restriction enzyme fnu4hi  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Fnu4HI
    Description:
    Fnu4HI 1 000 units
    Catalog Number:
    r0178l
    Price:
    282
    Size:
    1 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs restriction enzyme fnu4hi
    Fnu4HI
    Fnu4HI 1 000 units
    https://www.bioz.com/result/restriction enzyme fnu4hi/product/New England Biolabs
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    restriction enzyme fnu4hi - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Identification and Characterization of a Plastidic Adenine Nucleotide Uniporter (OsBT1-3) Required for Chloroplast Development in the Early Leaf Stage of Rice
    Article Snippet: Paragraph title: Map-Based Cloning ... These PCR products were digested by Fnu4HI (NEB).

    Amplification:

    Article Title: Quantitative detection of DNMT3A R882H mutation in acute myeloid leukemia
    Article Snippet: Amplified products were purified using the PCR Purification Kit (Qiagen) according to the manufactures instruction. .. Endonuclease restriction analysis of DNMT3A R882H mutation was performed using Fnu4HI (New England Biolabs) as previously reported [ ].

    Article Title: Identification and Characterization of a Plastidic Adenine Nucleotide Uniporter (OsBT1-3) Required for Chloroplast Development in the Early Leaf Stage of Rice
    Article Snippet: A sequence analysis of the genomic DNA and the CDSs of the OsBT1-3 gene from the 93–11 and the sla mutant plants were amplified by PCR and reverse transcription (RT)-PCR. .. These PCR products were digested by Fnu4HI (NEB).

    Article Title: Increased size of solid organs in patients with Chuvash polycythemia and in mice with altered expression of HIF-1? and HIF-2?
    Article Snippet: The following primers were used for amplification of VHL exon 3: VHL 3F, 5′-CCTTGTACTGAGACCCTAG; VHL 3R, 5′-GCTGAGATGAAACAGTGTA. .. Ten microliters of PCR product were incubated with 5 U of Fnu4H I (New England Biolabs Inc, Beverly, MA) for 2 h to detect the VHLR200W mutation.

    Article Title: Retinal O-linked N-acetylglucosamine protein modifications: implications for postnatal retinal vascularization and the pathogenesis of diabetic retinopathy
    Article Snippet: .. Genomic DNA was prepared from tail biopsies and the transgenic Ins2Akita/+ mice were identified by PCR screening ( ) The amplified fragments were digested with FNU 4 HI, as recommended by the supplier (New England Biolabs, Ipswich, MA). ..

    Article Title: Maternal cell traffic bounds for immune modulation: tracking maternal H-2 alleles in spleens of baby mice by DNA fingerprinting
    Article Snippet: DNA products of the H-2-specific amplification were purified using a QIAquick PCR Purification Kit (Qiagen GmbH, Hilden, Germany). .. After resuspension in water, the DNA was treated with Fnu 4H I (New England Biolabs, Beverly, MA), according to the manufacturer's instructions.

    Article Title: Comparative examination of various PCR-based methods for DNMT3A and IDH1/2 mutations identification in acute myeloid leukemia
    Article Snippet: Endonuclease restriction analysis of DNMT3A -R882H mutations PCR amplification for endonuclease restriction analysis was conducted using primers DNMT3A -ResF/R (Additional file : Table S2). .. In all, 10 μl of the PCR product was directly applied for endonuclease treatment with 1 μl Fnu4HI and 5 μl of CutSmart Buffer (New England Biolabs).

    Article Title: Integrin ?1/Akita double knockout mice on a Balb/c background develop advanced features of human diabetic nephropathy
    Article Snippet: .. Briefly, following PCR amplification of genomic DNA using the sense 5′-TGCTGATGCCCTGGCCTGCT-3′ and antisense 5′-TGGTCCCACATATGCACATG-3′ primers, the PCR products were digested with Fnu4HI enzyme (NEB, R0178s) at 37C overnight and run onto 2% agarose gels (Sigma, St. Louis, MO) for detection of the wild-type (140 bp) and/or the mutant (280 bp) allele. .. The protocol for genotyping integrin α1-null mice was as previously described .

    Article Title: CTLA-4 gene polymorphisms and their influence on predisposition to autoimmune thyroid diseases (Graves' disease and Hashimoto's thyroiditis)
    Article Snippet: Analysis of CTLA-4 polymorphism CTLA-4 polymorphisms (A49G, 1822 C/T and CT60 A/G) were assessed by PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism), using the following restriction enzymes: Fnu4HI , BsmAI , BsaAI (New England Biolabs, USA). .. First, genomic DNA sequences containing the polymorphic region, i.e., Fnu4HI or BsmAI or BsaAI restriction site, were amplified in a PCR reaction (Personal Thermocycler, Eppendorf, Germany), in a total volume of 25 µl, including: 3 µl 10x AmpliTaq Gold® 360 buffer (150 mM Tris-HCl, pH 8.3, 500 mM KCl), 0.12 µl (5 U/ µl) AmpliTaq Gold® 360 DNA Polymerase, 2 µl (25 mM) MgCl2 , 0.66 µl (10 mM) dNTPs (Applied Biosystems, USA), 1 µl (40 ng) DNA, 2.4 µl (1.2 µl 0.5 µM each primer: forward and reverse) and 15.82 µl nuclease-free water.

    Agarose Gel Electrophoresis:

    Article Title: Increased size of solid organs in patients with Chuvash polycythemia and in mice with altered expression of HIF-1? and HIF-2?
    Article Snippet: Ten microliters of PCR product were incubated with 5 U of Fnu4H I (New England Biolabs Inc, Beverly, MA) for 2 h to detect the VHLR200W mutation. .. The VHL598C > T ( VHLR200W ) mutation abolishes a restriction site for Fnu4H I, resulting in an uncut 296-base-pair band detected by 1.2% agarose gel electrophoresis [ ].

    Article Title: Comparative examination of various PCR-based methods for DNMT3A and IDH1/2 mutations identification in acute myeloid leukemia
    Article Snippet: In all, 10 μl of the PCR product was directly applied for endonuclease treatment with 1 μl Fnu4HI and 5 μl of CutSmart Buffer (New England Biolabs). .. After incubation at 37°C for 15 min products were analysed on a 1.5% agarose gel containing 10% ethidium bromide (voltage 150 V).

    Binding Assay:

    Article Title: Defining characteristics of Tn5 Transposase non-specific DNA binding
    Article Snippet: Following a 1 hour incubation, 20 U of HhaI (NEB), 20 units of Fnu4HI (NEB) and 16 U of Sau3AI (NEB) were added to each reaction and incubation at 37°C continued for an additional three hours. .. Traces of each lane were then overlayed to assess the amount of Tnp binding.

    Polymerase Chain Reaction:

    Article Title: Quantitative detection of DNMT3A R882H mutation in acute myeloid leukemia
    Article Snippet: Amplified products were purified using the PCR Purification Kit (Qiagen) according to the manufactures instruction. .. Endonuclease restriction analysis of DNMT3A R882H mutation was performed using Fnu4HI (New England Biolabs) as previously reported [ ].

    Article Title: Poorly-Controlled Type 1 Diabetes Mellitus Impairs LH-LHCGR Signaling in the Ovaries and Decreases Female Fertility in Mice
    Article Snippet: .. PCR was performed according to the manufacturer's instructions (K0171, Thermo Fisher Scientific, Waltham, MA, USA) and was followed by digestion with the restriction enzyme Fnu4HI (R0178, New England Biolabs, Ipswich, MA, USA) at 37℃ overnight. .. PCR products of 140 base pairs (bp) and 280 bp indicated the presence of the wild-type allele and AKITA mutant allele, respectively.

    Article Title: Identification and Characterization of a Plastidic Adenine Nucleotide Uniporter (OsBT1-3) Required for Chloroplast Development in the Early Leaf Stage of Rice
    Article Snippet: .. These PCR products were digested by Fnu4HI (NEB). .. The primer sequences used in the map-based cloning are listed in .

    Article Title: Increased size of solid organs in patients with Chuvash polycythemia and in mice with altered expression of HIF-1? and HIF-2?
    Article Snippet: .. Ten microliters of PCR product were incubated with 5 U of Fnu4H I (New England Biolabs Inc, Beverly, MA) for 2 h to detect the VHLR200W mutation. .. The VHL598C > T ( VHLR200W ) mutation abolishes a restriction site for Fnu4H I, resulting in an uncut 296-base-pair band detected by 1.2% agarose gel electrophoresis [ ].

    Article Title: Retinal O-linked N-acetylglucosamine protein modifications: implications for postnatal retinal vascularization and the pathogenesis of diabetic retinopathy
    Article Snippet: .. Genomic DNA was prepared from tail biopsies and the transgenic Ins2Akita/+ mice were identified by PCR screening ( ) The amplified fragments were digested with FNU 4 HI, as recommended by the supplier (New England Biolabs, Ipswich, MA). ..

    Article Title: Maternal cell traffic bounds for immune modulation: tracking maternal H-2 alleles in spleens of baby mice by DNA fingerprinting
    Article Snippet: DNA products of the H-2-specific amplification were purified using a QIAquick PCR Purification Kit (Qiagen GmbH, Hilden, Germany). .. After resuspension in water, the DNA was treated with Fnu 4H I (New England Biolabs, Beverly, MA), according to the manufacturer's instructions.

    Article Title: Comparative examination of various PCR-based methods for DNMT3A and IDH1/2 mutations identification in acute myeloid leukemia
    Article Snippet: .. In all, 10 μl of the PCR product was directly applied for endonuclease treatment with 1 μl Fnu4HI and 5 μl of CutSmart Buffer (New England Biolabs). .. After incubation at 37°C for 15 min products were analysed on a 1.5% agarose gel containing 10% ethidium bromide (voltage 150 V).

    Article Title: Integrin ?1/Akita double knockout mice on a Balb/c background develop advanced features of human diabetic nephropathy
    Article Snippet: .. Briefly, following PCR amplification of genomic DNA using the sense 5′-TGCTGATGCCCTGGCCTGCT-3′ and antisense 5′-TGGTCCCACATATGCACATG-3′ primers, the PCR products were digested with Fnu4HI enzyme (NEB, R0178s) at 37C overnight and run onto 2% agarose gels (Sigma, St. Louis, MO) for detection of the wild-type (140 bp) and/or the mutant (280 bp) allele. .. The protocol for genotyping integrin α1-null mice was as previously described .

    Article Title: CTLA-4 gene polymorphisms and their influence on predisposition to autoimmune thyroid diseases (Graves' disease and Hashimoto's thyroiditis)
    Article Snippet: .. Analysis of CTLA-4 polymorphism CTLA-4 polymorphisms (A49G, 1822 C/T and CT60 A/G) were assessed by PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism), using the following restriction enzymes: Fnu4HI , BsmAI , BsaAI (New England Biolabs, USA). .. First, genomic DNA sequences containing the polymorphic region, i.e., Fnu4HI or BsmAI or BsaAI restriction site, were amplified in a PCR reaction (Personal Thermocycler, Eppendorf, Germany), in a total volume of 25 µl, including: 3 µl 10x AmpliTaq Gold® 360 buffer (150 mM Tris-HCl, pH 8.3, 500 mM KCl), 0.12 µl (5 U/ µl) AmpliTaq Gold® 360 DNA Polymerase, 2 µl (25 mM) MgCl2 , 0.66 µl (10 mM) dNTPs (Applied Biosystems, USA), 1 µl (40 ng) DNA, 2.4 µl (1.2 µl 0.5 µM each primer: forward and reverse) and 15.82 µl nuclease-free water.

    Mutagenesis:

    Article Title: Quantitative detection of DNMT3A R882H mutation in acute myeloid leukemia
    Article Snippet: .. Endonuclease restriction analysis of DNMT3A R882H mutation was performed using Fnu4HI (New England Biolabs) as previously reported [ ]. .. Qualitative and quantitative evaluation of mutations Qualitative evaluation for presence of NPM1 , DNMT3A , IDH1 and IDH2 mutations were performed by Sanger sequencing using ABI310 Genetic Analyzer (Applied Biosystems) as previously described [ ].

    Article Title: Poorly-Controlled Type 1 Diabetes Mellitus Impairs LH-LHCGR Signaling in the Ovaries and Decreases Female Fertility in Mice
    Article Snippet: PCR was performed according to the manufacturer's instructions (K0171, Thermo Fisher Scientific, Waltham, MA, USA) and was followed by digestion with the restriction enzyme Fnu4HI (R0178, New England Biolabs, Ipswich, MA, USA) at 37℃ overnight. .. PCR products of 140 base pairs (bp) and 280 bp indicated the presence of the wild-type allele and AKITA mutant allele, respectively.

    Article Title: Identification and Characterization of a Plastidic Adenine Nucleotide Uniporter (OsBT1-3) Required for Chloroplast Development in the Early Leaf Stage of Rice
    Article Snippet: A sequence analysis of the genomic DNA and the CDSs of the OsBT1-3 gene from the 93–11 and the sla mutant plants were amplified by PCR and reverse transcription (RT)-PCR. .. These PCR products were digested by Fnu4HI (NEB).

    Article Title: Increased size of solid organs in patients with Chuvash polycythemia and in mice with altered expression of HIF-1? and HIF-2?
    Article Snippet: .. Ten microliters of PCR product were incubated with 5 U of Fnu4H I (New England Biolabs Inc, Beverly, MA) for 2 h to detect the VHLR200W mutation. .. The VHL598C > T ( VHLR200W ) mutation abolishes a restriction site for Fnu4H I, resulting in an uncut 296-base-pair band detected by 1.2% agarose gel electrophoresis [ ].

    Article Title: Integrin ?1/Akita double knockout mice on a Balb/c background develop advanced features of human diabetic nephropathy
    Article Snippet: .. Briefly, following PCR amplification of genomic DNA using the sense 5′-TGCTGATGCCCTGGCCTGCT-3′ and antisense 5′-TGGTCCCACATATGCACATG-3′ primers, the PCR products were digested with Fnu4HI enzyme (NEB, R0178s) at 37C overnight and run onto 2% agarose gels (Sigma, St. Louis, MO) for detection of the wild-type (140 bp) and/or the mutant (280 bp) allele. .. The protocol for genotyping integrin α1-null mice was as previously described .

    Ethanol Precipitation:

    Article Title: Defining characteristics of Tn5 Transposase non-specific DNA binding
    Article Snippet: Following a 1 hour incubation, 20 U of HhaI (NEB), 20 units of Fnu4HI (NEB) and 16 U of Sau3AI (NEB) were added to each reaction and incubation at 37°C continued for an additional three hours. .. Each reaction was then phenol/chloroform extracted twice and concentrated by ethanol precipitation with glycogen.

    Sequencing:

    Article Title: Quantitative detection of DNMT3A R882H mutation in acute myeloid leukemia
    Article Snippet: Sequencing was performed using ABI310 Genetic Analyzer (Applied Biosystems), and data were analyzed using DNA Sequencing Analysis Software v.5.2.0. .. Endonuclease restriction analysis of DNMT3A R882H mutation was performed using Fnu4HI (New England Biolabs) as previously reported [ ].

    Article Title: Identification and Characterization of a Plastidic Adenine Nucleotide Uniporter (OsBT1-3) Required for Chloroplast Development in the Early Leaf Stage of Rice
    Article Snippet: A sequence analysis of the genomic DNA and the CDSs of the OsBT1-3 gene from the 93–11 and the sla mutant plants were amplified by PCR and reverse transcription (RT)-PCR. .. These PCR products were digested by Fnu4HI (NEB).

    Incubation:

    Article Title: Defining characteristics of Tn5 Transposase non-specific DNA binding
    Article Snippet: .. Following a 1 hour incubation, 20 U of HhaI (NEB), 20 units of Fnu4HI (NEB) and 16 U of Sau3AI (NEB) were added to each reaction and incubation at 37°C continued for an additional three hours. .. Each reaction was then phenol/chloroform extracted twice and concentrated by ethanol precipitation with glycogen.

    Article Title: Increased size of solid organs in patients with Chuvash polycythemia and in mice with altered expression of HIF-1? and HIF-2?
    Article Snippet: .. Ten microliters of PCR product were incubated with 5 U of Fnu4H I (New England Biolabs Inc, Beverly, MA) for 2 h to detect the VHLR200W mutation. .. The VHL598C > T ( VHLR200W ) mutation abolishes a restriction site for Fnu4H I, resulting in an uncut 296-base-pair band detected by 1.2% agarose gel electrophoresis [ ].

    Article Title: Comparative examination of various PCR-based methods for DNMT3A and IDH1/2 mutations identification in acute myeloid leukemia
    Article Snippet: In all, 10 μl of the PCR product was directly applied for endonuclease treatment with 1 μl Fnu4HI and 5 μl of CutSmart Buffer (New England Biolabs). .. After incubation at 37°C for 15 min products were analysed on a 1.5% agarose gel containing 10% ethidium bromide (voltage 150 V).

    Knock-Out:

    Article Title: Integrin ?1/Akita double knockout mice on a Balb/c background develop advanced features of human diabetic nephropathy
    Article Snippet: Briefly, following PCR amplification of genomic DNA using the sense 5′-TGCTGATGCCCTGGCCTGCT-3′ and antisense 5′-TGGTCCCACATATGCACATG-3′ primers, the PCR products were digested with Fnu4HI enzyme (NEB, R0178s) at 37C overnight and run onto 2% agarose gels (Sigma, St. Louis, MO) for detection of the wild-type (140 bp) and/or the mutant (280 bp) allele. .. Briefly, following PCR amplification of genomic DNA using the wild type 5′GTTGTTCTATTTTTGTAGTTAAC3′; knockout 5′GGGGAACTTCCTGACTAG 3′; and common 5′AATCCTCCATTCGGGTTGGTG 3′ primers, the PCR products were run onto 2% agarose gels of detection of the wild type (103bp) and/or the knockout (273bp) allele. shows the genotypes of mice used in this study.

    Mouse Assay:

    Article Title: Maternal cell traffic bounds for immune modulation: tracking maternal H-2 alleles in spleens of baby mice by DNA fingerprinting
    Article Snippet: .. shows the alignment of DNA sequences from a portion of the class II Eb gene in three different H-2 haplotype mice , and the predicted fragment sizes after Fnu 4H I (or Bbr I) treatment of those DNA sequences ( ). .. The three haplotypes represent two sequence lengths owing to the variable number of tetranucleotide repeats.

    Article Title: Retinal O-linked N-acetylglucosamine protein modifications: implications for postnatal retinal vascularization and the pathogenesis of diabetic retinopathy
    Article Snippet: .. Genomic DNA was prepared from tail biopsies and the transgenic Ins2Akita/+ mice were identified by PCR screening ( ) The amplified fragments were digested with FNU 4 HI, as recommended by the supplier (New England Biolabs, Ipswich, MA). ..

    Article Title: Integrin ?1/Akita double knockout mice on a Balb/c background develop advanced features of human diabetic nephropathy
    Article Snippet: Briefly, following PCR amplification of genomic DNA using the sense 5′-TGCTGATGCCCTGGCCTGCT-3′ and antisense 5′-TGGTCCCACATATGCACATG-3′ primers, the PCR products were digested with Fnu4HI enzyme (NEB, R0178s) at 37C overnight and run onto 2% agarose gels (Sigma, St. Louis, MO) for detection of the wild-type (140 bp) and/or the mutant (280 bp) allele. .. The protocol for genotyping integrin α1-null mice was as previously described .

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Identification and Characterization of a Plastidic Adenine Nucleotide Uniporter (OsBT1-3) Required for Chloroplast Development in the Early Leaf Stage of Rice
    Article Snippet: A sequence analysis of the genomic DNA and the CDSs of the OsBT1-3 gene from the 93–11 and the sla mutant plants were amplified by PCR and reverse transcription (RT)-PCR. .. These PCR products were digested by Fnu4HI (NEB).

    Transgenic Assay:

    Article Title: Retinal O-linked N-acetylglucosamine protein modifications: implications for postnatal retinal vascularization and the pathogenesis of diabetic retinopathy
    Article Snippet: .. Genomic DNA was prepared from tail biopsies and the transgenic Ins2Akita/+ mice were identified by PCR screening ( ) The amplified fragments were digested with FNU 4 HI, as recommended by the supplier (New England Biolabs, Ipswich, MA). ..

    Generated:

    Article Title: Maternal cell traffic bounds for immune modulation: tracking maternal H-2 alleles in spleens of baby mice by DNA fingerprinting
    Article Snippet: .. The RFLP analysis generated by Fnu 4H I or Bbr I, however, was able to discriminate between the various alleles. ..

    DNA Sequencing:

    Article Title: Quantitative detection of DNMT3A R882H mutation in acute myeloid leukemia
    Article Snippet: Paragraph title: DNA sequencing and endonuclease restriction analysis of DNMT3A mutations ... Endonuclease restriction analysis of DNMT3A R882H mutation was performed using Fnu4HI (New England Biolabs) as previously reported [ ].

    Polyacrylamide Gel Electrophoresis:

    Article Title: Maternal cell traffic bounds for immune modulation: tracking maternal H-2 alleles in spleens of baby mice by DNA fingerprinting
    Article Snippet: After resuspension in water, the DNA was treated with Fnu 4H I (New England Biolabs, Beverly, MA), according to the manufacturer's instructions. .. The endonuclease-treated DNA was analysed by polyacrylamide gel electrophoresis (PAGE) on an 8% gel, stained with 0·05% ethidium bromide and photographed.

    Isolation:

    Article Title: Increased size of solid organs in patients with Chuvash polycythemia and in mice with altered expression of HIF-1? and HIF-2?
    Article Snippet: Genomic DNA was isolated using a QIAGEN column (QIAGEN Inc, Valencia, CA) and PCR reactions were performed in 50 µl containing 20 mM Tris-HCl pH 8.4, 50 mM KCl, 1.5 mM MgCl2 , 100 µM dNTP, 300 nM primers, and 2.5 U/reaction Taq DNA polymerase (Life Technologies, Grand Island, NY). .. Ten microliters of PCR product were incubated with 5 U of Fnu4H I (New England Biolabs Inc, Beverly, MA) for 2 h to detect the VHLR200W mutation.

    Marker:

    Article Title: Identification and Characterization of a Plastidic Adenine Nucleotide Uniporter (OsBT1-3) Required for Chloroplast Development in the Early Leaf Stage of Rice
    Article Snippet: A CAPS marker was also developed to confirm the mutated site of Osbt1-3 . .. These PCR products were digested by Fnu4HI (NEB).

    Staining:

    Article Title: Defining characteristics of Tn5 Transposase non-specific DNA binding
    Article Snippet: Following a 1 hour incubation, 20 U of HhaI (NEB), 20 units of Fnu4HI (NEB) and 16 U of Sau3AI (NEB) were added to each reaction and incubation at 37°C continued for an additional three hours. .. To analyze the cleavage patterns, the reactions were run on a 9% native polyacrylamide gel followed by brief ethidium bromide staining and visualization on a Typhoon Variable Mode Imager.

    Article Title: Maternal cell traffic bounds for immune modulation: tracking maternal H-2 alleles in spleens of baby mice by DNA fingerprinting
    Article Snippet: After resuspension in water, the DNA was treated with Fnu 4H I (New England Biolabs, Beverly, MA), according to the manufacturer's instructions. .. The endonuclease-treated DNA was analysed by polyacrylamide gel electrophoresis (PAGE) on an 8% gel, stained with 0·05% ethidium bromide and photographed.

    Purification:

    Article Title: Quantitative detection of DNMT3A R882H mutation in acute myeloid leukemia
    Article Snippet: Amplified products were purified using the PCR Purification Kit (Qiagen) according to the manufactures instruction. .. Endonuclease restriction analysis of DNMT3A R882H mutation was performed using Fnu4HI (New England Biolabs) as previously reported [ ].

    Article Title: Maternal cell traffic bounds for immune modulation: tracking maternal H-2 alleles in spleens of baby mice by DNA fingerprinting
    Article Snippet: DNA products of the H-2-specific amplification were purified using a QIAquick PCR Purification Kit (Qiagen GmbH, Hilden, Germany). .. After resuspension in water, the DNA was treated with Fnu 4H I (New England Biolabs, Beverly, MA), according to the manufacturer's instructions.

    Software:

    Article Title: Quantitative detection of DNMT3A R882H mutation in acute myeloid leukemia
    Article Snippet: Sequencing was performed using ABI310 Genetic Analyzer (Applied Biosystems), and data were analyzed using DNA Sequencing Analysis Software v.5.2.0. .. Endonuclease restriction analysis of DNMT3A R882H mutation was performed using Fnu4HI (New England Biolabs) as previously reported [ ].

    Article Title: Identification and Characterization of a Plastidic Adenine Nucleotide Uniporter (OsBT1-3) Required for Chloroplast Development in the Early Leaf Stage of Rice
    Article Snippet: New SSR markers were developed using SSRHunter software based on a sequence comparison of the indica variety 93–11 and the Nipponbare variety . .. These PCR products were digested by Fnu4HI (NEB).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs fnu4hi
    Fnu4hi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fnu4hi/product/New England Biolabs
    Average 99 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    fnu4hi - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results