hhai  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    HhaI
    Description:
    HhaI 10 000 units
    Catalog Number:
    R0139L
    Price:
    244
    Size:
    10 000 units
    Category:
    Restriction Enzymes
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs hhai
    HhaI
    HhaI 10 000 units
    https://www.bioz.com/result/hhai/product/New England Biolabs
    Average 99 stars, based on 64 article reviews
    Price from $9.99 to $1999.99
    hhai - by Bioz Stars, 2019-10
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Placenta-specific Methylation of the Vitamin D 24-Hydroxylase Gene
    Article Snippet: Reverse orientation cloning was also carried out to produce pGL:+209/–594. .. Following sequence verification, DNA was in vitro methylated using either Sss1, HpaII, or HhaI methylases (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions.

    Article Title: Paternal age effects on sperm FOXK1 and KCNA7 methylation and transmission into the next generation
    Article Snippet: Following double digestion of pCpGL vector and FOXK1 insert with BamHI and HindIII (New England Biolabs, Frankfurt, Germany), the insert was ligated into the multiple cloning site upstream of the luciferase gene. .. The pCpGL vector with FOXK1 insert was in vitro methylated using SssI , HhaI , and HpaII methylases (New England Biolabs, Frankfurt, Germany).

    Article Title: Closely related proteins MBD2 and MBD3 play distinctive but interacting roles in mouse development
    Article Snippet: The pGLPgk plasmid was made by cloning the murine phosphoglycerate kinase promoter from the pHA59 plasmid (Austin Smith, Edinburgh University) into the pGL2-Basic vector (Promega). .. Plasmids were methylated to completion using M.SssI (New England Biolabs), and methylation reactions were verified by digestion with Msp I, Hpa II, and Hha I (New England Biolabs).

    Amplification:

    Article Title: Genome-Wide DNA Methylation Analysis of Human Pancreatic Islets from Type 2 Diabetic and Non-Diabetic Donors Identifies Candidate Genes That Influence Insulin Secretion
    Article Snippet: Amplification of CDKN1A and PDE7B DNA sequences and insertion into the pCpGL-basic vector was done by GenScript (Piscataway, NJ, USA). .. The constructs were either mock-methylated or methylated using two different DNA methyltransferases; Sss I and Hha I (New England Biolabs, Frankfurt am Main, Germany).

    Article Title: Species-specific viability analysis of Pseudomonas aeruginosa, Burkholderia cepacia and Staphylococcus aureus in mixed culture by flow cytometry
    Article Snippet: 16S rRNA genes were amplified by a gene-specific and fluorescently labeled primer using Polymerase Chain Reaction (PCR) method. .. Subsequently, amplicons were restricted with an HhaI endonuclease (R0139L, New England Biolabs Inc., Ipswich, MA, USA).

    Article Title: Functional correlates of Apolipoprotein E genotype in Frontotemporal Lobar Degeneration
    Article Snippet: Genomic DNA was extracted from blood samples according to standard procedures. .. Genetic variation at the ApoE locus was determined by restriction isotyping using FTLDR amplification and subsequent digestion with Hha I (New England Biolabs ). .. Clinical diagnosis and SPECT analysis were performed in blind to ApoE genotype.

    Article Title: Placenta-specific Methylation of the Vitamin D 24-Hydroxylase Gene
    Article Snippet: The SalI-digested amplicon was cloned into a promoterless luciferase expression vector pGL3:basic (Promega, Madison, WI) to produce the plasmid pGL3:–594/+209. .. Following sequence verification, DNA was in vitro methylated using either Sss1, HpaII, or HhaI methylases (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions.

    Article Title: Mutation analysis at codon 838 of the Guanylate Cyclase 2D gene in Spanish families with autosomal dominant cone, cone-rod, and macular dystrophies
    Article Snippet: Exon 13 of the human GUCY2D gene, which includes codon 838 and surrounding codons, was directly amplified from genomic DNA using primers previously described [ ] Forward primer: 5′CAG CTT TAC CAG CTT CCT TC 3′, melting temperature=56.9 °C; Reverse primer: 5′ GCA GGC AGT GAG GTC ACC TG 3′, melting temperature=64.4 °C). .. The PCR products (278 base pairs length) were digested with HhaI according to the manufacturer instructions (New England BioLabs, Beverly, MA) and resolved by electrophoresis in 5% metaphor agarose (Lonza, Rockland, ME).

    Article Title: Bacteria in Crude Oil Survived Autoclaving and Stimulated Differentially by Exogenous Bacteria
    Article Snippet: T-RFLP analysis was performed according to a previously described protocol . .. Briefly, 10 µl of a purified DNA amplicon (obtained with the 6-FAM labeled primer) was digested in a 20-µl reaction mixture for 6 h at 37°C with 20 U of Hha I (New England Biolabs, Beverly, MA, USA), according to the manufacturer's instructions. .. After a desalting step, the purified digested DNA was mixed with 12 µl of Hi-Di formamide and 0.5 µl of a DNA fragment length internal standard (GeneScan Liz-500; Applied Biosystem, IL, USA), denaturated at 95°C for 5 min, and immediately snap-cooled on ice.

    Article Title: Impact of 5-HTTLPR on hippocampal subregional activation in older adults
    Article Snippet: Amplification reactions were carried out in 30 μl volume reactions containing 1 μg of DNA, 1 pmol μl−1 of each primer, 10% dimethyl sulfoxide, and 0.025 units μl−1 Taq polymerase. .. Following an initial denaturation step for 5 min at 95 °C amplification was achieved by 30 cycles of 60 °C for 1 min, 70 °C for 2 min and 95 °C for 1 min. After PCR amplification, 5 units of Hha I (New England Biolabs, Ipswich, MA, USA) were added directly to each reaction mixture for 3 h at 37 °C. .. Each reaction mixture was loaded onto an 8% polyacrylamide gel.

    Article Title: Association between ACE (rs4646994), FABP2 (rs1799883), MTHFR (rs1801133), FTO (rs9939609) Genes Polymorphism and Type 2 Diabetes with Dyslipidemia
    Article Snippet: The PCR products were analyzed on 2% agarose gel stained with ethidium bromide to certify the proper amplification. .. The amplified PCR products of 180 bp were digested with the addition of 2 U HhaI (New England Biolabs), 10 mmol/l Tris-HCl pH 7.9, 50 mmol/l NaCl, 10 mmol/l MgCl2 and 1 mmol/l dithiothreitol. .. After incubation at 37 °C for 2 hours, digested samples were separated on 10% ethidium bromide stained polyacrylamide gel after electrophoresis and were visualized by UVP BIOIMAGING gel doc system ( ).

    Article Title: Comparison of Genospecies and Antimicrobial Resistance Profiles of Isolates in the Acinetobacter calcoaceticus-Acinetobacter baumannii Complex from Various Clinical Specimens
    Article Snippet: Amplification was performed using 5 μl of DNA extract in a 50-μl PCR mixture containing 1 U of Taq polymerase (Fermentas, Vilnius, Lithuania), 200 mM each deoxynucleoside triphosphate (Viogen, New Taipei City, Taiwan), and 0.2 mM each primer in reaction buffer (1.5 mM MgCl2 and 50 mM KCl in 10 mM Tris-HCl, pH 8.3). .. Three restriction endonucleases, AluI, HhaI, and MboI (New England BioLabs, Beverly, MA), were used for DNA digestion following the manufacturer's instructions.

    Reporter Assay:

    Article Title: Paternal age effects on sperm FOXK1 and KCNA7 methylation and transmission into the next generation
    Article Snippet: Paragraph title: Luciferase reporter assay ... The pCpGL vector with FOXK1 insert was in vitro methylated using SssI , HhaI , and HpaII methylases (New England Biolabs, Frankfurt, Germany).

    Construct:

    Article Title: Genome-Wide DNA Methylation Analysis of Human Pancreatic Islets from Type 2 Diabetic and Non-Diabetic Donors Identifies Candidate Genes That Influence Insulin Secretion
    Article Snippet: Amplification of CDKN1A and PDE7B DNA sequences and insertion into the pCpGL-basic vector was done by GenScript (Piscataway, NJ, USA). .. The constructs were either mock-methylated or methylated using two different DNA methyltransferases; Sss I and Hha I (New England Biolabs, Frankfurt am Main, Germany). .. While Sss I methylates all cytosine residues within the double stranded dinucleotide recognition sequence CG, Hha I only methylates the internal cytosine residue in GCGC sequence.

    Article Title: Osteoponin Promoter Controlled by DNA Methylation: Aberrant Methylation in Cloned Porcine Genome
    Article Snippet: The OPN reporter construct −495-luc was methylated by incubation with Sss I methyltransferase (New England BioLabs). .. The −2615-luc construct was methylated by Hha I and Hpa II methyltransferase (New England BioLabs) for 16 h at 37°C. .. The methylation status was also verified by digested with Hha I and Hpa II enzyme.

    Article Title: Closely related proteins MBD2 and MBD3 play distinctive but interacting roles in mouse development
    Article Snippet: A CMV–MBD2 expression construct (50 ng) also was added to some wells. .. Plasmids were methylated to completion using M.SssI (New England Biolabs), and methylation reactions were verified by digestion with Msp I, Hpa II, and Hha I (New England Biolabs).

    Electrophoresis:

    Article Title: Mutation analysis at codon 838 of the Guanylate Cyclase 2D gene in Spanish families with autosomal dominant cone, cone-rod, and macular dystrophies
    Article Snippet: After an initial denaturation of 95 °C for 5 min, 30 cycles were performed at 95 °C for 30 s, 63 °C for 20 s, and 74 °C for 50 s, with a final extension step of 74 °C for 5 min. .. The PCR products (278 base pairs length) were digested with HhaI according to the manufacturer instructions (New England BioLabs, Beverly, MA) and resolved by electrophoresis in 5% metaphor agarose (Lonza, Rockland, ME). .. Wild-type samples produce two fragments of 130 bp and 150 bp, but the restriction target site (5′-… GCGC …-3′) in exon 13 of GUCY2D , which lies between the last nucleotide of codon 837 and the last nucleotides of codon 838 (both included), is destroyed by the previously reported mutations at these two codons ( ).

    Article Title: Bacteria in Crude Oil Survived Autoclaving and Stimulated Differentially by Exogenous Bacteria
    Article Snippet: Briefly, 10 µl of a purified DNA amplicon (obtained with the 6-FAM labeled primer) was digested in a 20-µl reaction mixture for 6 h at 37°C with 20 U of Hha I (New England Biolabs, Beverly, MA, USA), according to the manufacturer's instructions. .. After a desalting step, the purified digested DNA was mixed with 12 µl of Hi-Di formamide and 0.5 µl of a DNA fragment length internal standard (GeneScan Liz-500; Applied Biosystem, IL, USA), denaturated at 95°C for 5 min, and immediately snap-cooled on ice.

    Incubation:

    Article Title: AP-2? Induces Epigenetic Silencing of Tumor Suppressive Genes and Microsatellite Instability in Head and Neck Squamous Cell Carcinoma
    Article Snippet: Global methylation status was analyzed in SCC22B cells +/− AP-2α shRNA. .. 1ug of DNA was incubated with 1 unit HhaI (New England Biolabs) at 37 degrees Celsius for 3 hours. .. The digests were then loaded onto a 1% agarose gel for comparison.

    Article Title: Osteoponin Promoter Controlled by DNA Methylation: Aberrant Methylation in Cloned Porcine Genome
    Article Snippet: The OPN reporter construct −495-luc was methylated by incubation with Sss I methyltransferase (New England BioLabs). .. The −2615-luc construct was methylated by Hha I and Hpa II methyltransferase (New England BioLabs) for 16 h at 37°C.

    Luciferase:

    Article Title: Genome-Wide DNA Methylation Analysis of Human Pancreatic Islets from Type 2 Diabetic and Non-Diabetic Donors Identifies Candidate Genes That Influence Insulin Secretion
    Article Snippet: Paragraph title: Luciferase assays ... The constructs were either mock-methylated or methylated using two different DNA methyltransferases; Sss I and Hha I (New England Biolabs, Frankfurt am Main, Germany).

    Article Title: Placenta-specific Methylation of the Vitamin D 24-Hydroxylase Gene
    Article Snippet: The SalI-digested amplicon was cloned into a promoterless luciferase expression vector pGL3:basic (Promega, Madison, WI) to produce the plasmid pGL3:–594/+209. .. Following sequence verification, DNA was in vitro methylated using either Sss1, HpaII, or HhaI methylases (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions.

    Article Title: Paternal age effects on sperm FOXK1 and KCNA7 methylation and transmission into the next generation
    Article Snippet: Paragraph title: Luciferase reporter assay ... The pCpGL vector with FOXK1 insert was in vitro methylated using SssI , HhaI , and HpaII methylases (New England Biolabs, Frankfurt, Germany).

    Article Title: Closely related proteins MBD2 and MBD3 play distinctive but interacting roles in mouse development
    Article Snippet: Paragraph title: Cell lines, transfections, and luciferase assays ... Plasmids were methylated to completion using M.SssI (New England Biolabs), and methylation reactions were verified by digestion with Msp I, Hpa II, and Hha I (New England Biolabs).

    Activity Assay:

    Article Title: Genome-Wide DNA Methylation Analysis of Human Pancreatic Islets from Type 2 Diabetic and Non-Diabetic Donors Identifies Candidate Genes That Influence Insulin Secretion
    Article Snippet: The constructs were either mock-methylated or methylated using two different DNA methyltransferases; Sss I and Hha I (New England Biolabs, Frankfurt am Main, Germany). .. While Sss I methylates all cytosine residues within the double stranded dinucleotide recognition sequence CG, Hha I only methylates the internal cytosine residue in GCGC sequence.

    Article Title: Paternal age effects on sperm FOXK1 and KCNA7 methylation and transmission into the next generation
    Article Snippet: The pCpGL vector completely lacks CpG dinucleotides in its backbone which could influence the activity of the luciferase reporter gene ( ). .. The pCpGL vector with FOXK1 insert was in vitro methylated using SssI , HhaI , and HpaII methylases (New England Biolabs, Frankfurt, Germany).

    Expressing:

    Article Title: Placenta-specific Methylation of the Vitamin D 24-Hydroxylase Gene
    Article Snippet: The SalI-digested amplicon was cloned into a promoterless luciferase expression vector pGL3:basic (Promega, Madison, WI) to produce the plasmid pGL3:–594/+209. .. Following sequence verification, DNA was in vitro methylated using either Sss1, HpaII, or HhaI methylases (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions.

    Article Title: WWOX expression in colorectal cancer--a real-time quantitative RT-PCR study
    Article Snippet: To assess the methylation status of one 5′-upstream region involved in regulation of WWOX expression (from −508 to −174 bp) and region adjacent to and containing WWOX promoter (from −171 to +239 bp) we used novel bisulfite-free alternative technology MethylScreen, utilising the real-time quantitative PCR assay on templates generated by combined restriction digest using: methylation-sensitive restriction enzymes (MSRE), methylation-dependent restriction enzymes (MDRE), combined double digest (both MSRE and MDRE) and mock digestion [ ]. .. The enzymes used in this study were: HhaI, HpaII (MSRE) and McrBC (MDRE; New England Biolabs, Ipswich, MA, USA); all digestions were performed according to the manufacturer's instructions on 500 ng of patient's DNA.

    Article Title: Closely related proteins MBD2 and MBD3 play distinctive but interacting roles in mouse development
    Article Snippet: A CMV–MBD2 expression construct (50 ng) also was added to some wells. .. Plasmids were methylated to completion using M.SssI (New England Biolabs), and methylation reactions were verified by digestion with Msp I, Hpa II, and Hha I (New England Biolabs).

    Transformation Assay:

    Article Title: Paternal age effects on sperm FOXK1 and KCNA7 methylation and transmission into the next generation
    Article Snippet: The vector was transformed into one-shot competent PIR1 bacterial cells (Thermo Fisher Scientific). .. The pCpGL vector with FOXK1 insert was in vitro methylated using SssI , HhaI , and HpaII methylases (New England Biolabs, Frankfurt, Germany).

    Derivative Assay:

    Article Title: Paternal age effects on sperm FOXK1 and KCNA7 methylation and transmission into the next generation
    Article Snippet: The pCpGL vector with FOXK1 insert was in vitro methylated using SssI , HhaI , and HpaII methylases (New England Biolabs, Frankfurt, Germany). .. In vitro methylation was confirmed with the methylation sensitive and insensitive restriction enzymes HpaII and MspI (New England Biolabs, Frankfurt, Germany).

    Transfection:

    Article Title: Genome-Wide DNA Methylation Analysis of Human Pancreatic Islets from Type 2 Diabetic and Non-Diabetic Donors Identifies Candidate Genes That Influence Insulin Secretion
    Article Snippet: The constructs were either mock-methylated or methylated using two different DNA methyltransferases; Sss I and Hha I (New England Biolabs, Frankfurt am Main, Germany). .. While Sss I methylates all cytosine residues within the double stranded dinucleotide recognition sequence CG, Hha I only methylates the internal cytosine residue in GCGC sequence.

    Article Title: Placenta-specific Methylation of the Vitamin D 24-Hydroxylase Gene
    Article Snippet: Following sequence verification, DNA was in vitro methylated using either Sss1, HpaII, or HhaI methylases (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions. .. 100 ng of pGL3:control vector (SV40 constitutive promoter), pGL3:basic (promoterless), or unmethylated or methylated CYP24A1 promoter constructs were then transfected into JAR and HIPEC65 cells.

    Article Title: Closely related proteins MBD2 and MBD3 play distinctive but interacting roles in mouse development
    Article Snippet: Paragraph title: Cell lines, transfections, and luciferase assays ... Plasmids were methylated to completion using M.SssI (New England Biolabs), and methylation reactions were verified by digestion with Msp I, Hpa II, and Hha I (New England Biolabs).

    Ligation:

    Article Title: Overexpression of hTERT increases stem-like properties and decreases spontaneous differentiation in human mesenchymal stem cell lines
    Article Snippet: Heat inactivation was carried out at 65°C for 20 min. Mse I fragments were then subjected to ligation with PCR linkers, Mse I linker-S (5'-TAA CTA GCA TGC-3') and Mse I linker-L (5'-AGT GGG ATT CCG CAT GCT AGT-3') overnight. .. The other half of the Mse I fragments were digested with the three methylation-sensitive endonucleases Hpa II (New England Biolabs; recognition site CCGG, 3 h, 37°C), Hha I (New England Biolabs; recognition site CGCG, 3 h, 37°C) and Bst UI (New England Biolabs; recognition site CGCG, 3 h, 60°C) according to the recommendations of the supplier.

    Generated:

    Article Title: Use of stable isotope-labelled cells to identify active grazers of picocyanobacteria in ocean surface waters
    Article Snippet: Fluorescently labelled PCR products for the T-RFLP analysis were generated by the PCR protocol described above, using a FAM-labelled forward primer. .. PCR products were digested with the restriction endonucleases HhaI and RsaI (New England Biolabs, Ipswich, MA, USA).

    Article Title: WWOX expression in colorectal cancer--a real-time quantitative RT-PCR study
    Article Snippet: To assess the methylation status of one 5′-upstream region involved in regulation of WWOX expression (from −508 to −174 bp) and region adjacent to and containing WWOX promoter (from −171 to +239 bp) we used novel bisulfite-free alternative technology MethylScreen, utilising the real-time quantitative PCR assay on templates generated by combined restriction digest using: methylation-sensitive restriction enzymes (MSRE), methylation-dependent restriction enzymes (MDRE), combined double digest (both MSRE and MDRE) and mock digestion [ ]. .. The enzymes used in this study were: HhaI, HpaII (MSRE) and McrBC (MDRE; New England Biolabs, Ipswich, MA, USA); all digestions were performed according to the manufacturer's instructions on 500 ng of patient's DNA.

    other:

    Article Title: Telomere Terminal G/C Strand Synthesis: Measuring Telomerase Action and C-rich Fill-in
    Article Snippet: 10×NEB buffer 2 (NEB Inc) Restriction enzymes: Hinf I, Rsa I, Msp I, Hae III, Alu I, Hha I (NEB) CsCl (USB Inc) 1M Tris-HCl (pH 8.0) 0.5M EDTA (pH 8.0) Ultracentrifuge L8-M with VTi80 vertical rotor (Beckman Inc) (see ) Quick-seal centrifuge tubes (13×51mm) (Beckman) Light mineral oil (Sigma-Aldrich) 27guage 1/2″ and 21guage 1″ needles, 5ml syringe and 0.5ml tube Refractometer (Milto Roy)

    Sequencing:

    Article Title: Placenta-specific Methylation of the Vitamin D 24-Hydroxylase Gene
    Article Snippet: Reverse orientation cloning was also carried out to produce pGL:+209/–594. .. Following sequence verification, DNA was in vitro methylated using either Sss1, HpaII, or HhaI methylases (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions. .. 100 ng of pGL3:control vector (SV40 constitutive promoter), pGL3:basic (promoterless), or unmethylated or methylated CYP24A1 promoter constructs were then transfected into JAR and HIPEC65 cells.

    Article Title: Mutation analysis at codon 838 of the Guanylate Cyclase 2D gene in Spanish families with autosomal dominant cone, cone-rod, and macular dystrophies
    Article Snippet: The PCR products (278 base pairs length) were digested with HhaI according to the manufacturer instructions (New England BioLabs, Beverly, MA) and resolved by electrophoresis in 5% metaphor agarose (Lonza, Rockland, ME). .. The PCR products (278 base pairs length) were digested with HhaI according to the manufacturer instructions (New England BioLabs, Beverly, MA) and resolved by electrophoresis in 5% metaphor agarose (Lonza, Rockland, ME).

    DNA Extraction:

    Article Title: Comparison of Genospecies and Antimicrobial Resistance Profiles of Isolates in the Acinetobacter calcoaceticus-Acinetobacter baumannii Complex from Various Clinical Specimens
    Article Snippet: Paragraph title: DNA extraction and ARDRA for the ITS region of the 16S-23S rRNA gene of isolates in the A. calcoaceticus-A. baumannii complex. ... Three restriction endonucleases, AluI, HhaI, and MboI (New England BioLabs, Beverly, MA), were used for DNA digestion following the manufacturer's instructions.

    MTT Assay:

    Article Title: CpG methylation potentiates pixantrone and doxorubicin-induced DNA damage and is a marker of drug sensitivity
    Article Snippet: Cisplatin and 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) were from Sigma Chemical Co, while formaldehyde was purchased from BDH. .. The DNA modifying enzymes HpaII methylase, HhaI methylase and MspI methylase were purchased from New England Biolabs.

    DNA Purification:

    Article Title: Species-specific viability analysis of Pseudomonas aeruginosa, Burkholderia cepacia and Staphylococcus aureus in mixed culture by flow cytometry
    Article Snippet: DNA of mixed sample was extracted by enzymatic cell lysis followed by DNA purification applying a commercially available kit (QIAamp DNA Blood Mini Kit, QIAGEN, Hilden, Germany). .. Subsequently, amplicons were restricted with an HhaI endonuclease (R0139L, New England Biolabs Inc., Ipswich, MA, USA).

    Fluorescence:

    Article Title: Paternal age effects on sperm FOXK1 and KCNA7 methylation and transmission into the next generation
    Article Snippet: The pCpGL vector with FOXK1 insert was in vitro methylated using SssI , HhaI , and HpaII methylases (New England Biolabs, Frankfurt, Germany). .. Luciferase activity was measured with a Berthold Tristar microplate luminometer.

    Methylation:

    Article Title: Genome-Wide DNA Methylation Analysis of Human Pancreatic Islets from Type 2 Diabetic and Non-Diabetic Donors Identifies Candidate Genes That Influence Insulin Secretion
    Article Snippet: Amplification of CDKN1A and PDE7B DNA sequences and insertion into the pCpGL-basic vector was done by GenScript (Piscataway, NJ, USA). .. The constructs were either mock-methylated or methylated using two different DNA methyltransferases; Sss I and Hha I (New England Biolabs, Frankfurt am Main, Germany). .. While Sss I methylates all cytosine residues within the double stranded dinucleotide recognition sequence CG, Hha I only methylates the internal cytosine residue in GCGC sequence.

    Article Title: Placenta-specific Methylation of the Vitamin D 24-Hydroxylase Gene
    Article Snippet: Reverse orientation cloning was also carried out to produce pGL:+209/–594. .. Following sequence verification, DNA was in vitro methylated using either Sss1, HpaII, or HhaI methylases (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions. .. 100 ng of pGL3:control vector (SV40 constitutive promoter), pGL3:basic (promoterless), or unmethylated or methylated CYP24A1 promoter constructs were then transfected into JAR and HIPEC65 cells.

    Article Title: AP-2? Induces Epigenetic Silencing of Tumor Suppressive Genes and Microsatellite Instability in Head and Neck Squamous Cell Carcinoma
    Article Snippet: Global methylation status was analyzed in SCC22B cells +/− AP-2α shRNA. .. 1ug of DNA was incubated with 1 unit HhaI (New England Biolabs) at 37 degrees Celsius for 3 hours.

    Article Title: Overexpression of hTERT increases stem-like properties and decreases spontaneous differentiation in human mesenchymal stem cell lines
    Article Snippet: Half of the resulting ligated Mse I fragments were digested with the restriction enzyme McrBC (New England Biolabs, Beverly, MA, http://www.neb.com ) for 3 h following the conditions recommended by the supplier. .. The other half of the Mse I fragments were digested with the three methylation-sensitive endonucleases Hpa II (New England Biolabs; recognition site CCGG, 3 h, 37°C), Hha I (New England Biolabs; recognition site CGCG, 3 h, 37°C) and Bst UI (New England Biolabs; recognition site CGCG, 3 h, 60°C) according to the recommendations of the supplier. .. Digested DNA fragments were then treated with 1 μl Proteinase K (Invitrogen) for 1 h at 37°C with subsequent heat inactivation at 80°C for 10 min. For the LM-PCR steps, 2× PCR Master Mix (Promega, Madison, WI, http://www.promega.com ) was added to a final volume of 50 μl.

    Article Title: WWOX expression in colorectal cancer--a real-time quantitative RT-PCR study
    Article Snippet: Paragraph title: Analysis of WWOX methylation status ... The enzymes used in this study were: HhaI, HpaII (MSRE) and McrBC (MDRE; New England Biolabs, Ipswich, MA, USA); all digestions were performed according to the manufacturer's instructions on 500 ng of patient's DNA.

    Article Title: Osteoponin Promoter Controlled by DNA Methylation: Aberrant Methylation in Cloned Porcine Genome
    Article Snippet: The OPN reporter construct −495-luc was methylated by incubation with Sss I methyltransferase (New England BioLabs). .. The −2615-luc construct was methylated by Hha I and Hpa II methyltransferase (New England BioLabs) for 16 h at 37°C. .. The methylation status was also verified by digested with Hha I and Hpa II enzyme.

    Article Title: Paternal age effects on sperm FOXK1 and KCNA7 methylation and transmission into the next generation
    Article Snippet: Plasmid DNA was purified using a Midi or Maxi Prep kit (Zymo Research; Irvine, CA). .. The pCpGL vector with FOXK1 insert was in vitro methylated using SssI , HhaI , and HpaII methylases (New England Biolabs, Frankfurt, Germany). .. In vitro methylation was confirmed with the methylation sensitive and insensitive restriction enzymes HpaII and MspI (New England Biolabs, Frankfurt, Germany).

    Article Title: Closely related proteins MBD2 and MBD3 play distinctive but interacting roles in mouse development
    Article Snippet: Relative luciferase values are defined as the corrected value obtained using a methylated test plasmid divided by the corrected value obtained using the unmethylated test plasmid. .. Plasmids were methylated to completion using M.SssI (New England Biolabs), and methylation reactions were verified by digestion with Msp I, Hpa II, and Hha I (New England Biolabs). .. Pups were cross-fostered on the day of birth after normalization of litter sizes.

    Labeling:

    Article Title: Species-specific viability analysis of Pseudomonas aeruginosa, Burkholderia cepacia and Staphylococcus aureus in mixed culture by flow cytometry
    Article Snippet: 16S rRNA genes were amplified by a gene-specific and fluorescently labeled primer using Polymerase Chain Reaction (PCR) method. .. Subsequently, amplicons were restricted with an HhaI endonuclease (R0139L, New England Biolabs Inc., Ipswich, MA, USA).

    Article Title: Bacteria in Crude Oil Survived Autoclaving and Stimulated Differentially by Exogenous Bacteria
    Article Snippet: T-RFLP analysis was performed according to a previously described protocol . .. Briefly, 10 µl of a purified DNA amplicon (obtained with the 6-FAM labeled primer) was digested in a 20-µl reaction mixture for 6 h at 37°C with 20 U of Hha I (New England Biolabs, Beverly, MA, USA), according to the manufacturer's instructions. .. After a desalting step, the purified digested DNA was mixed with 12 µl of Hi-Di formamide and 0.5 µl of a DNA fragment length internal standard (GeneScan Liz-500; Applied Biosystem, IL, USA), denaturated at 95°C for 5 min, and immediately snap-cooled on ice.

    Purification:

    Article Title: Species-specific viability analysis of Pseudomonas aeruginosa, Burkholderia cepacia and Staphylococcus aureus in mixed culture by flow cytometry
    Article Snippet: Amplicons were then purified using an agarose gel and a commercially available extraction kit (QIAquick Gel Extraction Kit, QIAGEN, Hilden, Germany). .. Subsequently, amplicons were restricted with an HhaI endonuclease (R0139L, New England Biolabs Inc., Ipswich, MA, USA).

    Article Title: CpG methylation potentiates pixantrone and doxorubicin-induced DNA damage and is a marker of drug sensitivity
    Article Snippet: The DNA modifying enzymes HpaII methylase, HhaI methylase and MspI methylase were purchased from New England Biolabs. .. The DNA modifying enzymes HpaII methylase, HhaI methylase and MspI methylase were purchased from New England Biolabs.

    Article Title: Overexpression of hTERT increases stem-like properties and decreases spontaneous differentiation in human mesenchymal stem cell lines
    Article Snippet: The other half of the Mse I fragments were digested with the three methylation-sensitive endonucleases Hpa II (New England Biolabs; recognition site CCGG, 3 h, 37°C), Hha I (New England Biolabs; recognition site CGCG, 3 h, 37°C) and Bst UI (New England Biolabs; recognition site CGCG, 3 h, 60°C) according to the recommendations of the supplier. .. The other half of the Mse I fragments were digested with the three methylation-sensitive endonucleases Hpa II (New England Biolabs; recognition site CCGG, 3 h, 37°C), Hha I (New England Biolabs; recognition site CGCG, 3 h, 37°C) and Bst UI (New England Biolabs; recognition site CGCG, 3 h, 60°C) according to the recommendations of the supplier.

    Article Title: Bacteria in Crude Oil Survived Autoclaving and Stimulated Differentially by Exogenous Bacteria
    Article Snippet: T-RFLP analysis was performed according to a previously described protocol . .. Briefly, 10 µl of a purified DNA amplicon (obtained with the 6-FAM labeled primer) was digested in a 20-µl reaction mixture for 6 h at 37°C with 20 U of Hha I (New England Biolabs, Beverly, MA, USA), according to the manufacturer's instructions. .. After a desalting step, the purified digested DNA was mixed with 12 µl of Hi-Di formamide and 0.5 µl of a DNA fragment length internal standard (GeneScan Liz-500; Applied Biosystem, IL, USA), denaturated at 95°C for 5 min, and immediately snap-cooled on ice.

    Article Title: Paternal age effects on sperm FOXK1 and KCNA7 methylation and transmission into the next generation
    Article Snippet: Plasmid DNA was purified using a Midi or Maxi Prep kit (Zymo Research; Irvine, CA). .. The pCpGL vector with FOXK1 insert was in vitro methylated using SssI , HhaI , and HpaII methylases (New England Biolabs, Frankfurt, Germany).

    Polymerase Chain Reaction:

    Article Title: Species-specific viability analysis of Pseudomonas aeruginosa, Burkholderia cepacia and Staphylococcus aureus in mixed culture by flow cytometry
    Article Snippet: 16S rRNA genes were amplified by a gene-specific and fluorescently labeled primer using Polymerase Chain Reaction (PCR) method. .. Subsequently, amplicons were restricted with an HhaI endonuclease (R0139L, New England Biolabs Inc., Ipswich, MA, USA).

    Article Title: Use of stable isotope-labelled cells to identify active grazers of picocyanobacteria in ocean surface waters
    Article Snippet: Fluorescently labelled PCR products for the T-RFLP analysis were generated by the PCR protocol described above, using a FAM-labelled forward primer. .. PCR products were digested with the restriction endonucleases HhaI and RsaI (New England Biolabs, Ipswich, MA, USA). .. The resulting fluorescent terminal fragments were resolved and analysed at the Roy J.

    Article Title: Overexpression of hTERT increases stem-like properties and decreases spontaneous differentiation in human mesenchymal stem cell lines
    Article Snippet: Heat inactivation was carried out at 65°C for 20 min. Mse I fragments were then subjected to ligation with PCR linkers, Mse I linker-S (5'-TAA CTA GCA TGC-3') and Mse I linker-L (5'-AGT GGG ATT CCG CAT GCT AGT-3') overnight. .. The other half of the Mse I fragments were digested with the three methylation-sensitive endonucleases Hpa II (New England Biolabs; recognition site CCGG, 3 h, 37°C), Hha I (New England Biolabs; recognition site CGCG, 3 h, 37°C) and Bst UI (New England Biolabs; recognition site CGCG, 3 h, 60°C) according to the recommendations of the supplier.

    Article Title: Mutation analysis at codon 838 of the Guanylate Cyclase 2D gene in Spanish families with autosomal dominant cone, cone-rod, and macular dystrophies
    Article Snippet: After an initial denaturation of 95 °C for 5 min, 30 cycles were performed at 95 °C for 30 s, 63 °C for 20 s, and 74 °C for 50 s, with a final extension step of 74 °C for 5 min. .. The PCR products (278 base pairs length) were digested with HhaI according to the manufacturer instructions (New England BioLabs, Beverly, MA) and resolved by electrophoresis in 5% metaphor agarose (Lonza, Rockland, ME). .. Wild-type samples produce two fragments of 130 bp and 150 bp, but the restriction target site (5′-… GCGC …-3′) in exon 13 of GUCY2D , which lies between the last nucleotide of codon 837 and the last nucleotides of codon 838 (both included), is destroyed by the previously reported mutations at these two codons ( ).

    Article Title: Plasmodium vivax msp-3α polymorphisms: analysis in the Indian subcontinent
    Article Snippet: Characterization of the allelic patterns of the 167 PCR single clone isolates obtained was performed using the Alu I and Hha I restriction enzymes based on the methods reported by Bruce et al. [ ]. .. To determine the level of Pvmsp -3α polymorphism, RFLP analysis was carried out using the Hha I and Alu I restriction enzymes (NEB, Inc, Beverly, MA, USA) in a 10-µL reaction volume.

    Article Title: Impact of 5-HTTLPR on hippocampal subregional activation in older adults
    Article Snippet: Amplification reactions were carried out in 30 μl volume reactions containing 1 μg of DNA, 1 pmol μl−1 of each primer, 10% dimethyl sulfoxide, and 0.025 units μl−1 Taq polymerase. .. Following an initial denaturation step for 5 min at 95 °C amplification was achieved by 30 cycles of 60 °C for 1 min, 70 °C for 2 min and 95 °C for 1 min. After PCR amplification, 5 units of Hha I (New England Biolabs, Ipswich, MA, USA) were added directly to each reaction mixture for 3 h at 37 °C. .. Each reaction mixture was loaded onto an 8% polyacrylamide gel.

    Article Title: Paternal age effects on sperm FOXK1 and KCNA7 methylation and transmission into the next generation
    Article Snippet: Colony PCR was performed to check whether the insert is in the right orientation using primers F1 (AAACCACTGATTTTTGTTTATGTGA) and R1 (AGAAAGTGGCTCCAGAGGAA) or F2 (ACCTCAAG GTCTGTTGATCAG) and R2 (GACCAGGGCATACCTCTTCA), respectively. .. The pCpGL vector with FOXK1 insert was in vitro methylated using SssI , HhaI , and HpaII methylases (New England Biolabs, Frankfurt, Germany).

    Article Title: Association between ACE (rs4646994), FABP2 (rs1799883), MTHFR (rs1801133), FTO (rs9939609) Genes Polymorphism and Type 2 Diabetes with Dyslipidemia
    Article Snippet: The PCR products were analyzed on 2% agarose gel stained with ethidium bromide to certify the proper amplification. .. The amplified PCR products of 180 bp were digested with the addition of 2 U HhaI (New England Biolabs), 10 mmol/l Tris-HCl pH 7.9, 50 mmol/l NaCl, 10 mmol/l MgCl2 and 1 mmol/l dithiothreitol. .. After incubation at 37 °C for 2 hours, digested samples were separated on 10% ethidium bromide stained polyacrylamide gel after electrophoresis and were visualized by UVP BIOIMAGING gel doc system ( ).

    Article Title: Comparison of Genospecies and Antimicrobial Resistance Profiles of Isolates in the Acinetobacter calcoaceticus-Acinetobacter baumannii Complex from Various Clinical Specimens
    Article Snippet: Three restriction endonucleases, AluI, HhaI, and MboI (New England BioLabs, Beverly, MA), were used for DNA digestion following the manufacturer's instructions. .. Three restriction endonucleases, AluI, HhaI, and MboI (New England BioLabs, Beverly, MA), were used for DNA digestion following the manufacturer's instructions.

    Terminal Restriction Fragment Length Polymorphism:

    Article Title: Use of stable isotope-labelled cells to identify active grazers of picocyanobacteria in ocean surface waters
    Article Snippet: Paragraph title: T-RFLP analysis ... PCR products were digested with the restriction endonucleases HhaI and RsaI (New England Biolabs, Ipswich, MA, USA).

    Article Title: Bacteria in Crude Oil Survived Autoclaving and Stimulated Differentially by Exogenous Bacteria
    Article Snippet: Paragraph title: T-RFLP analysis ... Briefly, 10 µl of a purified DNA amplicon (obtained with the 6-FAM labeled primer) was digested in a 20-µl reaction mixture for 6 h at 37°C with 20 U of Hha I (New England Biolabs, Beverly, MA, USA), according to the manufacturer's instructions.

    Cotransfection:

    Article Title: Placenta-specific Methylation of the Vitamin D 24-Hydroxylase Gene
    Article Snippet: Following sequence verification, DNA was in vitro methylated using either Sss1, HpaII, or HhaI methylases (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions. .. 100 ng of pGL3:control vector (SV40 constitutive promoter), pGL3:basic (promoterless), or unmethylated or methylated CYP24A1 promoter constructs were then transfected into JAR and HIPEC65 cells.

    Gel Extraction:

    Article Title: Species-specific viability analysis of Pseudomonas aeruginosa, Burkholderia cepacia and Staphylococcus aureus in mixed culture by flow cytometry
    Article Snippet: Amplicons were then purified using an agarose gel and a commercially available extraction kit (QIAquick Gel Extraction Kit, QIAGEN, Hilden, Germany). .. Subsequently, amplicons were restricted with an HhaI endonuclease (R0139L, New England Biolabs Inc., Ipswich, MA, USA).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Overexpression of hTERT increases stem-like properties and decreases spontaneous differentiation in human mesenchymal stem cell lines
    Article Snippet: Heat inactivation was carried out at 65°C for 20 min. Mse I fragments were then subjected to ligation with PCR linkers, Mse I linker-S (5'-TAA CTA GCA TGC-3') and Mse I linker-L (5'-AGT GGG ATT CCG CAT GCT AGT-3') overnight. .. The other half of the Mse I fragments were digested with the three methylation-sensitive endonucleases Hpa II (New England Biolabs; recognition site CCGG, 3 h, 37°C), Hha I (New England Biolabs; recognition site CGCG, 3 h, 37°C) and Bst UI (New England Biolabs; recognition site CGCG, 3 h, 60°C) according to the recommendations of the supplier.

    Plasmid Preparation:

    Article Title: Genome-Wide DNA Methylation Analysis of Human Pancreatic Islets from Type 2 Diabetic and Non-Diabetic Donors Identifies Candidate Genes That Influence Insulin Secretion
    Article Snippet: Amplification of CDKN1A and PDE7B DNA sequences and insertion into the pCpGL-basic vector was done by GenScript (Piscataway, NJ, USA). .. The constructs were either mock-methylated or methylated using two different DNA methyltransferases; Sss I and Hha I (New England Biolabs, Frankfurt am Main, Germany).

    Article Title: Placenta-specific Methylation of the Vitamin D 24-Hydroxylase Gene
    Article Snippet: The SalI-digested amplicon was cloned into a promoterless luciferase expression vector pGL3:basic (Promega, Madison, WI) to produce the plasmid pGL3:–594/+209. .. Following sequence verification, DNA was in vitro methylated using either Sss1, HpaII, or HhaI methylases (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions.

    Article Title: Paternal age effects on sperm FOXK1 and KCNA7 methylation and transmission into the next generation
    Article Snippet: Plasmid DNA was purified using a Midi or Maxi Prep kit (Zymo Research; Irvine, CA). .. The pCpGL vector with FOXK1 insert was in vitro methylated using SssI , HhaI , and HpaII methylases (New England Biolabs, Frankfurt, Germany). .. In vitro methylation was confirmed with the methylation sensitive and insensitive restriction enzymes HpaII and MspI (New England Biolabs, Frankfurt, Germany).

    Article Title: Closely related proteins MBD2 and MBD3 play distinctive but interacting roles in mouse development
    Article Snippet: Plasmids were methylated to completion using M.SssI (New England Biolabs), and methylation reactions were verified by digestion with Msp I, Hpa II, and Hha I (New England Biolabs). .. Plasmids were methylated to completion using M.SssI (New England Biolabs), and methylation reactions were verified by digestion with Msp I, Hpa II, and Hha I (New England Biolabs).

    Software:

    Article Title: Placenta-specific Methylation of the Vitamin D 24-Hydroxylase Gene
    Article Snippet: Data were analyzed using BiQ Analyser software , and clones showing less than 80% conversion or that were identified as clonal in origin were not included in subsequent analysis. .. Following sequence verification, DNA was in vitro methylated using either Sss1, HpaII, or HhaI methylases (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions.

    Article Title: Use of stable isotope-labelled cells to identify active grazers of picocyanobacteria in ocean surface waters
    Article Snippet: PCR products were digested with the restriction endonucleases HhaI and RsaI (New England Biolabs, Ipswich, MA, USA). .. PCR products were digested with the restriction endonucleases HhaI and RsaI (New England Biolabs, Ipswich, MA, USA).

    Article Title: Mutation analysis at codon 838 of the Guanylate Cyclase 2D gene in Spanish families with autosomal dominant cone, cone-rod, and macular dystrophies
    Article Snippet: The PCR products (278 base pairs length) were digested with HhaI according to the manufacturer instructions (New England BioLabs, Beverly, MA) and resolved by electrophoresis in 5% metaphor agarose (Lonza, Rockland, ME). .. The PCR products (278 base pairs length) were digested with HhaI according to the manufacturer instructions (New England BioLabs, Beverly, MA) and resolved by electrophoresis in 5% metaphor agarose (Lonza, Rockland, ME).

    Article Title: Bacteria in Crude Oil Survived Autoclaving and Stimulated Differentially by Exogenous Bacteria
    Article Snippet: Briefly, 10 µl of a purified DNA amplicon (obtained with the 6-FAM labeled primer) was digested in a 20-µl reaction mixture for 6 h at 37°C with 20 U of Hha I (New England Biolabs, Beverly, MA, USA), according to the manufacturer's instructions. .. The “Genescan” analysis was then conducted in a capillary electrophoresis system (ABI 3130 Genetic Analyzer, Applied Biosystems), according to the manufacturer's instructions.

    Real-time Polymerase Chain Reaction:

    Article Title: WWOX expression in colorectal cancer--a real-time quantitative RT-PCR study
    Article Snippet: To assess the methylation status of one 5′-upstream region involved in regulation of WWOX expression (from −508 to −174 bp) and region adjacent to and containing WWOX promoter (from −171 to +239 bp) we used novel bisulfite-free alternative technology MethylScreen, utilising the real-time quantitative PCR assay on templates generated by combined restriction digest using: methylation-sensitive restriction enzymes (MSRE), methylation-dependent restriction enzymes (MDRE), combined double digest (both MSRE and MDRE) and mock digestion [ ]. .. The enzymes used in this study were: HhaI, HpaII (MSRE) and McrBC (MDRE; New England Biolabs, Ipswich, MA, USA); all digestions were performed according to the manufacturer's instructions on 500 ng of patient's DNA.

    shRNA:

    Article Title: AP-2? Induces Epigenetic Silencing of Tumor Suppressive Genes and Microsatellite Instability in Head and Neck Squamous Cell Carcinoma
    Article Snippet: Global methylation status was analyzed in SCC22B cells +/− AP-2α shRNA. .. 1ug of DNA was incubated with 1 unit HhaI (New England Biolabs) at 37 degrees Celsius for 3 hours.

    Agarose Gel Electrophoresis:

    Article Title: Species-specific viability analysis of Pseudomonas aeruginosa, Burkholderia cepacia and Staphylococcus aureus in mixed culture by flow cytometry
    Article Snippet: Amplicons were then purified using an agarose gel and a commercially available extraction kit (QIAquick Gel Extraction Kit, QIAGEN, Hilden, Germany). .. Subsequently, amplicons were restricted with an HhaI endonuclease (R0139L, New England Biolabs Inc., Ipswich, MA, USA).

    Article Title: Association between ACE (rs4646994), FABP2 (rs1799883), MTHFR (rs1801133), FTO (rs9939609) Genes Polymorphism and Type 2 Diabetes with Dyslipidemia
    Article Snippet: The PCR products were analyzed on 2% agarose gel stained with ethidium bromide to certify the proper amplification. .. The amplified PCR products of 180 bp were digested with the addition of 2 U HhaI (New England Biolabs), 10 mmol/l Tris-HCl pH 7.9, 50 mmol/l NaCl, 10 mmol/l MgCl2 and 1 mmol/l dithiothreitol.

    In Vitro:

    Article Title: Placenta-specific Methylation of the Vitamin D 24-Hydroxylase Gene
    Article Snippet: Reverse orientation cloning was also carried out to produce pGL:+209/–594. .. Following sequence verification, DNA was in vitro methylated using either Sss1, HpaII, or HhaI methylases (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions. .. 100 ng of pGL3:control vector (SV40 constitutive promoter), pGL3:basic (promoterless), or unmethylated or methylated CYP24A1 promoter constructs were then transfected into JAR and HIPEC65 cells.

    Article Title: Osteoponin Promoter Controlled by DNA Methylation: Aberrant Methylation in Cloned Porcine Genome
    Article Snippet: Paragraph title: 2.9. In Vitro Methylation of the OPN Promoter Region ... The −2615-luc construct was methylated by Hha I and Hpa II methyltransferase (New England BioLabs) for 16 h at 37°C.

    Article Title: Paternal age effects on sperm FOXK1 and KCNA7 methylation and transmission into the next generation
    Article Snippet: Plasmid DNA was purified using a Midi or Maxi Prep kit (Zymo Research; Irvine, CA). .. The pCpGL vector with FOXK1 insert was in vitro methylated using SssI , HhaI , and HpaII methylases (New England Biolabs, Frankfurt, Germany). .. In vitro methylation was confirmed with the methylation sensitive and insensitive restriction enzymes HpaII and MspI (New England Biolabs, Frankfurt, Germany).

    Ethanol Precipitation:

    Article Title: Overexpression of hTERT increases stem-like properties and decreases spontaneous differentiation in human mesenchymal stem cell lines
    Article Snippet: The other half of the Mse I fragments were digested with the three methylation-sensitive endonucleases Hpa II (New England Biolabs; recognition site CCGG, 3 h, 37°C), Hha I (New England Biolabs; recognition site CGCG, 3 h, 37°C) and Bst UI (New England Biolabs; recognition site CGCG, 3 h, 60°C) according to the recommendations of the supplier. .. The other half of the Mse I fragments were digested with the three methylation-sensitive endonucleases Hpa II (New England Biolabs; recognition site CCGG, 3 h, 37°C), Hha I (New England Biolabs; recognition site CGCG, 3 h, 37°C) and Bst UI (New England Biolabs; recognition site CGCG, 3 h, 60°C) according to the recommendations of the supplier.

    Sampling:

    Article Title: Species-specific viability analysis of Pseudomonas aeruginosa, Burkholderia cepacia and Staphylococcus aureus in mixed culture by flow cytometry
    Article Snippet: Subsequently, amplicons were restricted with an HhaI endonuclease (R0139L, New England Biolabs Inc., Ipswich, MA, USA). .. Subsequently, amplicons were restricted with an HhaI endonuclease (R0139L, New England Biolabs Inc., Ipswich, MA, USA).

    Concentration Assay:

    Article Title: Species-specific viability analysis of Pseudomonas aeruginosa, Burkholderia cepacia and Staphylococcus aureus in mixed culture by flow cytometry
    Article Snippet: 1 mL of sample was mixed with an internal quantification standard (IQS), an aliquot of Campylobacter jejuni with a fixed cell concentration. .. Subsequently, amplicons were restricted with an HhaI endonuclease (R0139L, New England Biolabs Inc., Ipswich, MA, USA).

    E. coli Genomic Assay:

    Article Title: Fidelity Index Determination of DNA Methyltransferases
    Article Snippet: FI incubation times were extended to 16 hours, glycerol concentrations were increased from a 5% final concentration to a 10% final concentration, DNA concentrations were halved from 1 µg to 500 ng and lastly, the amount of enzyme was increased by a factor of 4. .. The digestion reaction contained 23 µg of E. coli genomic DNA pre-sheared to 1 kB fragments by a Covaris s-series sonicator, and 200 units of either MboI (NEB #R0147), HhaI (NEB #R0139) or AluI (NEB #R0137) restriction enzyme in NEB4. .. Following incubation, the DNA was purified with QIAquick columns and subsequently used as a substrate in the radioactive methylation assay (see above).

    Lysis:

    Article Title: Species-specific viability analysis of Pseudomonas aeruginosa, Burkholderia cepacia and Staphylococcus aureus in mixed culture by flow cytometry
    Article Snippet: DNA of mixed sample was extracted by enzymatic cell lysis followed by DNA purification applying a commercially available kit (QIAamp DNA Blood Mini Kit, QIAGEN, Hilden, Germany). .. Subsequently, amplicons were restricted with an HhaI endonuclease (R0139L, New England Biolabs Inc., Ipswich, MA, USA).

    Marker:

    Article Title: Impact of 5-HTTLPR on hippocampal subregional activation in older adults
    Article Snippet: The PCR products were electrophoresed through 5% polyacrylamide gel (acrylamide/bis-acrylamide ratio 19:1) at 120 V for 60 min. A 100-bp marker was used to measure the PCR product size for l and s alleles. .. Following an initial denaturation step for 5 min at 95 °C amplification was achieved by 30 cycles of 60 °C for 1 min, 70 °C for 2 min and 95 °C for 1 min. After PCR amplification, 5 units of Hha I (New England Biolabs, Ipswich, MA, USA) were added directly to each reaction mixture for 3 h at 37 °C.

    Staining:

    Article Title: Impact of 5-HTTLPR on hippocampal subregional activation in older adults
    Article Snippet: Following an initial denaturation step for 5 min at 95 °C amplification was achieved by 30 cycles of 60 °C for 1 min, 70 °C for 2 min and 95 °C for 1 min. After PCR amplification, 5 units of Hha I (New England Biolabs, Ipswich, MA, USA) were added directly to each reaction mixture for 3 h at 37 °C. .. Following an initial denaturation step for 5 min at 95 °C amplification was achieved by 30 cycles of 60 °C for 1 min, 70 °C for 2 min and 95 °C for 1 min. After PCR amplification, 5 units of Hha I (New England Biolabs, Ipswich, MA, USA) were added directly to each reaction mixture for 3 h at 37 °C.

    Article Title: Association between ACE (rs4646994), FABP2 (rs1799883), MTHFR (rs1801133), FTO (rs9939609) Genes Polymorphism and Type 2 Diabetes with Dyslipidemia
    Article Snippet: The PCR products were analyzed on 2% agarose gel stained with ethidium bromide to certify the proper amplification. .. The amplified PCR products of 180 bp were digested with the addition of 2 U HhaI (New England Biolabs), 10 mmol/l Tris-HCl pH 7.9, 50 mmol/l NaCl, 10 mmol/l MgCl2 and 1 mmol/l dithiothreitol.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars

  • 99
    New England Biolabs hhai
    Hhai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 64 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hhai/product/New England Biolabs
    Average 99 stars, based on 64 article reviews
    Price from $9.99 to $1999.99
    hhai - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results