tcsc5d amplification  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    New England Biolabs tcsc5d amplification
    Key polymorphic sites in the T. cruzi <t>TcSC5D</t> gene. A: diploid genotypes built from identified highly informative sites (see main text), showing a section of one chromatogram around the tetra-allelic SNP at position 657. B: Summary of observed nucleotide changes between DTUs for these six sites. In the case of the comparisons with the TcII DTU, this is the minimum expected number of changes (marked with * in the figure), because of the diversity observed at position 618 in strains from this DTU.
    Tcsc5d Amplification, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 86/100, based on 819 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tcsc5d amplification/product/New England Biolabs
    Average 86 stars, based on 819 article reviews
    Price from $9.99 to $1999.99
    tcsc5d amplification - by Bioz Stars, 2020-04
    86/100 stars

    Images

    1) Product Images from "A Simple Strain Typing Assay for Trypanosoma cruzi: Discrimination of Major Evolutionary Lineages from a Single Amplification Product"

    Article Title: A Simple Strain Typing Assay for Trypanosoma cruzi: Discrimination of Major Evolutionary Lineages from a Single Amplification Product

    Journal: PLoS Neglected Tropical Diseases

    doi: 10.1371/journal.pntd.0001777

    Key polymorphic sites in the T. cruzi TcSC5D gene. A: diploid genotypes built from identified highly informative sites (see main text), showing a section of one chromatogram around the tetra-allelic SNP at position 657. B: Summary of observed nucleotide changes between DTUs for these six sites. In the case of the comparisons with the TcII DTU, this is the minimum expected number of changes (marked with * in the figure), because of the diversity observed at position 618 in strains from this DTU.
    Figure Legend Snippet: Key polymorphic sites in the T. cruzi TcSC5D gene. A: diploid genotypes built from identified highly informative sites (see main text), showing a section of one chromatogram around the tetra-allelic SNP at position 657. B: Summary of observed nucleotide changes between DTUs for these six sites. In the case of the comparisons with the TcII DTU, this is the minimum expected number of changes (marked with * in the figure), because of the diversity observed at position 618 in strains from this DTU.

    Techniques Used:

    The TcSC5D locus as a lineage discriminant marker. A: schematic view of the TcSC5D amplicon, with all identified SNPs, including key discriminant positions (marked in blue), and polymorphic HpaI/SphI restriction enzyme sites, showing their presence/absence in each lineage. B: Restriction fragment length polymorphism analysis of the TcSC5D amplification product. Fragments of the SphI/HpaI double digestion were resolved in a 2% TBE-agarose gel. Lanes in the gel correspond to: molecular size markers (lane 1), and DNA from T. cruzi strains (lanes 2–21). These are: Sylvio X10 (lane 3), Dm28c (4), and CAI72 (5) for DTU TcI; MAS1 cl1 (6), TU18 cl93 (7), and IVV cl4 (8) for DTU TcII; M6241 cl6 (9), M5631 cl5 (10), and X109/2 (11) for DUT TcIII; CanIII cl1(12), Dog Theis (13) and 92122102R (14) for DTU TcIV; Sc43 (15), MN cl2 (16) and Teh53 (17) for DTU TcV; CL-Brener (18), P63 cl1 (19), and Tulahuen cl2 (20) for DTU TcVI; and TCC1994 and TCC1122 for DTU Tcbat. The corresponding locus from T. cruzi marinkellei was analyzed in lanes 22/23 (stocks B3 and B7).
    Figure Legend Snippet: The TcSC5D locus as a lineage discriminant marker. A: schematic view of the TcSC5D amplicon, with all identified SNPs, including key discriminant positions (marked in blue), and polymorphic HpaI/SphI restriction enzyme sites, showing their presence/absence in each lineage. B: Restriction fragment length polymorphism analysis of the TcSC5D amplification product. Fragments of the SphI/HpaI double digestion were resolved in a 2% TBE-agarose gel. Lanes in the gel correspond to: molecular size markers (lane 1), and DNA from T. cruzi strains (lanes 2–21). These are: Sylvio X10 (lane 3), Dm28c (4), and CAI72 (5) for DTU TcI; MAS1 cl1 (6), TU18 cl93 (7), and IVV cl4 (8) for DTU TcII; M6241 cl6 (9), M5631 cl5 (10), and X109/2 (11) for DUT TcIII; CanIII cl1(12), Dog Theis (13) and 92122102R (14) for DTU TcIV; Sc43 (15), MN cl2 (16) and Teh53 (17) for DTU TcV; CL-Brener (18), P63 cl1 (19), and Tulahuen cl2 (20) for DTU TcVI; and TCC1994 and TCC1122 for DTU Tcbat. The corresponding locus from T. cruzi marinkellei was analyzed in lanes 22/23 (stocks B3 and B7).

    Techniques Used: Marker, Amplification, Agarose Gel Electrophoresis

    Proposed typing strategy based on the TcSC5D locus. A : the highly streamlined TcSC5D-PCR-RFLP assay can discriminate all non-hybrid lineages. If discrimination of DTUs TcV from TcVI is necessary, sequencing of the TcSC5D amplification locus is required. B : alternatively, if the method of choice is the PCR-RFLP, then a second locus can be assayed to resolve these DTUs. This additional locus can be the TcMK gene as shown in the figure (this work, see main text), or the gp72 gene (polymorphic Taq I site [41] ).
    Figure Legend Snippet: Proposed typing strategy based on the TcSC5D locus. A : the highly streamlined TcSC5D-PCR-RFLP assay can discriminate all non-hybrid lineages. If discrimination of DTUs TcV from TcVI is necessary, sequencing of the TcSC5D amplification locus is required. B : alternatively, if the method of choice is the PCR-RFLP, then a second locus can be assayed to resolve these DTUs. This additional locus can be the TcMK gene as shown in the figure (this work, see main text), or the gp72 gene (polymorphic Taq I site [41] ).

    Techniques Used: Polymerase Chain Reaction, RFLP Assay, Sequencing, Amplification

    2) Product Images from "DNA content analysis allows discrimination between Trypanosoma cruzi and Trypanosoma rangeli"

    Article Title: DNA content analysis allows discrimination between Trypanosoma cruzi and Trypanosoma rangeli

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0189907

    Genetic characterization Trypanosoma cruzi and Trypanosoma rangeli strains. (A) kDNA analysis of T . rangeli strains in a silver stained 6% polyacrylamide gel containing PCR products obtained with primers S35/S36/KP1L. The presence of a 165-bp band indicates the presence of KP1 minicircles. (B) Detection of the 832-bp fragment of TcSC5D gene in T . cruzi strains and clone. (C) PCR–RFLP of TcSC5D products digested with Hpa I and Sph I enzymes. MM: Molecular marker 100bp. NTC: No-template control.
    Figure Legend Snippet: Genetic characterization Trypanosoma cruzi and Trypanosoma rangeli strains. (A) kDNA analysis of T . rangeli strains in a silver stained 6% polyacrylamide gel containing PCR products obtained with primers S35/S36/KP1L. The presence of a 165-bp band indicates the presence of KP1 minicircles. (B) Detection of the 832-bp fragment of TcSC5D gene in T . cruzi strains and clone. (C) PCR–RFLP of TcSC5D products digested with Hpa I and Sph I enzymes. MM: Molecular marker 100bp. NTC: No-template control.

    Techniques Used: Staining, Polymerase Chain Reaction, Marker

    3) Product Images from "A Simple Strain Typing Assay for Trypanosoma cruzi: Discrimination of Major Evolutionary Lineages from a Single Amplification Product"

    Article Title: A Simple Strain Typing Assay for Trypanosoma cruzi: Discrimination of Major Evolutionary Lineages from a Single Amplification Product

    Journal: PLoS Neglected Tropical Diseases

    doi: 10.1371/journal.pntd.0001777

    Restriction fragment length polymorphism analysis of the TcMK amplification product. A: a multiple sequence alignment of the 5′-UTR just upstream of the translational start codon, showing the polymorphic Xho I site. A solid line box marks the Xho I site in TcV strains. B: Agarose gel electrophoresis showing a PCR-RFLP analysis of selected strains. Strains analyzed were: Sc43 cl9, MN cl2, LL014 and Teh53 for DTU TcV; and Tulahuen cl2, CL-Brener, Tul2 and P63 cl1 for DTU TcVI.
    Figure Legend Snippet: Restriction fragment length polymorphism analysis of the TcMK amplification product. A: a multiple sequence alignment of the 5′-UTR just upstream of the translational start codon, showing the polymorphic Xho I site. A solid line box marks the Xho I site in TcV strains. B: Agarose gel electrophoresis showing a PCR-RFLP analysis of selected strains. Strains analyzed were: Sc43 cl9, MN cl2, LL014 and Teh53 for DTU TcV; and Tulahuen cl2, CL-Brener, Tul2 and P63 cl1 for DTU TcVI.

    Techniques Used: Amplification, Sequencing, Agarose Gel Electrophoresis, Polymerase Chain Reaction

    4) Product Images from "DNA content analysis allows discrimination between Trypanosoma cruzi and Trypanosoma rangeli"

    Article Title: DNA content analysis allows discrimination between Trypanosoma cruzi and Trypanosoma rangeli

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0189907

    Genetic characterization Trypanosoma cruzi and Trypanosoma rangeli strains. (A) kDNA analysis of T . rangeli strains in a silver stained 6% polyacrylamide gel containing PCR products obtained with primers S35/S36/KP1L. The presence of a 165-bp band indicates the presence of KP1 minicircles. (B) Detection of the 832-bp fragment of TcSC5D gene in T . cruzi strains and clone. (C) PCR–RFLP of TcSC5D products digested with Hpa I and Sph I enzymes. MM: Molecular marker 100bp. NTC: No-template control.
    Figure Legend Snippet: Genetic characterization Trypanosoma cruzi and Trypanosoma rangeli strains. (A) kDNA analysis of T . rangeli strains in a silver stained 6% polyacrylamide gel containing PCR products obtained with primers S35/S36/KP1L. The presence of a 165-bp band indicates the presence of KP1 minicircles. (B) Detection of the 832-bp fragment of TcSC5D gene in T . cruzi strains and clone. (C) PCR–RFLP of TcSC5D products digested with Hpa I and Sph I enzymes. MM: Molecular marker 100bp. NTC: No-template control.

    Techniques Used: Staining, Polymerase Chain Reaction, Marker

    5) Product Images from "DNA content analysis allows discrimination between Trypanosoma cruzi and Trypanosoma rangeli"

    Article Title: DNA content analysis allows discrimination between Trypanosoma cruzi and Trypanosoma rangeli

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0189907

    Genetic characterization Trypanosoma cruzi and Trypanosoma rangeli strains. (A) kDNA analysis of T . rangeli strains in a silver stained 6% polyacrylamide gel containing PCR products obtained with primers S35/S36/KP1L. The presence of a 165-bp band indicates the presence of KP1 minicircles. (B) Detection of the 832-bp fragment of TcSC5D gene in T . cruzi strains and clone. (C) PCR–RFLP of TcSC5D products digested with Hpa I and Sph I enzymes. MM: Molecular marker 100bp. NTC: No-template control.
    Figure Legend Snippet: Genetic characterization Trypanosoma cruzi and Trypanosoma rangeli strains. (A) kDNA analysis of T . rangeli strains in a silver stained 6% polyacrylamide gel containing PCR products obtained with primers S35/S36/KP1L. The presence of a 165-bp band indicates the presence of KP1 minicircles. (B) Detection of the 832-bp fragment of TcSC5D gene in T . cruzi strains and clone. (C) PCR–RFLP of TcSC5D products digested with Hpa I and Sph I enzymes. MM: Molecular marker 100bp. NTC: No-template control.

    Techniques Used: Staining, Polymerase Chain Reaction, Marker

    Related Articles

    Clone Assay:

    Article Title: Generation of Recombinant Vaccinia Viruses via Green Fluorescent Protein Selection
    Article Snippet: .. Next, the fragment was digested with Xho I and Bam HI, purified in a 1% agarose gel, and cloned into vector pIRES2-EGFP, which had been linearized with Xho I and Bam HI (New England Biolabs, Ipswich, MA). .. The resulting construct was used as a template to obtain the expression cassette GFP–IRES–envC by PCR.

    Article Title: A partial form of recessive STAT1 deficiency in humans
    Article Snippet: PCR products and empty pSPL3 plasmids (provided by Ralph Burkhardt, The Rockefeller University) were digested with Xho I and BamH 1 (New England BioLabs). .. Positive clones were identified by double enzyme digestion and sequencing.

    Article Title: A rationally designed nanoparticle for RNA interference therapy in B-lineage lymphoid malignancies
    Article Snippet: The correct PCR products (FL: 2541-bp and ΔE12–14: 2208-bp) were ligated into the 8497-bp lentiviral vector pCL6-2AEGwo through the NheI and XhoI restriction sites (underlined) using the Quick Ligase kit (New England Biolabs catalog no. M2200L) following the manufacturer's instructions. .. The pCL6-2AEGwo lentiviral backbone vector, a kind gift from Dr. Zanxian Xia, School of Biological Science and Technology, Central South University, Changsha, Hunan 410078, China, contains both a “ribosome-skip” fragment encoding the 2A-like peptide APVKQTLNFDLLKLAGDVESNPGP and an in-frame eGFP fluorescent coding sequence downstream of a multiple cloning site.

    Amplification:

    Article Title:
    Article Snippet: Genomic DNA sequence at the sites of mutagenesis was determined from PCR products amplified using primers as shown , with genomic DNA isolated from mouse tail as the template. .. Restriction enzyme analysis of PCR products containing the CYP2B6 exon-9 region was performed by incubating 2 μ g DNA with 100 U XhoI (NEB) overnight.

    Article Title: A partial form of recessive STAT1 deficiency in humans
    Article Snippet: We amplified STAT1 genomic DNA from nucleotide 36989 to 38523 ( ) with the following primers: forward, 5′cgcCTCGAG( Xho I)cctccctttattttccctga3′; reverse, 5′cgcGGATCC( BamH I)ttcagctgtgatggcgatag3′. .. PCR products and empty pSPL3 plasmids (provided by Ralph Burkhardt, The Rockefeller University) were digested with Xho I and BamH 1 (New England BioLabs).

    Article Title: A rationally designed nanoparticle for RNA interference therapy in B-lineage lymphoid malignancies
    Article Snippet: 2.8 Preparation of a Human Full-length CD22 and CD22ΔE12–14 Plasmids The cDNA fragments encoding either full-length CD22 (CD22FL) or truncated CD22 lacking exons 12–14 (CD22ΔE12–14) were generated by PCR amplification using the Phusion High Fidelity PCR Kit (New England Biolabs, catalog no. E0553L) with the following primer sets: full-length Fwd/Rev 5′-CTTGGT GCTAGC ATGCATCTCCTCGGC-3′/5′CCGG TCTCGAG GATGTTTGAGGATCACATAGTC-3′, and truncation ΔE12–14 Fwd/Rev 5′-CTTGGT GCTAGC ATGCATCTCCTCGGC-3′/5′-CCGGT CTCGAG CCTTTTTATTCCTCAC-3′. .. The correct PCR products (FL: 2541-bp and ΔE12–14: 2208-bp) were ligated into the 8497-bp lentiviral vector pCL6-2AEGwo through the NheI and XhoI restriction sites (underlined) using the Quick Ligase kit (New England Biolabs catalog no. M2200L) following the manufacturer's instructions.

    Positive Control:

    Article Title:
    Article Snippet: The transgene copy number in 2A13-TG(+/−) mice was estimated through densitometric analysis of the 5.1-kbp CYP2A13 -specific band detected, with DNA from CYP2A13/2B6/2F1-TG(+/+) mice as the positive control (and standard for quantification) and DNA from B6 wild-type (WT) mice as the negative control. .. Restriction enzyme analysis of PCR products containing the CYP2B6 exon-9 region was performed by incubating 2 μ g DNA with 100 U XhoI (NEB) overnight.

    Molecular Cloning:

    Article Title: Generation of Recombinant Vaccinia Viruses via Green Fluorescent Protein Selection
    Article Snippet: Paragraph title: Primers, polymerase chain reaction, and molecular cloning ... Next, the fragment was digested with Xho I and Bam HI, purified in a 1% agarose gel, and cloned into vector pIRES2-EGFP, which had been linearized with Xho I and Bam HI (New England Biolabs, Ipswich, MA).

    Construct:

    Article Title: Generation of Recombinant Vaccinia Viruses via Green Fluorescent Protein Selection
    Article Snippet: Next, the fragment was digested with Xho I and Bam HI, purified in a 1% agarose gel, and cloned into vector pIRES2-EGFP, which had been linearized with Xho I and Bam HI (New England Biolabs, Ipswich, MA). .. The resulting construct was used as a template to obtain the expression cassette GFP–IRES–envC by PCR.

    Electrophoresis:

    Article Title:
    Article Snippet: Hind III-digested genomic DNA was fractionated by electrophoresis on 0.7% agarose gels, transferred to nylon membranes, and analyzed using a 32 P-labeled DNA probe corresponding to CYP2A13 exon 2, as described elsewhere ( ). .. Restriction enzyme analysis of PCR products containing the CYP2B6 exon-9 region was performed by incubating 2 μ g DNA with 100 U XhoI (NEB) overnight.

    Incubation:

    Article Title: Effects of size and topology of DNA molecules on intracellular delivery with non-viral gene carriers
    Article Snippet: .. Linear DNA (l-DNA) Purified c-DNA was linearized using the restriction enzyme, Xho I (New England Biolabs; Pickering, ON) for pORF9-hTNFRS11b or Cla I (Invitrogen; Burlington, ON) for pEGFP-N2, Restriction digestion were set up with 5 μg of DNA per 50 μL of reaction volume containing 3 units of enzyme and incubated at 37°C for 16 hours. .. The enzyme was then heat-inactivated by incubating the mixture at 65°C for 10 min. Digested DNA was purified using QIAEX II Gel Extraction Kit (Qiagen, Mississauga, ON).

    Article Title: Retrofitting the BAC cloning vector pBeloBAC11 by the insertion of a mutant loxP site
    Article Snippet: A 500-fold molar excess of the double-stranded oligonucleotide was incubated with pBeloBac11 DNA that had been digested with Sfi I for 2 h at 37 °C (New England BioLabs) in the presence of 1 U of T4 DNA ligase (Invitrogen) at 15 °C overnight. .. The DNA samples were digested with 10 U of Xho I for 2 h at 37 °C (New England BioLabs) and electrophoresed in a 0.8% agarose gel in 0.5X TBE.

    Expressing:

    Article Title: Generation of Recombinant Vaccinia Viruses via Green Fluorescent Protein Selection
    Article Snippet: Next, the fragment was digested with Xho I and Bam HI, purified in a 1% agarose gel, and cloned into vector pIRES2-EGFP, which had been linearized with Xho I and Bam HI (New England Biolabs, Ipswich, MA). .. The resulting construct was used as a template to obtain the expression cassette GFP–IRES–envC by PCR.

    Article Title: A rationally designed nanoparticle for RNA interference therapy in B-lineage lymphoid malignancies
    Article Snippet: The correct PCR products (FL: 2541-bp and ΔE12–14: 2208-bp) were ligated into the 8497-bp lentiviral vector pCL6-2AEGwo through the NheI and XhoI restriction sites (underlined) using the Quick Ligase kit (New England Biolabs catalog no. M2200L) following the manufacturer's instructions. .. The expression of GFP allows transduced cells to be identified using fluorescent microscope.

    Modification:

    Article Title: A Germination-Specific Endo-?-Mannanase Gene Is Expressed in the Micropylar Endosperm Cap of Tomato Seeds 1
    Article Snippet: Genomic DNA was isolated from young tomato leaves (cv Moneymaker) as described by and modified by . .. Genomic DNA (10 μg) was digested with the restriction enzymes Bam HI, Xba I, and Xho I (New England Biolabs), separated on a 1.0% (w/v) agarose gel, and transferred to positively charged membranes (Hybond-N+ , Amersham Pharmacia Biotech).

    Article Title: A Telomeric Avirulence Gene Determines Efficacy for the Rice Blast Resistance Gene Pi-ta
    Article Snippet: An Exonuclease III deletion procedure, modified from , was used to produce progressive deletions from the telomere repeat end of the putative AVR-Pita clone. .. Plasmid pCB783, containing the 791-bp telomeric SacI fragment, was digested first with KpnI and XhoI and then with Exonuclease III (New England Biolabs).

    Transformation Assay:

    Article Title: Engineering and Flow-Cytometric Analysis of Chimeric LAGLIDADG Homing Endonucleases from Homologous I-OnuI-Family Enzymes
    Article Snippet: 12 The high fidelity (HF) version of the KpnI restriction enzyme is used for its compatibility with NdeI or XhoI enzymes in NEB Buffer #4. .. 13 Transformation of intact, supercoiled plasmid DNA is a high efficiency reaction.

    Article Title: A Telomeric Avirulence Gene Determines Efficacy for the Rice Blast Resistance Gene Pi-ta
    Article Snippet: Plasmid pCB783, containing the 791-bp telomeric SacI fragment, was digested first with KpnI and XhoI and then with Exonuclease III (New England Biolabs). .. The ExoIII-digested DNAs were treated with S1 nuclease (Sigma) followed by a fill-in reaction with the Klenow fragment of DNA polymerase I, ligation, and transformation into DH5αMCR cells (Gibco BRL).

    Hybridization:

    Article Title: A Germination-Specific Endo-?-Mannanase Gene Is Expressed in the Micropylar Endosperm Cap of Tomato Seeds 1
    Article Snippet: Paragraph title: DNA Extraction and Southern Hybridization ... Genomic DNA (10 μg) was digested with the restriction enzymes Bam HI, Xba I, and Xho I (New England Biolabs), separated on a 1.0% (w/v) agarose gel, and transferred to positively charged membranes (Hybond-N+ , Amersham Pharmacia Biotech).

    Electroporation:

    Article Title: Engineering and Flow-Cytometric Analysis of Chimeric LAGLIDADG Homing Endonucleases from Homologous I-OnuI-Family Enzymes
    Article Snippet: 12 The high fidelity (HF) version of the KpnI restriction enzyme is used for its compatibility with NdeI or XhoI enzymes in NEB Buffer #4. .. If using electroporation for this step, a single aliquot of electrocompetent cells can be used for up to ten transformations.

    Transfection:

    Article Title: Multiresidue Method for Analysis of β Agonists in Swine Urine by Enzyme Linked Receptor Assay Based on β2 Adrenergic Receptor Expressed in HEK293 Cells
    Article Snippet: The restriction enzymes of NcoI and XhoI were purchased from NEB (Ipswich, MA, USA). .. Competent cell NovaBlue, pTriEx-1.1 Hygro vector, and GeneJuice® transfection reagent were supplied by Novagen (Billerica, MA, USA).

    Southern Blot:

    Article Title:
    Article Snippet: Paragraph title: Southern Blot and Genomic DNA Sequence Analysis. ... Restriction enzyme analysis of PCR products containing the CYP2B6 exon-9 region was performed by incubating 2 μ g DNA with 100 U XhoI (NEB) overnight.

    Article Title: A mutant form of Dmc1 that bypasses the requirement for accessory protein Mei5-Sae3 reveals independent activities of Mei5-Sae3 and Rad51 in Dmc1 filament stability
    Article Snippet: Approximately 2 micrograms DNA per sample was then digested with XhoI or PstI (as indicated in figure legend) restriction enzyme (New England BioLabs) and processed as described previously [ ]. .. Samples were then run on a 0.6% (XhoI) or 0.7% (PstI) agarose gel at 2V/cm for 24 (XhoI) or 18 (PstI) hours, followed by Southern blotting as described previously [ ].

    Ligation:

    Article Title: A partial form of recessive STAT1 deficiency in humans
    Article Snippet: PCR products and empty pSPL3 plasmids (provided by Ralph Burkhardt, The Rockefeller University) were digested with Xho I and BamH 1 (New England BioLabs). .. The ligation products were then used to transform competent HB101 cells (Promega).

    Article Title: Retrofitting the BAC cloning vector pBeloBAC11 by the insertion of a mutant loxP site
    Article Snippet: The ligation reaction was heat inactivated at 70 °C for 15 min and then spot dialyzed against 0.5X TE for 1 h. Two μl aliquots of the ligation reaction were mixed with 25 μl of electrocompetent DH10B cells (Invitrogen), placed into a 1 cm gap cuvette (BTX) and electroporated at 2.5 kV and 129 Ohms using the BTX Electro Cell Manipulator 600. .. The DNA samples were digested with 10 U of Xho I for 2 h at 37 °C (New England BioLabs) and electrophoresed in a 0.8% agarose gel in 0.5X TBE.

    Article Title: A Telomeric Avirulence Gene Determines Efficacy for the Rice Blast Resistance Gene Pi-ta
    Article Snippet: Plasmid pCB783, containing the 791-bp telomeric SacI fragment, was digested first with KpnI and XhoI and then with Exonuclease III (New England Biolabs). .. The ExoIII-digested DNAs were treated with S1 nuclease (Sigma) followed by a fill-in reaction with the Klenow fragment of DNA polymerase I, ligation, and transformation into DH5αMCR cells (Gibco BRL).

    Generated:

    Article Title: A rationally designed nanoparticle for RNA interference therapy in B-lineage lymphoid malignancies
    Article Snippet: 2.8 Preparation of a Human Full-length CD22 and CD22ΔE12–14 Plasmids The cDNA fragments encoding either full-length CD22 (CD22FL) or truncated CD22 lacking exons 12–14 (CD22ΔE12–14) were generated by PCR amplification using the Phusion High Fidelity PCR Kit (New England Biolabs, catalog no. E0553L) with the following primer sets: full-length Fwd/Rev 5′-CTTGGT GCTAGC ATGCATCTCCTCGGC-3′/5′CCGG TCTCGAG GATGTTTGAGGATCACATAGTC-3′, and truncation ΔE12–14 Fwd/Rev 5′-CTTGGT GCTAGC ATGCATCTCCTCGGC-3′/5′-CCGGT CTCGAG CCTTTTTATTCCTCAC-3′. .. The correct PCR products (FL: 2541-bp and ΔE12–14: 2208-bp) were ligated into the 8497-bp lentiviral vector pCL6-2AEGwo through the NheI and XhoI restriction sites (underlined) using the Quick Ligase kit (New England Biolabs catalog no. M2200L) following the manufacturer's instructions.

    Article Title: Retrofitting the BAC cloning vector pBeloBAC11 by the insertion of a mutant loxP site
    Article Snippet: Individual colonies were grown overnight in 2.5 ml of LB + CM media and DNA was generated using an alkaline lysis miniprep procedure [ ]. .. The DNA samples were digested with 10 U of Xho I for 2 h at 37 °C (New England BioLabs) and electrophoresed in a 0.8% agarose gel in 0.5X TBE.

    Polymerase Chain Reaction:

    Article Title:
    Article Snippet: .. Restriction enzyme analysis of PCR products containing the CYP2B6 exon-9 region was performed by incubating 2 μ g DNA with 100 U XhoI (NEB) overnight. .. Total RNA was isolated using Trizol (Invitrogen).

    Article Title: Generation of Recombinant Vaccinia Viruses via Green Fluorescent Protein Selection
    Article Snippet: Paragraph title: Primers, polymerase chain reaction, and molecular cloning ... Next, the fragment was digested with Xho I and Bam HI, purified in a 1% agarose gel, and cloned into vector pIRES2-EGFP, which had been linearized with Xho I and Bam HI (New England Biolabs, Ipswich, MA).

    Article Title: A partial form of recessive STAT1 deficiency in humans
    Article Snippet: .. PCR products and empty pSPL3 plasmids (provided by Ralph Burkhardt, The Rockefeller University) were digested with Xho I and BamH 1 (New England BioLabs). .. Plasmids were then dephosphorylated, and 50 ng of purified plasmids and 250 ng of purified PCR products were ligated with T4 ligase (New England BioLabs).

    Article Title: A rationally designed nanoparticle for RNA interference therapy in B-lineage lymphoid malignancies
    Article Snippet: .. The correct PCR products (FL: 2541-bp and ΔE12–14: 2208-bp) were ligated into the 8497-bp lentiviral vector pCL6-2AEGwo through the NheI and XhoI restriction sites (underlined) using the Quick Ligase kit (New England Biolabs catalog no. M2200L) following the manufacturer's instructions. .. The pCL6-2AEGwo lentiviral backbone vector, a kind gift from Dr. Zanxian Xia, School of Biological Science and Technology, Central South University, Changsha, Hunan 410078, China, contains both a “ribosome-skip” fragment encoding the 2A-like peptide APVKQTLNFDLLKLAGDVESNPGP and an in-frame eGFP fluorescent coding sequence downstream of a multiple cloning site.

    Sequencing:

    Article Title:
    Article Snippet: Paragraph title: Southern Blot and Genomic DNA Sequence Analysis. ... Restriction enzyme analysis of PCR products containing the CYP2B6 exon-9 region was performed by incubating 2 μ g DNA with 100 U XhoI (NEB) overnight.

    Article Title: Generation of Recombinant Vaccinia Viruses via Green Fluorescent Protein Selection
    Article Snippet: To obtain the sequence of the mutated envC , we designed primers flanking the env gene of HIV-1. .. Next, the fragment was digested with Xho I and Bam HI, purified in a 1% agarose gel, and cloned into vector pIRES2-EGFP, which had been linearized with Xho I and Bam HI (New England Biolabs, Ipswich, MA).

    Article Title: A partial form of recessive STAT1 deficiency in humans
    Article Snippet: PCR products and empty pSPL3 plasmids (provided by Ralph Burkhardt, The Rockefeller University) were digested with Xho I and BamH 1 (New England BioLabs). .. Positive clones were identified by double enzyme digestion and sequencing.

    Article Title: A rationally designed nanoparticle for RNA interference therapy in B-lineage lymphoid malignancies
    Article Snippet: The correct PCR products (FL: 2541-bp and ΔE12–14: 2208-bp) were ligated into the 8497-bp lentiviral vector pCL6-2AEGwo through the NheI and XhoI restriction sites (underlined) using the Quick Ligase kit (New England Biolabs catalog no. M2200L) following the manufacturer's instructions. .. The pCL6-2AEGwo lentiviral backbone vector, a kind gift from Dr. Zanxian Xia, School of Biological Science and Technology, Central South University, Changsha, Hunan 410078, China, contains both a “ribosome-skip” fragment encoding the 2A-like peptide APVKQTLNFDLLKLAGDVESNPGP and an in-frame eGFP fluorescent coding sequence downstream of a multiple cloning site.

    Article Title: A Telomeric Avirulence Gene Determines Efficacy for the Rice Blast Resistance Gene Pi-ta
    Article Snippet: Plasmid pCB783, containing the 791-bp telomeric SacI fragment, was digested first with KpnI and XhoI and then with Exonuclease III (New England Biolabs). .. The 307-bp DraIII fragment from pCB808 was substituted for the 430-bp DraIII fragment from pCB780 to produce pCB806, containing the 6.5-kb BglII fragment minus the telomere repeat sequence.

    DNA Extraction:

    Article Title: A Germination-Specific Endo-?-Mannanase Gene Is Expressed in the Micropylar Endosperm Cap of Tomato Seeds 1
    Article Snippet: Paragraph title: DNA Extraction and Southern Hybridization ... Genomic DNA (10 μg) was digested with the restriction enzymes Bam HI, Xba I, and Xho I (New England Biolabs), separated on a 1.0% (w/v) agarose gel, and transferred to positively charged membranes (Hybond-N+ , Amersham Pharmacia Biotech).

    Nucleic Acid Electrophoresis:

    Article Title: A mutant form of Dmc1 that bypasses the requirement for accessory protein Mei5-Sae3 reveals independent activities of Mei5-Sae3 and Rad51 in Dmc1 filament stability
    Article Snippet: Paragraph title: One-dimensional gel electrophoresis ... Approximately 2 micrograms DNA per sample was then digested with XhoI or PstI (as indicated in figure legend) restriction enzyme (New England BioLabs) and processed as described previously [ ].

    Mutagenesis:

    Article Title:
    Article Snippet: Genomic DNA sequence at the sites of mutagenesis was determined from PCR products amplified using primers as shown , with genomic DNA isolated from mouse tail as the template. .. Restriction enzyme analysis of PCR products containing the CYP2B6 exon-9 region was performed by incubating 2 μ g DNA with 100 U XhoI (NEB) overnight.

    Isolation:

    Article Title:
    Article Snippet: Genomic DNA sequence at the sites of mutagenesis was determined from PCR products amplified using primers as shown , with genomic DNA isolated from mouse tail as the template. .. Restriction enzyme analysis of PCR products containing the CYP2B6 exon-9 region was performed by incubating 2 μ g DNA with 100 U XhoI (NEB) overnight.

    Article Title: Multiresidue Method for Analysis of β Agonists in Swine Urine by Enzyme Linked Receptor Assay Based on β2 Adrenergic Receptor Expressed in HEK293 Cells
    Article Snippet: Materials and reagents SV Total RNA Isolation System, Access reverse transcription polymerase chain reaction (RT-PCR) System, and T4 DNA ligase were purchased from Promega (Madison, WI, USA). .. The restriction enzymes of NcoI and XhoI were purchased from NEB (Ipswich, MA, USA).

    Article Title: A Germination-Specific Endo-?-Mannanase Gene Is Expressed in the Micropylar Endosperm Cap of Tomato Seeds 1
    Article Snippet: Genomic DNA was isolated from young tomato leaves (cv Moneymaker) as described by and modified by . .. Genomic DNA (10 μg) was digested with the restriction enzymes Bam HI, Xba I, and Xho I (New England Biolabs), separated on a 1.0% (w/v) agarose gel, and transferred to positively charged membranes (Hybond-N+ , Amersham Pharmacia Biotech).

    Electro Cell Manipulation:

    Article Title: Retrofitting the BAC cloning vector pBeloBAC11 by the insertion of a mutant loxP site
    Article Snippet: The ligation reaction was heat inactivated at 70 °C for 15 min and then spot dialyzed against 0.5X TE for 1 h. Two μl aliquots of the ligation reaction were mixed with 25 μl of electrocompetent DH10B cells (Invitrogen), placed into a 1 cm gap cuvette (BTX) and electroporated at 2.5 kV and 129 Ohms using the BTX Electro Cell Manipulator 600. .. The DNA samples were digested with 10 U of Xho I for 2 h at 37 °C (New England BioLabs) and electrophoresed in a 0.8% agarose gel in 0.5X TBE.

    Microscopy:

    Article Title: A rationally designed nanoparticle for RNA interference therapy in B-lineage lymphoid malignancies
    Article Snippet: The correct PCR products (FL: 2541-bp and ΔE12–14: 2208-bp) were ligated into the 8497-bp lentiviral vector pCL6-2AEGwo through the NheI and XhoI restriction sites (underlined) using the Quick Ligase kit (New England Biolabs catalog no. M2200L) following the manufacturer's instructions. .. The expression of GFP allows transduced cells to be identified using fluorescent microscope.

    Mouse Assay:

    Article Title:
    Article Snippet: Various amounts of genomic DNA from WT mice were added to CYP2A13/2B6/2F1-TG(+/+) genomic DNA (1–5 μ g), to maintain a constant amount of total DNA (10 μ g) for all samples analyzed. .. Restriction enzyme analysis of PCR products containing the CYP2B6 exon-9 region was performed by incubating 2 μ g DNA with 100 U XhoI (NEB) overnight.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Multiresidue Method for Analysis of β Agonists in Swine Urine by Enzyme Linked Receptor Assay Based on β2 Adrenergic Receptor Expressed in HEK293 Cells
    Article Snippet: Materials and reagents SV Total RNA Isolation System, Access reverse transcription polymerase chain reaction (RT-PCR) System, and T4 DNA ligase were purchased from Promega (Madison, WI, USA). .. The restriction enzymes of NcoI and XhoI were purchased from NEB (Ipswich, MA, USA).

    Gel Extraction:

    Article Title: Generation of Recombinant Vaccinia Viruses via Green Fluorescent Protein Selection
    Article Snippet: Polymerase chain reaction (PCR) was carried out in 50 μL thin-wall polypropylene tubes (Axygen Scientific, Union City, CA) using a thermocycler (PerkinElmer, Shelton, CT) under the following conditions: denaturation at 95°C for 5 min followed by 30 cycles of denaturation at 95°C for 45 s, annealing at 52°C for 45 s, elongation at 72°C for 2 min, and a final extension at 72°C for 7 min. PCR products were visualized in 1% agarose gel with ethidium bromide staining, cut out, and purified using a Qiagen gel extraction kit (Qiagen, Valencia, CA). .. Next, the fragment was digested with Xho I and Bam HI, purified in a 1% agarose gel, and cloned into vector pIRES2-EGFP, which had been linearized with Xho I and Bam HI (New England Biolabs, Ipswich, MA).

    Article Title: Effects of size and topology of DNA molecules on intracellular delivery with non-viral gene carriers
    Article Snippet: Linear DNA (l-DNA) Purified c-DNA was linearized using the restriction enzyme, Xho I (New England Biolabs; Pickering, ON) for pORF9-hTNFRS11b or Cla I (Invitrogen; Burlington, ON) for pEGFP-N2, Restriction digestion were set up with 5 μg of DNA per 50 μL of reaction volume containing 3 units of enzyme and incubated at 37°C for 16 hours. .. The enzyme was then heat-inactivated by incubating the mixture at 65°C for 10 min. Digested DNA was purified using QIAEX II Gel Extraction Kit (Qiagen, Mississauga, ON).

    cDNA Library Assay:

    Article Title: A Germination-Specific Endo-?-Mannanase Gene Is Expressed in the Micropylar Endosperm Cap of Tomato Seeds 1
    Article Snippet: Genomic DNA (10 μg) was digested with the restriction enzymes Bam HI, Xba I, and Xho I (New England Biolabs), separated on a 1.0% (w/v) agarose gel, and transferred to positively charged membranes (Hybond-N+ , Amersham Pharmacia Biotech). .. Prehybridization, hybridization, washing, and detection were performed as described for cDNA library screening.

    Purification:

    Article Title: Generation of Recombinant Vaccinia Viruses via Green Fluorescent Protein Selection
    Article Snippet: .. Next, the fragment was digested with Xho I and Bam HI, purified in a 1% agarose gel, and cloned into vector pIRES2-EGFP, which had been linearized with Xho I and Bam HI (New England Biolabs, Ipswich, MA). .. The resulting construct was used as a template to obtain the expression cassette GFP–IRES–envC by PCR.

    Article Title: A partial form of recessive STAT1 deficiency in humans
    Article Snippet: PCR products and empty pSPL3 plasmids (provided by Ralph Burkhardt, The Rockefeller University) were digested with Xho I and BamH 1 (New England BioLabs). .. Plasmids were then dephosphorylated, and 50 ng of purified plasmids and 250 ng of purified PCR products were ligated with T4 ligase (New England BioLabs).

    Article Title: Effects of size and topology of DNA molecules on intracellular delivery with non-viral gene carriers
    Article Snippet: .. Linear DNA (l-DNA) Purified c-DNA was linearized using the restriction enzyme, Xho I (New England Biolabs; Pickering, ON) for pORF9-hTNFRS11b or Cla I (Invitrogen; Burlington, ON) for pEGFP-N2, Restriction digestion were set up with 5 μg of DNA per 50 μL of reaction volume containing 3 units of enzyme and incubated at 37°C for 16 hours. .. The enzyme was then heat-inactivated by incubating the mixture at 65°C for 10 min. Digested DNA was purified using QIAEX II Gel Extraction Kit (Qiagen, Mississauga, ON).

    Plasmid Preparation:

    Article Title: Generation of Recombinant Vaccinia Viruses via Green Fluorescent Protein Selection
    Article Snippet: .. Next, the fragment was digested with Xho I and Bam HI, purified in a 1% agarose gel, and cloned into vector pIRES2-EGFP, which had been linearized with Xho I and Bam HI (New England Biolabs, Ipswich, MA). .. The resulting construct was used as a template to obtain the expression cassette GFP–IRES–envC by PCR.

    Article Title: Multiresidue Method for Analysis of β Agonists in Swine Urine by Enzyme Linked Receptor Assay Based on β2 Adrenergic Receptor Expressed in HEK293 Cells
    Article Snippet: The restriction enzymes of NcoI and XhoI were purchased from NEB (Ipswich, MA, USA). .. Competent cell NovaBlue, pTriEx-1.1 Hygro vector, and GeneJuice® transfection reagent were supplied by Novagen (Billerica, MA, USA).

    Article Title: Novel Method of Cell-Free In Vitro Synthesis of the Human Fibroblast Growth Factor 1 Gene
    Article Snippet: .. Restriction Enzyme Digestion Double digestion was performed on a sample of extracted plasmid DNA with Hin dIII and Xho I (20,000 U/mL and 10,000 U/mL, resp. ; New England Biolabs, Ipswich, MA, USA). ..

    Article Title: A rationally designed nanoparticle for RNA interference therapy in B-lineage lymphoid malignancies
    Article Snippet: .. The correct PCR products (FL: 2541-bp and ΔE12–14: 2208-bp) were ligated into the 8497-bp lentiviral vector pCL6-2AEGwo through the NheI and XhoI restriction sites (underlined) using the Quick Ligase kit (New England Biolabs catalog no. M2200L) following the manufacturer's instructions. .. The pCL6-2AEGwo lentiviral backbone vector, a kind gift from Dr. Zanxian Xia, School of Biological Science and Technology, Central South University, Changsha, Hunan 410078, China, contains both a “ribosome-skip” fragment encoding the 2A-like peptide APVKQTLNFDLLKLAGDVESNPGP and an in-frame eGFP fluorescent coding sequence downstream of a multiple cloning site.

    Article Title: Engineering and Flow-Cytometric Analysis of Chimeric LAGLIDADG Homing Endonucleases from Homologous I-OnuI-Family Enzymes
    Article Snippet: 12 The high fidelity (HF) version of the KpnI restriction enzyme is used for its compatibility with NdeI or XhoI enzymes in NEB Buffer #4. .. 13 Transformation of intact, supercoiled plasmid DNA is a high efficiency reaction.

    Article Title: A Telomeric Avirulence Gene Determines Efficacy for the Rice Blast Resistance Gene Pi-ta
    Article Snippet: .. Plasmid pCB783, containing the 791-bp telomeric SacI fragment, was digested first with KpnI and XhoI and then with Exonuclease III (New England Biolabs). .. The ExoIII-digested DNAs were treated with S1 nuclease (Sigma) followed by a fill-in reaction with the Klenow fragment of DNA polymerase I, ligation, and transformation into DH5αMCR cells (Gibco BRL).

    Negative Control:

    Article Title:
    Article Snippet: The transgene copy number in 2A13-TG(+/−) mice was estimated through densitometric analysis of the 5.1-kbp CYP2A13 -specific band detected, with DNA from CYP2A13/2B6/2F1-TG(+/+) mice as the positive control (and standard for quantification) and DNA from B6 wild-type (WT) mice as the negative control. .. Restriction enzyme analysis of PCR products containing the CYP2B6 exon-9 region was performed by incubating 2 μ g DNA with 100 U XhoI (NEB) overnight.

    Agarose Gel Electrophoresis:

    Article Title: Generation of Recombinant Vaccinia Viruses via Green Fluorescent Protein Selection
    Article Snippet: .. Next, the fragment was digested with Xho I and Bam HI, purified in a 1% agarose gel, and cloned into vector pIRES2-EGFP, which had been linearized with Xho I and Bam HI (New England Biolabs, Ipswich, MA). .. The resulting construct was used as a template to obtain the expression cassette GFP–IRES–envC by PCR.

    Article Title: A mutant form of Dmc1 that bypasses the requirement for accessory protein Mei5-Sae3 reveals independent activities of Mei5-Sae3 and Rad51 in Dmc1 filament stability
    Article Snippet: Approximately 2 micrograms DNA per sample was then digested with XhoI or PstI (as indicated in figure legend) restriction enzyme (New England BioLabs) and processed as described previously [ ]. .. Samples were then run on a 0.6% (XhoI) or 0.7% (PstI) agarose gel at 2V/cm for 24 (XhoI) or 18 (PstI) hours, followed by Southern blotting as described previously [ ].

    Article Title: A Germination-Specific Endo-?-Mannanase Gene Is Expressed in the Micropylar Endosperm Cap of Tomato Seeds 1
    Article Snippet: .. Genomic DNA (10 μg) was digested with the restriction enzymes Bam HI, Xba I, and Xho I (New England Biolabs), separated on a 1.0% (w/v) agarose gel, and transferred to positively charged membranes (Hybond-N+ , Amersham Pharmacia Biotech). .. Prehybridization, hybridization, washing, and detection were performed as described for cDNA library screening.

    Article Title: Retrofitting the BAC cloning vector pBeloBAC11 by the insertion of a mutant loxP site
    Article Snippet: .. The DNA samples were digested with 10 U of Xho I for 2 h at 37 °C (New England BioLabs) and electrophoresed in a 0.8% agarose gel in 0.5X TBE. .. Results Since the BAC cloning vector pBeloBAc11 was commercially available from New England BioLabs, I decided to modify this plasmid to increase its utility for genomics studies.

    Concentration Assay:

    Article Title: A mutant form of Dmc1 that bypasses the requirement for accessory protein Mei5-Sae3 reveals independent activities of Mei5-Sae3 and Rad51 in Dmc1 filament stability
    Article Snippet: Sodium azide was added to a final concentration of 0.1%. .. Approximately 2 micrograms DNA per sample was then digested with XhoI or PstI (as indicated in figure legend) restriction enzyme (New England BioLabs) and processed as described previously [ ].

    Alkaline Lysis:

    Article Title: Retrofitting the BAC cloning vector pBeloBAC11 by the insertion of a mutant loxP site
    Article Snippet: Individual colonies were grown overnight in 2.5 ml of LB + CM media and DNA was generated using an alkaline lysis miniprep procedure [ ]. .. The DNA samples were digested with 10 U of Xho I for 2 h at 37 °C (New England BioLabs) and electrophoresed in a 0.8% agarose gel in 0.5X TBE.

    Staining:

    Article Title: Generation of Recombinant Vaccinia Viruses via Green Fluorescent Protein Selection
    Article Snippet: Polymerase chain reaction (PCR) was carried out in 50 μL thin-wall polypropylene tubes (Axygen Scientific, Union City, CA) using a thermocycler (PerkinElmer, Shelton, CT) under the following conditions: denaturation at 95°C for 5 min followed by 30 cycles of denaturation at 95°C for 45 s, annealing at 52°C for 45 s, elongation at 72°C for 2 min, and a final extension at 72°C for 7 min. PCR products were visualized in 1% agarose gel with ethidium bromide staining, cut out, and purified using a Qiagen gel extraction kit (Qiagen, Valencia, CA). .. Next, the fragment was digested with Xho I and Bam HI, purified in a 1% agarose gel, and cloned into vector pIRES2-EGFP, which had been linearized with Xho I and Bam HI (New England Biolabs, Ipswich, MA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs enzyme sph i
    Genetic characterization Trypanosoma cruzi and Trypanosoma rangeli strains. (A) kDNA analysis of T . rangeli strains in a silver stained 6% polyacrylamide gel containing PCR products obtained with primers S35/S36/KP1L. The presence of a 165-bp band indicates the presence of KP1 minicircles. (B) Detection of the 832-bp fragment of TcSC5D gene in T . cruzi strains and clone. (C) PCR–RFLP of TcSC5D products digested with Hpa I and <t>Sph</t> I enzymes. MM: Molecular marker 100bp. NTC: No-template control.
    Enzyme Sph I, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 78 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/enzyme sph i/product/New England Biolabs
    Average 99 stars, based on 78 article reviews
    Price from $9.99 to $1999.99
    enzyme sph i - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Genetic characterization Trypanosoma cruzi and Trypanosoma rangeli strains. (A) kDNA analysis of T . rangeli strains in a silver stained 6% polyacrylamide gel containing PCR products obtained with primers S35/S36/KP1L. The presence of a 165-bp band indicates the presence of KP1 minicircles. (B) Detection of the 832-bp fragment of TcSC5D gene in T . cruzi strains and clone. (C) PCR–RFLP of TcSC5D products digested with Hpa I and Sph I enzymes. MM: Molecular marker 100bp. NTC: No-template control.

    Journal: PLoS ONE

    Article Title: DNA content analysis allows discrimination between Trypanosoma cruzi and Trypanosoma rangeli

    doi: 10.1371/journal.pone.0189907

    Figure Lengend Snippet: Genetic characterization Trypanosoma cruzi and Trypanosoma rangeli strains. (A) kDNA analysis of T . rangeli strains in a silver stained 6% polyacrylamide gel containing PCR products obtained with primers S35/S36/KP1L. The presence of a 165-bp band indicates the presence of KP1 minicircles. (B) Detection of the 832-bp fragment of TcSC5D gene in T . cruzi strains and clone. (C) PCR–RFLP of TcSC5D products digested with Hpa I and Sph I enzymes. MM: Molecular marker 100bp. NTC: No-template control.

    Article Snippet: Aliquots of 20 μL of the amplified products were digested with 1U of the enzyme Hpa I (NEB R105) at 55°C for 1 h and with 1U of the enzyme Sph I (NEB R0182) at 37°C for 1 h (TcSC5D fragment) or with one unit of Xho I (NEB R0146S) endonuclease (TcMK fragment).

    Techniques: Staining, Polymerase Chain Reaction, Marker