New England Biolabs, Ipswich, MA).

    Article Title: Glycogen Synthase Kinase 3 Is a Potential Drug Target for African Trypanosomiasis Therapy
    Article Snippet: The constructs were linearized with the NotI restriction enzyme (New England Biolabs, Ipswich, MA). .. The constructs were linearized with the NotI restriction enzyme (New England Biolabs, Ipswich, MA).

    Flow Cytometry:

    Article Title: Rapid TaqMan-Based Quantification of Chlorophyll d-Containing Cyanobacteria in the Genus Acaryochloris
    Article Snippet: Here, the plasmid insert was sequenced to confirm the correct insert (Macrogen, Seoul, South Korea) and then linearized using the NotI restriction enzyme (New England BioLabs, Ipswich, MA, USA), in order to avoid template overestimation due to plasmid supercoiling ( ). .. The plasmids were diluted into a copy number ranging from 108 to 100 in molecular biology-grade water for subsequent use as qPCR standard templates.

    Serial Dilution:

    Article Title: Characterization of Plasmodium ovale curtisi and P. ovale wallikeri in Western Kenya Utilizing a Novel Species-specific Real-time PCR Assay
    Article Snippet: The resulting non-linearized ten-fold serial dilution series was utilized as a standard curve in subsequent validation experiments including determination of the linear dynamic range, specificity, reproducibility, repeatability, and limit of detection. .. The effect of the conformation of the rbp2 plasmid on standard curve linearity was analyzed by linearizing the rbp2 plasmid using the NotI restriction enzyme (New England BioLabs Inc, Ipswich, MA, USA) according to the manufacturer’s protocol.

    Cell Culture:

    Article Title: Glycogen Synthase Kinase 3 Is a Potential Drug Target for African Trypanosomiasis Therapy
    Article Snippet: The constructs were linearized with the NotI restriction enzyme (New England Biolabs, Ipswich, MA). .. The constructs were linearized with the NotI restriction enzyme (New England Biolabs, Ipswich, MA).

    Generated:

    Article Title: Viral oncomiR spreading between B and T cells is employed by Kaposi's sarcoma herpesvirus to induce non-cell-autonomous target gene regulation
    Article Snippet: These bioinformatics data were generated based on miRNA target prediction algorithms ( http://www.targetscan.org ); genomic sequence databases available from the UCSC genome browser ( http://genome.ucsc.edu ); and the Primer3 online tool ( http://frodo.wi.mit.edu/primer3 ). .. Next, the amplified fragment was cloned into pGEM T-easy vector (Promega, Madison, WI, USA), verified by sequencing and compared to the original human genome sequence. pGEM-BACH1 3′UTR was digested using NotI restriction enzyme (New England Biolabs Ltd.) and cloned into the psiCHECK2 vector (Promega, Madison, WI, USA) into the multiple cloning region located 3′ to the synthetic Renilla luciferase (hRluc) gene.

    Sequencing:

    Article Title: The somite-secreted factor Maeg promotes zebrafish embryonic angiogenesis
    Article Snippet: Zebrafish maeg and mCherry coding sequence were cloned into PCS2+ vector. .. The vector template was linearized with NotI Restriction Enzyme (NEB).

    Article Title: Viral oncomiR spreading between B and T cells is employed by Kaposi's sarcoma herpesvirus to induce non-cell-autonomous target gene regulation
    Article Snippet: These bioinformatics data were generated based on miRNA target prediction algorithms ( http://www.targetscan.org ); genomic sequence databases available from the UCSC genome browser ( http://genome.ucsc.edu ); and the Primer3 online tool ( http://frodo.wi.mit.edu/primer3 ). .. Next, the amplified fragment was cloned into pGEM T-easy vector (Promega, Madison, WI, USA), verified by sequencing and compared to the original human genome sequence. pGEM-BACH1 3′UTR was digested using NotI restriction enzyme (New England Biolabs Ltd.) and cloned into the psiCHECK2 vector (Promega, Madison, WI, USA) into the multiple cloning region located 3′ to the synthetic Renilla luciferase (hRluc) gene. .. Thereafter, a clone where the BACH1 3′UTR was inserted in the correct orientation was selected for future in vitro studies.

    Article Title: Insm1a Regulates Motor Neuron Development in Zebrafish
    Article Snippet: Translation blocking antisense Morpholino (MOs; Gene Tools) against the ATG-containing sequence was designed (5′-AAATCCTCTGGGCATCTTCGCCAGC-3′) to target the translation start site according to the manufacturer's instruction and the other MO oligo (5′-CCTCTTACCTCAGTTACAATTTATA-3′) was used as standard control. .. The cDNAs containing the open reading frame of the target genes were cloned into PCS2+ vector respectively and then were transcribed in vitro using the mMESSAGE mMACHIN Kit (Ambion, USA) after the recombinant plasmids linearized with NotI Restriction Enzyme (NEB, England), and then the capped mRNAs were purified by RNeasy Mini Kit (Qiagen, Germany).

    Article Title: Crystal structures of trypanosomal histidyl-tRNA synthetase illuminate differences between eukaryotic and prokaryotic homologs
    Article Snippet: The resulting amplicon was ligated by TA cloning into the vector p2T7TABlue (a gift of D. Horn, London School of Hygiene and Tropical Medicine) , and the sequence was confirmed by nucleotide sequence analysis of the insert. .. The construct was linearized with the NotI restriction enzyme (New England Biolabs, Ipswich, MA).

    Article Title: Glycogen Synthase Kinase 3 Is a Potential Drug Target for African Trypanosomiasis Therapy
    Article Snippet: The resultant amplicons were ligated by the use of TA cloning into the vector p2T7TABlue (a gift of D. Horn, London School of Hygiene and Tropical Medicine) , and their sequences were confirmed by nucleotide sequence analysis of the inserts. .. The constructs were linearized with the NotI restriction enzyme (New England Biolabs, Ipswich, MA).

    Injection:

    Article Title: The somite-secreted factor Maeg promotes zebrafish embryonic angiogenesis
    Article Snippet: Paragraph title: Injection of morpholinos and mRNAs ... The vector template was linearized with NotI Restriction Enzyme (NEB).

    Article Title: Insm1a Regulates Motor Neuron Development in Zebrafish
    Article Snippet: The MOs were diluted to 0.3 mM with RNase-free water and injected into the yolk of one to two-cell stage embryos and then raised in E3 medium at 28.5°C. .. The cDNAs containing the open reading frame of the target genes were cloned into PCS2+ vector respectively and then were transcribed in vitro using the mMESSAGE mMACHIN Kit (Ambion, USA) after the recombinant plasmids linearized with NotI Restriction Enzyme (NEB, England), and then the capped mRNAs were purified by RNeasy Mini Kit (Qiagen, Germany).

    Binding Assay:

    Article Title: Viral oncomiR spreading between B and T cells is employed by Kaposi's sarcoma herpesvirus to induce non-cell-autonomous target gene regulation
    Article Snippet: BACH1 3′UTR was amplified from human genomic DNA by a specific set of primers (CCCTTGATTTCCTACCTCAGTG and CTTCGGCAGCCTCAAAAA) designed to include 3 putative hsa-miR-155 / KSHV-miR-K12-11 binding sites. .. Next, the amplified fragment was cloned into pGEM T-easy vector (Promega, Madison, WI, USA), verified by sequencing and compared to the original human genome sequence. pGEM-BACH1 3′UTR was digested using NotI restriction enzyme (New England Biolabs Ltd.) and cloned into the psiCHECK2 vector (Promega, Madison, WI, USA) into the multiple cloning region located 3′ to the synthetic Renilla luciferase (hRluc) gene.

    Pulsed-Field Gel:

    Article Title: Preserving Genome Integrity: The DdrA Protein of Deinococcus radiodurans R1Damage Response Protein Buys Time for Bacterial DNA Repair
    Article Snippet: Paragraph title: Pulsed-field gel electrophoresis ... DNA contained within the agarose plugs was digested with 10 U of NotI restriction enzyme (New England Biolabs, Beverly, Massachusetts, United States) overnight at 37 °C.

    Article Title: Human Leptospirosis Caused by a New, Antigenically Unique Leptospira Associated with a Rattus Species Reservoir in the Peruvian Amazon
    Article Snippet: Paragraph title: Pulsed Field Gel Electrophoresis (PFGE) Characterization of Isolates ... Agarose blocks containing leptospiral DNA were prepared and then digested with 30 units of NotI restriction enzyme (New England Biolabs, USA) for 2 hours at 37°C.

    Article Title: Role of SV40 Integration Site at Chromosomal Interval 1q21.1 in Immortalized CRL2504 Cells
    Article Snippet: The BAC clones BAC RP11-364B14 and 152L6 were retrofitted with MJ0X166 to incorporate neo marker, using a vector exchange procedure ( ). .. Briefly, human DNA inserts from the BAC clones were released by digestion with NotI restriction enzyme (New England Biolab, Beverly, MA) and separated by pulsed- field gel electrophoresis (PFGE). .. The purified inserts were mixed separately with NotI digested and dephosphorylated retrofitting vector pJMOX166 at a molar ratio of 2:1 or 4:1 and ligated using T4 DNA ligase at 16° C for 16 hours.

    Nucleic Acid Electrophoresis:

    Article Title: Transcription of TP0126, Treponema pallidum Putative OmpW Homolog, Is Regulated by the Length of a Homopolymeric Guanosine Repeat
    Article Snippet: Each of the vectors was incubated with 10 U of ZraI overnight at 37°C, purified using the QIAquick PCR purification kit (Qiagen), and then incubated with the NotI restriction enzyme (both enzymes were from New England Biolabs, Ipswich, MA) overnight at 37°C. .. Each of the vectors was incubated with 10 U of ZraI overnight at 37°C, purified using the QIAquick PCR purification kit (Qiagen), and then incubated with the NotI restriction enzyme (both enzymes were from New England Biolabs, Ipswich, MA) overnight at 37°C.

    Irradiation:

    Article Title: Preserving Genome Integrity: The DdrA Protein of Deinococcus radiodurans R1Damage Response Protein Buys Time for Bacterial DNA Repair
    Article Snippet: After irradiation at 5.0 kGy, cells were collected by centrifugation (6,000g, 15 min, 4 °C) and resuspended in either TGY broth or 10 mM MgSO4 solution, before being placed in a shaking incubator at 30 °C for 24 h. Aliquots of these cultures were removed at various time points, and cells were washed in 0.9% NaCl and suspended in 0.125 M EDTA (pH 8.0) at a density of 5 × 108 cells/ml. .. DNA contained within the agarose plugs was digested with 10 U of NotI restriction enzyme (New England Biolabs, Beverly, Massachusetts, United States) overnight at 37 °C.

    Mutagenesis:

    Article Title: Viral oncomiR spreading between B and T cells is employed by Kaposi's sarcoma herpesvirus to induce non-cell-autonomous target gene regulation
    Article Snippet: Paragraph title: BACH1 3′UTR mutagenesis and cloning into the psiCHECK2 vector ... Next, the amplified fragment was cloned into pGEM T-easy vector (Promega, Madison, WI, USA), verified by sequencing and compared to the original human genome sequence. pGEM-BACH1 3′UTR was digested using NotI restriction enzyme (New England Biolabs Ltd.) and cloned into the psiCHECK2 vector (Promega, Madison, WI, USA) into the multiple cloning region located 3′ to the synthetic Renilla luciferase (hRluc) gene.

    Isolation:

    Article Title: Role of SV40 Integration Site at Chromosomal Interval 1q21.1 in Immortalized CRL2504 Cells
    Article Snippet: Briefly, human DNA inserts from the BAC clones were released by digestion with NotI restriction enzyme (New England Biolab, Beverly, MA) and separated by pulsed- field gel electrophoresis (PFGE). .. An aliquot (1 μl) of the ligated products was transformed into competent DH-5α cells and cells were plated on LB agar plates containing chloramphenicol (12.5μg/ml) and kanamycin (30μg/ml).

    Purification:

    Article Title: Characterization of Plasmodium ovale curtisi and P. ovale wallikeri in Western Kenya Utilizing a Novel Species-specific Real-time PCR Assay
    Article Snippet: The effect of the conformation of the rbp2 plasmid on standard curve linearity was analyzed by linearizing the rbp2 plasmid using the NotI restriction enzyme (New England BioLabs Inc, Ipswich, MA, USA) according to the manufacturer’s protocol. .. Rbp2 plasmid linearization was confirmed by gel electrophoresis on a 0.7% agarose gel stained with ethidium bromide.

    Article Title: Insm1a Regulates Motor Neuron Development in Zebrafish
    Article Snippet: The MOs were diluted to 0.3 mM with RNase-free water and injected into the yolk of one to two-cell stage embryos and then raised in E3 medium at 28.5°C. .. The cDNAs containing the open reading frame of the target genes were cloned into PCS2+ vector respectively and then were transcribed in vitro using the mMESSAGE mMACHIN Kit (Ambion, USA) after the recombinant plasmids linearized with NotI Restriction Enzyme (NEB, England), and then the capped mRNAs were purified by RNeasy Mini Kit (Qiagen, Germany). .. 2 nl target genes and mCherry mRNA mixture (1:1) were injected at 20 ng/μl into 1/2-cell stage embryos.

    Article Title: Transcription of TP0126, Treponema pallidum Putative OmpW Homolog, Is Regulated by the Length of a Homopolymeric Guanosine Repeat
    Article Snippet: To obtain templates for the IVT assay, DNA fragments containing variants of the TP0126 promoter [with 7- to 12-nt-long poly(G) regions] followed by the GFP gene were excised from the pGlow-TOPO TA vectors used for the GFP reporter assay (see above). .. Each of the vectors was incubated with 10 U of ZraI overnight at 37°C, purified using the QIAquick PCR purification kit (Qiagen), and then incubated with the NotI restriction enzyme (both enzymes were from New England Biolabs, Ipswich, MA) overnight at 37°C. .. As positive and negative controls, respectively, a lac promoter-GFP fragment and the TP0574-GFP fragment (the no-promoter control) were also excised.

    Article Title: Rapid TaqMan-Based Quantification of Chlorophyll d-Containing Cyanobacteria in the Genus Acaryochloris
    Article Snippet: The resulting 102-bp fragment was purified on an agarose gel, excised using a sterile scalpel, purified (QiaexII; Qiagen Nordic, Sweden), and cloned into the TOPO-TA cloning vector (Invitrogen, Life Technologies Europe) by following the manufacturer's recommendations. .. Here, the plasmid insert was sequenced to confirm the correct insert (Macrogen, Seoul, South Korea) and then linearized using the NotI restriction enzyme (New England BioLabs, Ipswich, MA, USA), in order to avoid template overestimation due to plasmid supercoiling ( ).

    Polymerase Chain Reaction:

    Article Title: Characterization of Plasmodium ovale curtisi and P. ovale wallikeri in Western Kenya Utilizing a Novel Species-specific Real-time PCR Assay
    Article Snippet: We cloned the 74 base pair rbp2 amplicon into the pCR 2.1-TOPO TA vector (Life Technologies) following manufacturer’s guidelines and eluted the rbp2 plasmid in PCR grade water. .. The effect of the conformation of the rbp2 plasmid on standard curve linearity was analyzed by linearizing the rbp2 plasmid using the NotI restriction enzyme (New England BioLabs Inc, Ipswich, MA, USA) according to the manufacturer’s protocol.

    Article Title: Transcription of TP0126, Treponema pallidum Putative OmpW Homolog, Is Regulated by the Length of a Homopolymeric Guanosine Repeat
    Article Snippet: To obtain templates for the IVT assay, DNA fragments containing variants of the TP0126 promoter [with 7- to 12-nt-long poly(G) regions] followed by the GFP gene were excised from the pGlow-TOPO TA vectors used for the GFP reporter assay (see above). .. Each of the vectors was incubated with 10 U of ZraI overnight at 37°C, purified using the QIAquick PCR purification kit (Qiagen), and then incubated with the NotI restriction enzyme (both enzymes were from New England Biolabs, Ipswich, MA) overnight at 37°C. .. As positive and negative controls, respectively, a lac promoter-GFP fragment and the TP0574-GFP fragment (the no-promoter control) were also excised.

    Article Title: Rapid TaqMan-Based Quantification of Chlorophyll d-Containing Cyanobacteria in the Genus Acaryochloris
    Article Snippet: Plasmid standards for qPCR were prepared by amplifying the 16S rRNA gene fragment using AcmRv′ and AcmFv′ in conjunction with the PCR master mix (Promega, Madison, WI, USA) and DNA originating from the A. marina MBIC11017. .. Here, the plasmid insert was sequenced to confirm the correct insert (Macrogen, Seoul, South Korea) and then linearized using the NotI restriction enzyme (New England BioLabs, Ipswich, MA, USA), in order to avoid template overestimation due to plasmid supercoiling ( ).

    Blocking Assay:

    Article Title: Insm1a Regulates Motor Neuron Development in Zebrafish
    Article Snippet: Translation blocking antisense Morpholino (MOs; Gene Tools) against the ATG-containing sequence was designed (5′-AAATCCTCTGGGCATCTTCGCCAGC-3′) to target the translation start site according to the manufacturer's instruction and the other MO oligo (5′-CCTCTTACCTCAGTTACAATTTATA-3′) was used as standard control. .. The cDNAs containing the open reading frame of the target genes were cloned into PCS2+ vector respectively and then were transcribed in vitro using the mMESSAGE mMACHIN Kit (Ambion, USA) after the recombinant plasmids linearized with NotI Restriction Enzyme (NEB, England), and then the capped mRNAs were purified by RNeasy Mini Kit (Qiagen, Germany).

    Recombinant:

    Article Title: Functional Characterization of a Juvenile Hormone Esterase Related Gene in the Moth Sesamia nonagrioides through RNA Interference
    Article Snippet: The pGEM T-easy/SnJHERloop plasmid ( ) was partially digested by incubating 1 µg of it with 1/10 U of the NotI restriction enzyme (New England Biolabs) for 5 minutes at 37°C. .. The pFastBac Actin-BGH transfer plasmid ( ) was digested with NotI and after dephosphorylation (0.5 U of Alkaline Phosphatase in 50 µl of restriction reaction for 30 min) was ligated with the NotI digested SnJHERloop construct ( ).

    Article Title: Insm1a Regulates Motor Neuron Development in Zebrafish
    Article Snippet: The MOs were diluted to 0.3 mM with RNase-free water and injected into the yolk of one to two-cell stage embryos and then raised in E3 medium at 28.5°C. .. The cDNAs containing the open reading frame of the target genes were cloned into PCS2+ vector respectively and then were transcribed in vitro using the mMESSAGE mMACHIN Kit (Ambion, USA) after the recombinant plasmids linearized with NotI Restriction Enzyme (NEB, England), and then the capped mRNAs were purified by RNeasy Mini Kit (Qiagen, Germany). .. 2 nl target genes and mCherry mRNA mixture (1:1) were injected at 20 ng/μl into 1/2-cell stage embryos.

    Article Title: Transcription of TP0126, Treponema pallidum Putative OmpW Homolog, Is Regulated by the Length of a Homopolymeric Guanosine Repeat
    Article Snippet: Each of the vectors was incubated with 10 U of ZraI overnight at 37°C, purified using the QIAquick PCR purification kit (Qiagen), and then incubated with the NotI restriction enzyme (both enzymes were from New England Biolabs, Ipswich, MA) overnight at 37°C. .. Excised fragments were separated from the vector through gel electrophoresis, purified using the QIAquick gel extraction kit (Qiagen), and quantitated spectrophotometrically.

    Staining:

    Article Title: Preserving Genome Integrity: The DdrA Protein of Deinococcus radiodurans R1Damage Response Protein Buys Time for Bacterial DNA Repair
    Article Snippet: DNA contained within the agarose plugs was digested with 10 U of NotI restriction enzyme (New England Biolabs, Beverly, Massachusetts, United States) overnight at 37 °C. .. Restriction digests were analyzed on 1% agarose gels in 0.5X TBE, using a CHEF-MAPPER electrophoresis system (Bio-Rad, Hercules, California, United States) at 6 V/cm for 22 h at 12 °C, with a linear pulse ramp of 10–60 s and a switching angle of 120°.

    Article Title: Human Leptospirosis Caused by a New, Antigenically Unique Leptospira Associated with a Rattus Species Reservoir in the Peruvian Amazon
    Article Snippet: Agarose blocks containing leptospiral DNA were prepared and then digested with 30 units of NotI restriction enzyme (New England Biolabs, USA) for 2 hours at 37°C. .. Agarose blocks containing leptospiral DNA were prepared and then digested with 30 units of NotI restriction enzyme (New England Biolabs, USA) for 2 hours at 37°C.

    Plasmid Preparation:

    Article Title: Characterization of Plasmodium ovale curtisi and P. ovale wallikeri in Western Kenya Utilizing a Novel Species-specific Real-time PCR Assay
    Article Snippet: The resulting non-linearized ten-fold serial dilution series was utilized as a standard curve in subsequent validation experiments including determination of the linear dynamic range, specificity, reproducibility, repeatability, and limit of detection. .. The effect of the conformation of the rbp2 plasmid on standard curve linearity was analyzed by linearizing the rbp2 plasmid using the NotI restriction enzyme (New England BioLabs Inc, Ipswich, MA, USA) according to the manufacturer’s protocol. .. Rbp2 plasmid linearization was confirmed by gel electrophoresis on a 0.7% agarose gel stained with ethidium bromide.

    Article Title: The somite-secreted factor Maeg promotes zebrafish embryonic angiogenesis
    Article Snippet: Zebrafish maeg and mCherry coding sequence were cloned into PCS2+ vector. .. The vector template was linearized with NotI Restriction Enzyme (NEB). .. Sense-capped mRNAs were synthesized with SP6 mMESSAGE mMACHINE Kit (Ambion), purified with RNeasy Mini Kit (Qiagen), and dissolved in RNase free Ultrapure Water (Life Technologies).

    Article Title: Viral oncomiR spreading between B and T cells is employed by Kaposi's sarcoma herpesvirus to induce non-cell-autonomous target gene regulation
    Article Snippet: These bioinformatics data were generated based on miRNA target prediction algorithms ( http://www.targetscan.org ); genomic sequence databases available from the UCSC genome browser ( http://genome.ucsc.edu ); and the Primer3 online tool ( http://frodo.wi.mit.edu/primer3 ). .. Next, the amplified fragment was cloned into pGEM T-easy vector (Promega, Madison, WI, USA), verified by sequencing and compared to the original human genome sequence. pGEM-BACH1 3′UTR was digested using NotI restriction enzyme (New England Biolabs Ltd.) and cloned into the psiCHECK2 vector (Promega, Madison, WI, USA) into the multiple cloning region located 3′ to the synthetic Renilla luciferase (hRluc) gene. .. Thereafter, a clone where the BACH1 3′UTR was inserted in the correct orientation was selected for future in vitro studies.

    Article Title: Functional Characterization of a Juvenile Hormone Esterase Related Gene in the Moth Sesamia nonagrioides through RNA Interference
    Article Snippet: As control we used the BmNPV/BmA::GFP-BmA::dsLuciferase virus, a virus expressing double stranded molecules of the reference luciferase gene. .. The pGEM T-easy/SnJHERloop plasmid ( ) was partially digested by incubating 1 µg of it with 1/10 U of the NotI restriction enzyme (New England Biolabs) for 5 minutes at 37°C. .. The pFastBac Actin-BGH transfer plasmid ( ) was digested with NotI and after dephosphorylation (0.5 U of Alkaline Phosphatase in 50 µl of restriction reaction for 30 min) was ligated with the NotI digested SnJHERloop construct ( ).

    Article Title: Insm1a Regulates Motor Neuron Development in Zebrafish
    Article Snippet: The MOs were diluted to 0.3 mM with RNase-free water and injected into the yolk of one to two-cell stage embryos and then raised in E3 medium at 28.5°C. .. The cDNAs containing the open reading frame of the target genes were cloned into PCS2+ vector respectively and then were transcribed in vitro using the mMESSAGE mMACHIN Kit (Ambion, USA) after the recombinant plasmids linearized with NotI Restriction Enzyme (NEB, England), and then the capped mRNAs were purified by RNeasy Mini Kit (Qiagen, Germany). .. 2 nl target genes and mCherry mRNA mixture (1:1) were injected at 20 ng/μl into 1/2-cell stage embryos.

    Article Title: Crystal structures of trypanosomal histidyl-tRNA synthetase illuminate differences between eukaryotic and prokaryotic homologs
    Article Snippet: The resulting amplicon was ligated by TA cloning into the vector p2T7TABlue (a gift of D. Horn, London School of Hygiene and Tropical Medicine) , and the sequence was confirmed by nucleotide sequence analysis of the insert. .. The construct was linearized with the NotI restriction enzyme (New England Biolabs, Ipswich, MA).

    Article Title: Role of SV40 Integration Site at Chromosomal Interval 1q21.1 in Immortalized CRL2504 Cells
    Article Snippet: The BAC clones BAC RP11-364B14 and 152L6 were retrofitted with MJ0X166 to incorporate neo marker, using a vector exchange procedure ( ). .. Briefly, human DNA inserts from the BAC clones were released by digestion with NotI restriction enzyme (New England Biolab, Beverly, MA) and separated by pulsed- field gel electrophoresis (PFGE).

    Article Title: Transcription of TP0126, Treponema pallidum Putative OmpW Homolog, Is Regulated by the Length of a Homopolymeric Guanosine Repeat
    Article Snippet: Each of the vectors was incubated with 10 U of ZraI overnight at 37°C, purified using the QIAquick PCR purification kit (Qiagen), and then incubated with the NotI restriction enzyme (both enzymes were from New England Biolabs, Ipswich, MA) overnight at 37°C. .. Each of the vectors was incubated with 10 U of ZraI overnight at 37°C, purified using the QIAquick PCR purification kit (Qiagen), and then incubated with the NotI restriction enzyme (both enzymes were from New England Biolabs, Ipswich, MA) overnight at 37°C.

    Article Title: Glycogen Synthase Kinase 3 Is a Potential Drug Target for African Trypanosomiasis Therapy
    Article Snippet: The resultant amplicons were ligated by the use of TA cloning into the vector p2T7TABlue (a gift of D. Horn, London School of Hygiene and Tropical Medicine) , and their sequences were confirmed by nucleotide sequence analysis of the inserts. .. The constructs were linearized with the NotI restriction enzyme (New England Biolabs, Ipswich, MA).

    Article Title: Rapid TaqMan-Based Quantification of Chlorophyll d-Containing Cyanobacteria in the Genus Acaryochloris
    Article Snippet: Clones were grown in LB medium with the addition of kanamycin (50 μg ml−1 ), and plasmids were extracted using the Qiagen miniprep kit (Qiagen Nordic, Sweden). .. Here, the plasmid insert was sequenced to confirm the correct insert (Macrogen, Seoul, South Korea) and then linearized using the NotI restriction enzyme (New England BioLabs, Ipswich, MA, USA), in order to avoid template overestimation due to plasmid supercoiling ( ). .. Complete linearization was confirmed on an agarose gel, and the linearized plasmid was cleaned and concentrated using the DNA clean and concentrator kit (Zymo Research, California, USA).

    Article Title: High-throughput imaging of adult fluorescent zebrafish with an LED fluorescence macroscope
    Article Snippet: Permission was obtained from the Massachusetts General Hospital Subcommittee on Research Animal Care for the treatment of zebrafish in our laboratory. .. Zebrafish rag2- driven mouse Myc expression vector Zebrafish rag2- driven human kRASG12D expression vector Zebrafish rag2- driven fluorescent reporter KCl (5 M; Sigma-Aldrich, cat. no. P9541) Tris-EDTA (TE, 100×; Sigma-Aldrich, cat. no. T9285) PBS (1×; Gibco, cat. no. 10010-023) FBS (Gibco, cat. no. 16000-036) Liberase TM (Roche, cat. no. 0540119001) NotI restriction enzyme (New England Biolabs, cat. no. R0189) MassRuler High-Range DNA ladder (Fermentas, cat. no. R0621) Trypan Blue Vital Dye (1×; Gibco, cat. no. 15250-061) Phenol/chloroform (EMD Biochemicals, cat. no. 6805-OP) Tricaine-S (Western Chemical, cat. no. MS-222) Visible Implant Elastomer kit (Northwest Marine Technology, cat. no. IVIFE0004) Agarose HS (Denville Scientific, cat. no. CA3510-8) Ethidium Bromide (Sigma-Aldrich, cat. no. E1510) Ethanol (Pharmco-AAPER, cat. no. 111ACS200) Mineral oil (Fisher Scientific, cat. no. O121-1) Distilled water .. Microsyringe (no. 701N; Hamilton, cat. no. 80366) Nylon cell strainer (40 μm; BD Falcon, cat. no. 352340) Petri dishes (100 mm × 15 mm; BD Falcon, cat. no. 351029) Luer-slip syringe (1 ml; Fisher Scientific, cat. no. 03-377-20) Insulin needles (28 gauge; Fisher Scientific, cat. no. 20-023-377) Hemocytometer (Fisher Scientific, cat. no. 0261710) Stage Micrometer (Fisher Scientific, cat. no. 12561SM1) Common zebrafish equipment (tanks, mating chambers, egg strainers) Paramecia for feeding fish (Paramecia VAP Company, ) QuickTime Player, version 7.0 (Apple Freeware, )

    Real-time Polymerase Chain Reaction:

    Article Title: Characterization of Plasmodium ovale curtisi and P. ovale wallikeri in Western Kenya Utilizing a Novel Species-specific Real-time PCR Assay
    Article Snippet: Paragraph title: Real-time PCR assay to detect P. ovale ... The effect of the conformation of the rbp2 plasmid on standard curve linearity was analyzed by linearizing the rbp2 plasmid using the NotI restriction enzyme (New England BioLabs Inc, Ipswich, MA, USA) according to the manufacturer’s protocol.

    Article Title: Rapid TaqMan-Based Quantification of Chlorophyll d-Containing Cyanobacteria in the Genus Acaryochloris
    Article Snippet: Plasmid standards for qPCR were prepared by amplifying the 16S rRNA gene fragment using AcmRv′ and AcmFv′ in conjunction with the PCR master mix (Promega, Madison, WI, USA) and DNA originating from the A. marina MBIC11017. .. Here, the plasmid insert was sequenced to confirm the correct insert (Macrogen, Seoul, South Korea) and then linearized using the NotI restriction enzyme (New England BioLabs, Ipswich, MA, USA), in order to avoid template overestimation due to plasmid supercoiling ( ).

    Selection:

    Article Title: Crystal structures of trypanosomal histidyl-tRNA synthetase illuminate differences between eukaryotic and prokaryotic homologs
    Article Snippet: The region within the gene coding sequence to be used for RNAi was selected using the RNA target selection program RNAit to ensure that there was no significant sequence homology with other genes within the genome. .. The construct was linearized with the NotI restriction enzyme (New England Biolabs, Ipswich, MA).

    Article Title: Glycogen Synthase Kinase 3 Is a Potential Drug Target for African Trypanosomiasis Therapy
    Article Snippet: The regions within the T. brucei GSK-3 short and long gene-coding sequences selected for RNAi plasmid construction were determined by using the RNA target selection program RNAit , to ensure that there was no significant sequence homology with other genes within the genome. .. The constructs were linearized with the NotI restriction enzyme (New England Biolabs, Ipswich, MA).

    Agarose Gel Electrophoresis:

    Article Title: Rapid TaqMan-Based Quantification of Chlorophyll d-Containing Cyanobacteria in the Genus Acaryochloris
    Article Snippet: The resulting 102-bp fragment was purified on an agarose gel, excised using a sterile scalpel, purified (QiaexII; Qiagen Nordic, Sweden), and cloned into the TOPO-TA cloning vector (Invitrogen, Life Technologies Europe) by following the manufacturer's recommendations. .. Here, the plasmid insert was sequenced to confirm the correct insert (Macrogen, Seoul, South Korea) and then linearized using the NotI restriction enzyme (New England BioLabs, Ipswich, MA, USA), in order to avoid template overestimation due to plasmid supercoiling ( ).

    In Vitro:

    Article Title: Insm1a Regulates Motor Neuron Development in Zebrafish
    Article Snippet: The MOs were diluted to 0.3 mM with RNase-free water and injected into the yolk of one to two-cell stage embryos and then raised in E3 medium at 28.5°C. .. The cDNAs containing the open reading frame of the target genes were cloned into PCS2+ vector respectively and then were transcribed in vitro using the mMESSAGE mMACHIN Kit (Ambion, USA) after the recombinant plasmids linearized with NotI Restriction Enzyme (NEB, England), and then the capped mRNAs were purified by RNeasy Mini Kit (Qiagen, Germany). .. 2 nl target genes and mCherry mRNA mixture (1:1) were injected at 20 ng/μl into 1/2-cell stage embryos.

    Article Title: Transcription of TP0126, Treponema pallidum Putative OmpW Homolog, Is Regulated by the Length of a Homopolymeric Guanosine Repeat
    Article Snippet: An in vitro transcription (IVT) assay was developed to further confirm the results of the GFP reporter assay and to investigate whether the T. pallidum σ70 factor initiates TP0126 transcription, as predicted by BProm. .. Each of the vectors was incubated with 10 U of ZraI overnight at 37°C, purified using the QIAquick PCR purification kit (Qiagen), and then incubated with the NotI restriction enzyme (both enzymes were from New England Biolabs, Ipswich, MA) overnight at 37°C.

    Transgenic Assay:

    Article Title: High-throughput imaging of adult fluorescent zebrafish with an LED fluorescence macroscope
    Article Snippet: For the experiments outlined in this protocol, the wild-type strain AB (Zebrafish International Resource Center, cat. no. ZL1) and the syngeneic strain CG1 (refs. , ) were used, as were transgenic fish expressing a fluorescent reporter under the mylz2 muscle promoter ▲ CRITICAL All zebrafish experiments should be performed in accordance with relevant guidelines and regulations approved by institutional animal care and use committees. .. Zebrafish rag2- driven mouse Myc expression vector Zebrafish rag2- driven human kRASG12D expression vector Zebrafish rag2- driven fluorescent reporter KCl (5 M; Sigma-Aldrich, cat. no. P9541) Tris-EDTA (TE, 100×; Sigma-Aldrich, cat. no. T9285) PBS (1×; Gibco, cat. no. 10010-023) FBS (Gibco, cat. no. 16000-036) Liberase TM (Roche, cat. no. 0540119001) NotI restriction enzyme (New England Biolabs, cat. no. R0189) MassRuler High-Range DNA ladder (Fermentas, cat. no. R0621) Trypan Blue Vital Dye (1×; Gibco, cat. no. 15250-061) Phenol/chloroform (EMD Biochemicals, cat. no. 6805-OP) Tricaine-S (Western Chemical, cat. no. MS-222) Visible Implant Elastomer kit (Northwest Marine Technology, cat. no. IVIFE0004) Agarose HS (Denville Scientific, cat. no. CA3510-8) Ethidium Bromide (Sigma-Aldrich, cat. no. E1510) Ethanol (Pharmco-AAPER, cat. no. 111ACS200) Mineral oil (Fisher Scientific, cat. no. O121-1) Distilled water

    Spectrophotometry:

    Article Title: Characterization of Plasmodium ovale curtisi and P. ovale wallikeri in Western Kenya Utilizing a Novel Species-specific Real-time PCR Assay
    Article Snippet: The approximate rbp2 amplicon copy number per microliter was determined based on spectrophotometer (Nanodrop 2000c) concentration in nanograms per microliter. .. The effect of the conformation of the rbp2 plasmid on standard curve linearity was analyzed by linearizing the rbp2 plasmid using the NotI restriction enzyme (New England BioLabs Inc, Ipswich, MA, USA) according to the manufacturer’s protocol.

    Concentration Assay:

    Article Title: Characterization of Plasmodium ovale curtisi and P. ovale wallikeri in Western Kenya Utilizing a Novel Species-specific Real-time PCR Assay
    Article Snippet: The approximate rbp2 amplicon copy number per microliter was determined based on spectrophotometer (Nanodrop 2000c) concentration in nanograms per microliter. .. The effect of the conformation of the rbp2 plasmid on standard curve linearity was analyzed by linearizing the rbp2 plasmid using the NotI restriction enzyme (New England BioLabs Inc, Ipswich, MA, USA) according to the manufacturer’s protocol.

    Article Title: Preserving Genome Integrity: The DdrA Protein of Deinococcus radiodurans R1Damage Response Protein Buys Time for Bacterial DNA Repair
    Article Snippet: The suspensions were mixed with low-melting-point agarose (Sigma) to obtain a final concentration of 0.8% agarose. .. DNA contained within the agarose plugs was digested with 10 U of NotI restriction enzyme (New England Biolabs, Beverly, Massachusetts, United States) overnight at 37 °C.

    Article Title: The somite-secreted factor Maeg promotes zebrafish embryonic angiogenesis
    Article Snippet: Morpholino antisense oligos (MOs; Gene Tools) were prepared at a stock concentration of 1 mM according to the manufacturer's instruction. .. The vector template was linearized with NotI Restriction Enzyme (NEB).

    Article Title: Rapid TaqMan-Based Quantification of Chlorophyll d-Containing Cyanobacteria in the Genus Acaryochloris
    Article Snippet: Here, the plasmid insert was sequenced to confirm the correct insert (Macrogen, Seoul, South Korea) and then linearized using the NotI restriction enzyme (New England BioLabs, Ipswich, MA, USA), in order to avoid template overestimation due to plasmid supercoiling ( ). .. Complete linearization was confirmed on an agarose gel, and the linearized plasmid was cleaned and concentrated using the DNA clean and concentrator kit (Zymo Research, California, USA).

    BAC Assay:

    Article Title: Role of SV40 Integration Site at Chromosomal Interval 1q21.1 in Immortalized CRL2504 Cells
    Article Snippet: The BAC clones BAC RP11-364B14 and 152L6 were retrofitted with MJ0X166 to incorporate neo marker, using a vector exchange procedure ( ). .. Briefly, human DNA inserts from the BAC clones were released by digestion with NotI restriction enzyme (New England Biolab, Beverly, MA) and separated by pulsed- field gel electrophoresis (PFGE). .. The purified inserts were mixed separately with NotI digested and dephosphorylated retrofitting vector pJMOX166 at a molar ratio of 2:1 or 4:1 and ligated using T4 DNA ligase at 16° C for 16 hours.

    Marker:

    Article Title: Role of SV40 Integration Site at Chromosomal Interval 1q21.1 in Immortalized CRL2504 Cells
    Article Snippet: The BAC clones BAC RP11-364B14 and 152L6 were retrofitted with MJ0X166 to incorporate neo marker, using a vector exchange procedure ( ). .. Briefly, human DNA inserts from the BAC clones were released by digestion with NotI restriction enzyme (New England Biolab, Beverly, MA) and separated by pulsed- field gel electrophoresis (PFGE).

    Article Title: Glycogen Synthase Kinase 3 Is a Potential Drug Target for African Trypanosomiasis Therapy
    Article Snippet: The constructs were linearized with the NotI restriction enzyme (New England Biolabs, Ipswich, MA). .. The constructs were linearized with the NotI restriction enzyme (New England Biolabs, Ipswich, MA).

    Gel Extraction:

    Article Title: Transcription of TP0126, Treponema pallidum Putative OmpW Homolog, Is Regulated by the Length of a Homopolymeric Guanosine Repeat
    Article Snippet: Each of the vectors was incubated with 10 U of ZraI overnight at 37°C, purified using the QIAquick PCR purification kit (Qiagen), and then incubated with the NotI restriction enzyme (both enzymes were from New England Biolabs, Ipswich, MA) overnight at 37°C. .. Each of the vectors was incubated with 10 U of ZraI overnight at 37°C, purified using the QIAquick PCR purification kit (Qiagen), and then incubated with the NotI restriction enzyme (both enzymes were from New England Biolabs, Ipswich, MA) overnight at 37°C.

    Fluorescence In Situ Hybridization:

    Article Title: High-throughput imaging of adult fluorescent zebrafish with an LED fluorescence macroscope
    Article Snippet: For the experiments outlined in this protocol, the wild-type strain AB (Zebrafish International Resource Center, cat. no. ZL1) and the syngeneic strain CG1 (refs. , ) were used, as were transgenic fish expressing a fluorescent reporter under the mylz2 muscle promoter ▲ CRITICAL All zebrafish experiments should be performed in accordance with relevant guidelines and regulations approved by institutional animal care and use committees. .. Zebrafish rag2- driven mouse Myc expression vector Zebrafish rag2- driven human kRASG12D expression vector Zebrafish rag2- driven fluorescent reporter KCl (5 M; Sigma-Aldrich, cat. no. P9541) Tris-EDTA (TE, 100×; Sigma-Aldrich, cat. no. T9285) PBS (1×; Gibco, cat. no. 10010-023) FBS (Gibco, cat. no. 16000-036) Liberase TM (Roche, cat. no. 0540119001) NotI restriction enzyme (New England Biolabs, cat. no. R0189) MassRuler High-Range DNA ladder (Fermentas, cat. no. R0621) Trypan Blue Vital Dye (1×; Gibco, cat. no. 15250-061) Phenol/chloroform (EMD Biochemicals, cat. no. 6805-OP) Tricaine-S (Western Chemical, cat. no. MS-222) Visible Implant Elastomer kit (Northwest Marine Technology, cat. no. IVIFE0004) Agarose HS (Denville Scientific, cat. no. CA3510-8) Ethidium Bromide (Sigma-Aldrich, cat. no. E1510) Ethanol (Pharmco-AAPER, cat. no. 111ACS200) Mineral oil (Fisher Scientific, cat. no. O121-1) Distilled water

    Hood:

    Article Title: Rapid TaqMan-Based Quantification of Chlorophyll d-Containing Cyanobacteria in the Genus Acaryochloris
    Article Snippet: Here, the plasmid insert was sequenced to confirm the correct insert (Macrogen, Seoul, South Korea) and then linearized using the NotI restriction enzyme (New England BioLabs, Ipswich, MA, USA), in order to avoid template overestimation due to plasmid supercoiling ( ). .. The plasmids were diluted into a copy number ranging from 108 to 100 in molecular biology-grade water for subsequent use as qPCR standard templates.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    New England Biolabs noti restriction enzyme
    Noti Restriction Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/noti restriction enzyme/product/New England Biolabs
    Average 94 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    noti restriction enzyme - by Bioz Stars, 2019-10
    94/100 stars
      Buy from Supplier

    Image Search Results