bstni restriction enzyme  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    BstNI
    Description:
    BstNI 15 000 units
    Catalog Number:
    r0168l
    Price:
    249
    Size:
    15 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs bstni restriction enzyme
    BstNI
    BstNI 15 000 units
    https://www.bioz.com/result/bstni restriction enzyme/product/New England Biolabs
    Average 90 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    bstni restriction enzyme - by Bioz Stars, 2020-04
    90/100 stars

    Images

    1) Product Images from "Hnrnph1 Is A Quantitative Trait Gene for Methamphetamine Sensitivity"

    Article Title: Hnrnph1 Is A Quantitative Trait Gene for Methamphetamine Sensitivity

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1005713

    TALENS-targeted frameshift deletions in Hnrnph 1 +/- mice reveal Hnrnph1 as a quantitative trait gene for MA sensitivity. (a): Left TAL effector (50,191,867–50,191,883 bp) and right TAL effector (50,191,899–50,191,915 bp) separated by the Fok I cleavage zone were used to introduce frameshift deletions in the first coding exon of Hnrnph1 (exon 4) that resulted in premature stop codons ( S8 Fig ). Founder #28 contained a 16 bp deletion and Founder #22 contained an 11 bp deletion. ( b): A PCR amplicon capturing the Fok I cleavage zone was digested with BstNI. Hnrnph1 +/+ mice contained two copies of a functional BstNI restriction site and thus, restriction digest produced a single band containing digested fragments of equal size. Hnrnph1 +/- mice were heterozygous for a deletion of the BstNI site and showed both the digested band and a larger, undigested band. Gel band lanes were cropped and re-ordered to present wild-type first (+/+) followed by B6 control, and heterozygous samples (+/-). ( c): There was a significant upregulation of total Hnrnph1 transcript levels in Hnrnph1 +/- mice as indicated by cDNA amplification using qPCR primers spanning exons 4–5 that hybridized to both genotypes (t 6 = 5.69; p = 0.0013). ( d): An upregulation of total Hnrnph1 transcript levels was also indicated by cDNA amplification using qPCR primers spanning untargeted exons 6–7 (t 6 = 8.53; p = 0.00014). (e): A significant downregulation of the Hnrnph1 +/+ transcript levels was observed in Hnrnph1 +/- mice that was indicated by cDNA amplification using primers spanning exons 4–5, one of which hybridized to the deleted Hnrnph1 +/+ sequence (t 6 = 9.45; p = 0.00091; Fig 5e). *p
    Figure Legend Snippet: TALENS-targeted frameshift deletions in Hnrnph 1 +/- mice reveal Hnrnph1 as a quantitative trait gene for MA sensitivity. (a): Left TAL effector (50,191,867–50,191,883 bp) and right TAL effector (50,191,899–50,191,915 bp) separated by the Fok I cleavage zone were used to introduce frameshift deletions in the first coding exon of Hnrnph1 (exon 4) that resulted in premature stop codons ( S8 Fig ). Founder #28 contained a 16 bp deletion and Founder #22 contained an 11 bp deletion. ( b): A PCR amplicon capturing the Fok I cleavage zone was digested with BstNI. Hnrnph1 +/+ mice contained two copies of a functional BstNI restriction site and thus, restriction digest produced a single band containing digested fragments of equal size. Hnrnph1 +/- mice were heterozygous for a deletion of the BstNI site and showed both the digested band and a larger, undigested band. Gel band lanes were cropped and re-ordered to present wild-type first (+/+) followed by B6 control, and heterozygous samples (+/-). ( c): There was a significant upregulation of total Hnrnph1 transcript levels in Hnrnph1 +/- mice as indicated by cDNA amplification using qPCR primers spanning exons 4–5 that hybridized to both genotypes (t 6 = 5.69; p = 0.0013). ( d): An upregulation of total Hnrnph1 transcript levels was also indicated by cDNA amplification using qPCR primers spanning untargeted exons 6–7 (t 6 = 8.53; p = 0.00014). (e): A significant downregulation of the Hnrnph1 +/+ transcript levels was observed in Hnrnph1 +/- mice that was indicated by cDNA amplification using primers spanning exons 4–5, one of which hybridized to the deleted Hnrnph1 +/+ sequence (t 6 = 9.45; p = 0.00091; Fig 5e). *p

    Techniques Used: TALENs, Mouse Assay, Introduce, Polymerase Chain Reaction, Amplification, Functional Assay, Produced, Real-time Polymerase Chain Reaction, Sequencing

    Related Articles

    Clone Assay:

    Article Title: Sequential, Divergent, and Cooperative Requirements of Foxl2a and Foxl2b in Ovary Development and Maintenance of Zebrafish
    Article Snippet: .. After digestion with Bst N I (restriction enzyme cutting site in the spacer of foxl2a ) or Bsr D I (restriction enzyme cutting site in the spacer of foxl2b ) (New England Biolabs, Beverly, MA) respectively at 60° and 65° for 2 hr, the uncleaved DNA fragments were separated by gel electrophoresis and cloned into pMD-18T vector (Promega). .. Sequence alignments were generated to analyze whether or not the gDNA fragments from embryos injected with TALEN mRNAs were mutated.

    Article Title: Selection of functional human antibodies from retroviral display libraries
    Article Snippet: The PCR fragments were subcloned and plasmid from single bacterial clones was sequenced using the standard primers SP6 and T7. .. For the fingerprint analysis, the scFv-coding region was amplified by colony-PCR using primers CB6 and EMoSeq, and the PCR fragments were digested with BstNI (NEB).

    Amplification:

    Article Title: Selection of Recombinant Antibodies Specific for Pathogenic Streptococcus suis by Subtractive Phage Display
    Article Snippet: DNA amplification was carried out with a Perkin-Elmer 9600 thermal cycler, and the program consisted of an incubation for 10 min at 94°C and 30 cycles of 1 min at 94°C, 1 min at 55°C, and 1.5 min at 72°C, followed and 5 min at 72°C. .. PCR products were digested with Bst NI (New England Biolabs, Beverly, Mass.) or Ava II (Promega, Madison, Wis.).

    Article Title: Sequential, Divergent, and Cooperative Requirements of Foxl2a and Foxl2b in Ovary Development and Maintenance of Zebrafish
    Article Snippet: The gDNA fragments including the target site of the TALENs were amplified using foxl2a and foxl2b gene-specific primers ( ). .. After digestion with Bst N I (restriction enzyme cutting site in the spacer of foxl2a ) or Bsr D I (restriction enzyme cutting site in the spacer of foxl2b ) (New England Biolabs, Beverly, MA) respectively at 60° and 65° for 2 hr, the uncleaved DNA fragments were separated by gel electrophoresis and cloned into pMD-18T vector (Promega).

    Article Title: Development and Evaluation of a Real-Time PCR Assay for Detection of Klebsiella pneumoniae Carbapenemase Genes ▿
    Article Snippet: Amplification was performed using recombinant Taq Polymerase (Qiagen) at a final magnesium concentration of 2 mM. .. The following cycling conditions were used: 95o for 2 min, followed by 35 cycles of 94°C for 2 s, 62°C for 10 s, and 72°C for 15 s. The amplicons from KPC-positive samples were then digested at 48°C for 1 h in RsaI and BstNI (New England Biolabs, Ipswitch, MA) using NEB buffer 2 (New England Biolabs) and electrophoresed on a 2% agarose gel to differentiate bla KPC-1 , bla KPC-2 , and bla KPC-3 .

    Article Title: Hnrnph1 Is A Quantitative Trait Gene for Methamphetamine Sensitivity
    Article Snippet: PCR products were treated with the BstNI restriction enzyme (New England Biolabs) or a control enzyme-free buffer solution and incubated overnight at 60°C to ensure complete digestion. .. There were two BstNI restriction sites within the Hnrnph1 amplicon that were located proximal and distal to the TALENs Fok I cleavage zone.

    Article Title: Selection of functional human antibodies from retroviral display libraries
    Article Snippet: .. For the fingerprint analysis, the scFv-coding region was amplified by colony-PCR using primers CB6 and EMoSeq, and the PCR fragments were digested with BstNI (NEB). .. Western-blot analysis Virus particles were harvested into serum-free medium and then concentrated by ultracentrifugation in an SW41 rotor (Beckman) at 30 000 r.p.m. for 1 h at 4°C.

    Article Title: Diagnostic Molecular Markers for Phosphine Resistance in U.S. Populations of Tribolium castaneum and Rhyzopertha dominica
    Article Snippet: .. The amplified 368bp PCR product from T . castaneum and the 375bp PCR product from R . dominica were subjected to separate restriction enzyme digestion with either MboI or BstNI (New England Biolabs, MA USA) in a 10μl reaction containing 8μl of PCR product, 1μl reaction buffer and 1U restriction enzyme. .. The reaction was then incubated at 37°C for MboI or 60°C for BstNI, respectively for 15min according to manufacturer’s instruction.

    Article Title: Genetic diversity among Plasmodium vivax isolates along the Thai–Myanmar border of Thailand
    Article Snippet: One microlitres of template DNA was used to initiate amplification, followed by a second amplification, in which 1 µL of PCR products from the first amplification was used. .. Subsequently, 20 µL of the second PCR products were separately digested by restriction enzymes Alu I and Bst NI (New England Biolabs Inc., UK) according to the manufacture specification for 2 h in a total volume of 30 µL.

    Article Title: Rapid Concerted Evolution of Nuclear Ribosomal DNA in Two Tragopogon Allopolyploids of Recent and Recurrent Origin
    Article Snippet: For PCR (50 μl) amplification we used 100 ng of input RNA or 100 ng of genomic DNA as template, 40 pmol of each primer (18Sfor and 5.8Srev), 12 nmol of each dNTP, and 1.9 units of DyNAzyme II DNA polymerase (FINNZYMES, Espoo, Finland). .. Cycling conditions were as follows: initial denaturation step (92°, 180 sec) and 35 cycles of 92° for 20 sec, 57° for 30 sec, and 72° for 30 sec, followed by a final 72° extension for 10 min. To discriminate among ITS-1 variants, the PCR products were digested with Bst NI (New England Biolabs, Beverly, MA), which produces species-specific DNA fragments for each diploid progenitor ( ); the resulting fragments were separated on a 7% polyacrylamide gel.

    Positive Control:

    Article Title: G388R mutation of the FGFR4 gene is not relevant to breast cancer prognosis
    Article Snippet: As a positive control for the digestion efficiency of Bst NI, an additional Bst NI restriction site was located in the 168 bp PCR product. .. The digestion reactions contained 10 μ l of PCR product, 0.5 μ l of Bst NI (5 U; New England Biolabs, Beverly, MA, USA), 2 μ l of 10 × NEBuffer 2 (supplied with the enzyme) and 0.2 μ l bovine serum albumin (100 mg l−1 ) in a final volume of 20 μ l. These components were incubated for 60 min at 60°C.

    Construct:

    Article Title: Ligation of high-melting-temperature 'clamp' sequence extends the scanning range of rare point-mutational analysis by constant denaturant capillary electrophoresis (CDCE) to most of the human genome
    Article Snippet: Restriction digestion by BstNI and DraI (New England Biolabs, Beverly, MA) was performed with the samples of genomic DNA to liberate the HPRT target-embedded fragment of 438 bp suitable for target isolation by probe-target hybridization coupled with a biotin–streptavidin capture system ( ). .. According to this estimation, the 438 bp internal standard, constructed via PCR, was added at a fraction of 5 × 10–5 (∼2.5 × 104 copies).

    Real-time Polymerase Chain Reaction:

    Article Title: Development and Evaluation of a Real-Time PCR Assay for Detection of Klebsiella pneumoniae Carbapenemase Genes ▿
    Article Snippet: Paragraph title: KPC real-time PCR assay. ... The following cycling conditions were used: 95o for 2 min, followed by 35 cycles of 94°C for 2 s, 62°C for 10 s, and 72°C for 15 s. The amplicons from KPC-positive samples were then digested at 48°C for 1 h in RsaI and BstNI (New England Biolabs, Ipswitch, MA) using NEB buffer 2 (New England Biolabs) and electrophoresed on a 2% agarose gel to differentiate bla KPC-1 , bla KPC-2 , and bla KPC-3 .

    Article Title: Ligation of high-melting-temperature 'clamp' sequence extends the scanning range of rare point-mutational analysis by constant denaturant capillary electrophoresis (CDCE) to most of the human genome
    Article Snippet: Restriction digestion by BstNI and DraI (New England Biolabs, Beverly, MA) was performed with the samples of genomic DNA to liberate the HPRT target-embedded fragment of 438 bp suitable for target isolation by probe-target hybridization coupled with a biotin–streptavidin capture system ( ). .. A copy number of ∼5 × 108 in each sample of restriction digestion was estimated for the HPRT target by quantitative PCR, followed by CDCE ( , , ).

    Incubation:

    Article Title: Selection of Recombinant Antibodies Specific for Pathogenic Streptococcus suis by Subtractive Phage Display
    Article Snippet: DNA amplification was carried out with a Perkin-Elmer 9600 thermal cycler, and the program consisted of an incubation for 10 min at 94°C and 30 cycles of 1 min at 94°C, 1 min at 55°C, and 1.5 min at 72°C, followed and 5 min at 72°C. .. PCR products were digested with Bst NI (New England Biolabs, Beverly, Mass.) or Ava II (Promega, Madison, Wis.).

    Article Title: G388R mutation of the FGFR4 gene is not relevant to breast cancer prognosis
    Article Snippet: .. The digestion reactions contained 10 μ l of PCR product, 0.5 μ l of Bst NI (5 U; New England Biolabs, Beverly, MA, USA), 2 μ l of 10 × NEBuffer 2 (supplied with the enzyme) and 0.2 μ l bovine serum albumin (100 mg l−1 ) in a final volume of 20 μ l. These components were incubated for 60 min at 60°C. .. The digestion reactions contained 10 μ l of PCR product, 0.5 μ l of Bst NI (5 U; New England Biolabs, Beverly, MA, USA), 2 μ l of 10 × NEBuffer 2 (supplied with the enzyme) and 0.2 μ l bovine serum albumin (100 mg l−1 ) in a final volume of 20 μ l. These components were incubated for 60 min at 60°C.

    Article Title: Hnrnph1 Is A Quantitative Trait Gene for Methamphetamine Sensitivity
    Article Snippet: .. PCR products were treated with the BstNI restriction enzyme (New England Biolabs) or a control enzyme-free buffer solution and incubated overnight at 60°C to ensure complete digestion. .. Enzyme-treated PCR products and untreated controls were resolved in 2% agarose gel electrophoresis with 0.5 μg/mL ethidium bromide to visualize under UV light.

    Article Title: Diagnostic Molecular Markers for Phosphine Resistance in U.S. Populations of Tribolium castaneum and Rhyzopertha dominica
    Article Snippet: The amplified 368bp PCR product from T . castaneum and the 375bp PCR product from R . dominica were subjected to separate restriction enzyme digestion with either MboI or BstNI (New England Biolabs, MA USA) in a 10μl reaction containing 8μl of PCR product, 1μl reaction buffer and 1U restriction enzyme. .. The reaction was then incubated at 37°C for MboI or 60°C for BstNI, respectively for 15min according to manufacturer’s instruction.

    TALENs:

    Article Title: Sequential, Divergent, and Cooperative Requirements of Foxl2a and Foxl2b in Ovary Development and Maintenance of Zebrafish
    Article Snippet: The gDNA fragments including the target site of the TALENs were amplified using foxl2a and foxl2b gene-specific primers ( ). .. After digestion with Bst N I (restriction enzyme cutting site in the spacer of foxl2a ) or Bsr D I (restriction enzyme cutting site in the spacer of foxl2b ) (New England Biolabs, Beverly, MA) respectively at 60° and 65° for 2 hr, the uncleaved DNA fragments were separated by gel electrophoresis and cloned into pMD-18T vector (Promega).

    Article Title: Hnrnph1 Is A Quantitative Trait Gene for Methamphetamine Sensitivity
    Article Snippet: Paragraph title: Genotyping of TALENs-targeted Hnrnph1 +/- and Rufy1 +/- mice ... PCR products were treated with the BstNI restriction enzyme (New England Biolabs) or a control enzyme-free buffer solution and incubated overnight at 60°C to ensure complete digestion.

    Hybridization:

    Article Title: Ligation of high-melting-temperature 'clamp' sequence extends the scanning range of rare point-mutational analysis by constant denaturant capillary electrophoresis (CDCE) to most of the human genome
    Article Snippet: .. Restriction digestion by BstNI and DraI (New England Biolabs, Beverly, MA) was performed with the samples of genomic DNA to liberate the HPRT target-embedded fragment of 438 bp suitable for target isolation by probe-target hybridization coupled with a biotin–streptavidin capture system ( ). ..

    Ligation:

    Article Title: Comparative analysis of the end-joining activity of several DNA ligases
    Article Snippet: .. General materials T4 DNA ligase reaction buffer (50 mM Tris-HCl pH 7.5 @ 25°C, 1 mM ATP and 10 mM MgCl2 ) as a 10x stock, NEBNext® Quick Ligation reaction buffer (66 mM Tris pH 7.6 @ 25°C, 10 mM MgCl2 , 1 mM DTT, 1 mM ATP, 6% Polyethylene glycol (PEG 6000)) as a 5x stock, restriction endonucleases EcoRV, NruI, BstNI, Hpy188I, NdeI, BamHI, as well as λ DNA, 1 M DTT, 6x Purple Loading Dye with SDS, Proteinase K and 10 mM ATP were obtained from New England Biolabs (NEB, Ipswich, MA). .. Tris-HCl (1 M pH 7.5 @ 25°C) was obtained from Amresco (Solon, OH).

    Cell Culture:

    Article Title: Selection of functional human antibodies from retroviral display libraries
    Article Snippet: After selection, virus was harvested from the cell culture supernatant by ultracentrifugation in an SW41 rotor (Beckman) at 30 000 r.p.m. for 1 h at 4°C and RNA was purified using the QIAamp Viral RNA Mini kit (Qiagen) followed by treatment with DNase I (Promega). .. For the fingerprint analysis, the scFv-coding region was amplified by colony-PCR using primers CB6 and EMoSeq, and the PCR fragments were digested with BstNI (NEB).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Rapid Concerted Evolution of Nuclear Ribosomal DNA in Two Tragopogon Allopolyploids of Recent and Recurrent Origin
    Article Snippet: Paragraph title: RNA isolation and RT-PCR assay: ... Cycling conditions were as follows: initial denaturation step (92°, 180 sec) and 35 cycles of 92° for 20 sec, 57° for 30 sec, and 72° for 30 sec, followed by a final 72° extension for 10 min. To discriminate among ITS-1 variants, the PCR products were digested with Bst NI (New England Biolabs, Beverly, MA), which produces species-specific DNA fragments for each diploid progenitor ( ); the resulting fragments were separated on a 7% polyacrylamide gel.

    Generated:

    Article Title: Sequential, Divergent, and Cooperative Requirements of Foxl2a and Foxl2b in Ovary Development and Maintenance of Zebrafish
    Article Snippet: After digestion with Bst N I (restriction enzyme cutting site in the spacer of foxl2a ) or Bsr D I (restriction enzyme cutting site in the spacer of foxl2b ) (New England Biolabs, Beverly, MA) respectively at 60° and 65° for 2 hr, the uncleaved DNA fragments were separated by gel electrophoresis and cloned into pMD-18T vector (Promega). .. Sequence alignments were generated to analyze whether or not the gDNA fragments from embryos injected with TALEN mRNAs were mutated.

    Polymerase Chain Reaction:

    Article Title: Selection of Recombinant Antibodies Specific for Pathogenic Streptococcus suis by Subtractive Phage Display
    Article Snippet: .. PCR products were digested with Bst NI (New England Biolabs, Beverly, Mass.) or Ava II (Promega, Madison, Wis.). .. The restriction mixture, containing 50 mM NaCl, 10 mM Tris-HCl (pH 7.9), 10 mM MgCl2 , 1 mM dithiothreitol, and 4 U of Bst NI or Ava II, was added to the PCR mixture in a 1:1 ratio.

    Article Title: Development and Evaluation of a Real-Time PCR Assay for Detection of Klebsiella pneumoniae Carbapenemase Genes ▿
    Article Snippet: The following cycling conditions were used: 95o for 2 min, followed by 35 cycles of 94°C for 2 s, 62°C for 10 s, and 72°C for 15 s. The amplicons from KPC-positive samples were then digested at 48°C for 1 h in RsaI and BstNI (New England Biolabs, Ipswitch, MA) using NEB buffer 2 (New England Biolabs) and electrophoresed on a 2% agarose gel to differentiate bla KPC-1 , bla KPC-2 , and bla KPC-3 . .. For initial verification of the bla KPC PCR assay, the three reference strains and 69 ESBL-positive clinical isolates of Klebsiella spp. (39 K. pneumoniae and 30 K. oxytoca isolates) collected between 1 November 2006 and 15 March 2007 were tested.

    Article Title: G388R mutation of the FGFR4 gene is not relevant to breast cancer prognosis
    Article Snippet: .. The digestion reactions contained 10 μ l of PCR product, 0.5 μ l of Bst NI (5 U; New England Biolabs, Beverly, MA, USA), 2 μ l of 10 × NEBuffer 2 (supplied with the enzyme) and 0.2 μ l bovine serum albumin (100 mg l−1 ) in a final volume of 20 μ l. These components were incubated for 60 min at 60°C. .. The digestion reactions contained 10 μ l of PCR product, 0.5 μ l of Bst NI (5 U; New England Biolabs, Beverly, MA, USA), 2 μ l of 10 × NEBuffer 2 (supplied with the enzyme) and 0.2 μ l bovine serum albumin (100 mg l−1 ) in a final volume of 20 μ l. These components were incubated for 60 min at 60°C.

    Article Title: Hnrnph1 Is A Quantitative Trait Gene for Methamphetamine Sensitivity
    Article Snippet: .. PCR products were treated with the BstNI restriction enzyme (New England Biolabs) or a control enzyme-free buffer solution and incubated overnight at 60°C to ensure complete digestion. .. Enzyme-treated PCR products and untreated controls were resolved in 2% agarose gel electrophoresis with 0.5 μg/mL ethidium bromide to visualize under UV light.

    Article Title: Selection of functional human antibodies from retroviral display libraries
    Article Snippet: .. For the fingerprint analysis, the scFv-coding region was amplified by colony-PCR using primers CB6 and EMoSeq, and the PCR fragments were digested with BstNI (NEB). .. Western-blot analysis Virus particles were harvested into serum-free medium and then concentrated by ultracentrifugation in an SW41 rotor (Beckman) at 30 000 r.p.m. for 1 h at 4°C.

    Article Title: Diagnostic Molecular Markers for Phosphine Resistance in U.S. Populations of Tribolium castaneum and Rhyzopertha dominica
    Article Snippet: .. The amplified 368bp PCR product from T . castaneum and the 375bp PCR product from R . dominica were subjected to separate restriction enzyme digestion with either MboI or BstNI (New England Biolabs, MA USA) in a 10μl reaction containing 8μl of PCR product, 1μl reaction buffer and 1U restriction enzyme. .. The reaction was then incubated at 37°C for MboI or 60°C for BstNI, respectively for 15min according to manufacturer’s instruction.

    Article Title: Ligation of high-melting-temperature 'clamp' sequence extends the scanning range of rare point-mutational analysis by constant denaturant capillary electrophoresis (CDCE) to most of the human genome
    Article Snippet: Restriction digestion by BstNI and DraI (New England Biolabs, Beverly, MA) was performed with the samples of genomic DNA to liberate the HPRT target-embedded fragment of 438 bp suitable for target isolation by probe-target hybridization coupled with a biotin–streptavidin capture system ( ). .. According to this estimation, the 438 bp internal standard, constructed via PCR, was added at a fraction of 5 × 10–5 (∼2.5 × 104 copies).

    Article Title: Genetic diversity among Plasmodium vivax isolates along the Thai–Myanmar border of Thailand
    Article Snippet: .. Subsequently, 20 µL of the second PCR products were separately digested by restriction enzymes Alu I and Bst NI (New England Biolabs Inc., UK) according to the manufacture specification for 2 h in a total volume of 30 µL. .. The DNA fragments were separated by electrophoresis on 3 % agarose gel and visualized under UV illumination after ethidium bromide staining.

    Article Title: Rapid Concerted Evolution of Nuclear Ribosomal DNA in Two Tragopogon Allopolyploids of Recent and Recurrent Origin
    Article Snippet: .. Cycling conditions were as follows: initial denaturation step (92°, 180 sec) and 35 cycles of 92° for 20 sec, 57° for 30 sec, and 72° for 30 sec, followed by a final 72° extension for 10 min. To discriminate among ITS-1 variants, the PCR products were digested with Bst NI (New England Biolabs, Beverly, MA), which produces species-specific DNA fragments for each diploid progenitor ( ); the resulting fragments were separated on a 7% polyacrylamide gel. .. The gel was stained after electrophoresis with ethidium bromide and photographed.

    Antiviral Assay:

    Article Title: Selection of Recombinant Antibodies Specific for Pathogenic Streptococcus suis by Subtractive Phage Display
    Article Snippet: .. PCR products were digested with Bst NI (New England Biolabs, Beverly, Mass.) or Ava II (Promega, Madison, Wis.). .. The restriction mixture, containing 50 mM NaCl, 10 mM Tris-HCl (pH 7.9), 10 mM MgCl2 , 1 mM dithiothreitol, and 4 U of Bst NI or Ava II, was added to the PCR mixture in a 1:1 ratio.

    Recombinant:

    Article Title: Development and Evaluation of a Real-Time PCR Assay for Detection of Klebsiella pneumoniae Carbapenemase Genes ▿
    Article Snippet: Amplification was performed using recombinant Taq Polymerase (Qiagen) at a final magnesium concentration of 2 mM. .. The following cycling conditions were used: 95o for 2 min, followed by 35 cycles of 94°C for 2 s, 62°C for 10 s, and 72°C for 15 s. The amplicons from KPC-positive samples were then digested at 48°C for 1 h in RsaI and BstNI (New England Biolabs, Ipswitch, MA) using NEB buffer 2 (New England Biolabs) and electrophoresed on a 2% agarose gel to differentiate bla KPC-1 , bla KPC-2 , and bla KPC-3 .

    Nucleic Acid Electrophoresis:

    Article Title: Sequential, Divergent, and Cooperative Requirements of Foxl2a and Foxl2b in Ovary Development and Maintenance of Zebrafish
    Article Snippet: .. After digestion with Bst N I (restriction enzyme cutting site in the spacer of foxl2a ) or Bsr D I (restriction enzyme cutting site in the spacer of foxl2b ) (New England Biolabs, Beverly, MA) respectively at 60° and 65° for 2 hr, the uncleaved DNA fragments were separated by gel electrophoresis and cloned into pMD-18T vector (Promega). .. Sequence alignments were generated to analyze whether or not the gDNA fragments from embryos injected with TALEN mRNAs were mutated.

    Mutagenesis:

    Article Title: Sequential, Divergent, and Cooperative Requirements of Foxl2a and Foxl2b in Ovary Development and Maintenance of Zebrafish
    Article Snippet: Paragraph title: Establishment of foxl2a and foxl2b mutant zebrafish lines ... After digestion with Bst N I (restriction enzyme cutting site in the spacer of foxl2a ) or Bsr D I (restriction enzyme cutting site in the spacer of foxl2b ) (New England Biolabs, Beverly, MA) respectively at 60° and 65° for 2 hr, the uncleaved DNA fragments were separated by gel electrophoresis and cloned into pMD-18T vector (Promega).

    Isolation:

    Article Title: Development and Evaluation of a Real-Time PCR Assay for Detection of Klebsiella pneumoniae Carbapenemase Genes ▿
    Article Snippet: In brief, bacterial plasmid DNA was isolated from 2-ml cultures using QIAprep miniprep kits (Qiagen, Germantown, MD). .. The following cycling conditions were used: 95o for 2 min, followed by 35 cycles of 94°C for 2 s, 62°C for 10 s, and 72°C for 15 s. The amplicons from KPC-positive samples were then digested at 48°C for 1 h in RsaI and BstNI (New England Biolabs, Ipswitch, MA) using NEB buffer 2 (New England Biolabs) and electrophoresed on a 2% agarose gel to differentiate bla KPC-1 , bla KPC-2 , and bla KPC-3 .

    Article Title: Ligation of high-melting-temperature 'clamp' sequence extends the scanning range of rare point-mutational analysis by constant denaturant capillary electrophoresis (CDCE) to most of the human genome
    Article Snippet: .. Restriction digestion by BstNI and DraI (New England Biolabs, Beverly, MA) was performed with the samples of genomic DNA to liberate the HPRT target-embedded fragment of 438 bp suitable for target isolation by probe-target hybridization coupled with a biotin–streptavidin capture system ( ). ..

    Article Title: Rapid Concerted Evolution of Nuclear Ribosomal DNA in Two Tragopogon Allopolyploids of Recent and Recurrent Origin
    Article Snippet: Paragraph title: RNA isolation and RT-PCR assay: ... Cycling conditions were as follows: initial denaturation step (92°, 180 sec) and 35 cycles of 92° for 20 sec, 57° for 30 sec, and 72° for 30 sec, followed by a final 72° extension for 10 min. To discriminate among ITS-1 variants, the PCR products were digested with Bst NI (New England Biolabs, Beverly, MA), which produces species-specific DNA fragments for each diploid progenitor ( ); the resulting fragments were separated on a 7% polyacrylamide gel.

    Size-exclusion Chromatography:

    Article Title: Rapid Concerted Evolution of Nuclear Ribosomal DNA in Two Tragopogon Allopolyploids of Recent and Recurrent Origin
    Article Snippet: .. Cycling conditions were as follows: initial denaturation step (92°, 180 sec) and 35 cycles of 92° for 20 sec, 57° for 30 sec, and 72° for 30 sec, followed by a final 72° extension for 10 min. To discriminate among ITS-1 variants, the PCR products were digested with Bst NI (New England Biolabs, Beverly, MA), which produces species-specific DNA fragments for each diploid progenitor ( ); the resulting fragments were separated on a 7% polyacrylamide gel. .. The gel was stained after electrophoresis with ethidium bromide and photographed.

    Mouse Assay:

    Article Title: Hnrnph1 Is A Quantitative Trait Gene for Methamphetamine Sensitivity
    Article Snippet: Paragraph title: Genotyping of TALENs-targeted Hnrnph1 +/- and Rufy1 +/- mice ... PCR products were treated with the BstNI restriction enzyme (New England Biolabs) or a control enzyme-free buffer solution and incubated overnight at 60°C to ensure complete digestion.

    Sequencing:

    Article Title: Sequential, Divergent, and Cooperative Requirements of Foxl2a and Foxl2b in Ovary Development and Maintenance of Zebrafish
    Article Snippet: After digestion with Bst N I (restriction enzyme cutting site in the spacer of foxl2a ) or Bsr D I (restriction enzyme cutting site in the spacer of foxl2b ) (New England Biolabs, Beverly, MA) respectively at 60° and 65° for 2 hr, the uncleaved DNA fragments were separated by gel electrophoresis and cloned into pMD-18T vector (Promega). .. Sequence alignments were generated to analyze whether or not the gDNA fragments from embryos injected with TALEN mRNAs were mutated.

    Article Title: Development and Evaluation of a Real-Time PCR Assay for Detection of Klebsiella pneumoniae Carbapenemase Genes ▿
    Article Snippet: The following cycling conditions were used: 95o for 2 min, followed by 35 cycles of 94°C for 2 s, 62°C for 10 s, and 72°C for 15 s. The amplicons from KPC-positive samples were then digested at 48°C for 1 h in RsaI and BstNI (New England Biolabs, Ipswitch, MA) using NEB buffer 2 (New England Biolabs) and electrophoresed on a 2% agarose gel to differentiate bla KPC-1 , bla KPC-2 , and bla KPC-3 . .. The nucleotide sequence for KPC-2 differed from KPC-1 by a single nucleotide at position 650 (A→G), and the sequence for KPC-3 differed from KPC-2 by a single nucleotide at position 944 (C→T) according to the literature at the time the assay was designed.

    Article Title: Selection of functional human antibodies from retroviral display libraries
    Article Snippet: For cloning and sequence analysis, the scFv-coding region of the viral RNA was reverse transcribed into cDNA (primer EMoSeq, 5′-CGTCTCCCGATCTCCATTGGTTAC-3′), which was then amplified by PCR using primers CB6 (5′-CCCCTAATCCCCTTAATTCTTC-3′) and EMoSeq. .. For the fingerprint analysis, the scFv-coding region was amplified by colony-PCR using primers CB6 and EMoSeq, and the PCR fragments were digested with BstNI (NEB).

    Article Title: Diagnostic Molecular Markers for Phosphine Resistance in U.S. Populations of Tribolium castaneum and Rhyzopertha dominica
    Article Snippet: Development of a resistance marker A cleaved amplified polymorphic sequence (CAPS) marker assay was designed to target a SNP (single nucleotide polymorphism) found in the DLD gene sequences of TcOK-G and RdOK-G. A fragment from each of the relevant gene sequences was amplified in 25μl reaction volume (12.5μl Master Mix, 1μl each forward and reverse primer, 2μl gDNA template and 8.5μl ddH2 O) using Thermo Scientific PCR MasterMix polymerase kit as described earlier. .. The amplified 368bp PCR product from T . castaneum and the 375bp PCR product from R . dominica were subjected to separate restriction enzyme digestion with either MboI or BstNI (New England Biolabs, MA USA) in a 10μl reaction containing 8μl of PCR product, 1μl reaction buffer and 1U restriction enzyme.

    Selection:

    Article Title: Selection of functional human antibodies from retroviral display libraries
    Article Snippet: Paragraph title: Selection of the virus library and fingerprint analysis ... For the fingerprint analysis, the scFv-coding region was amplified by colony-PCR using primers CB6 and EMoSeq, and the PCR fragments were digested with BstNI (NEB).

    Nested PCR:

    Article Title: Genetic diversity among Plasmodium vivax isolates along the Thai–Myanmar border of Thailand
    Article Snippet: Briefly, Pvcsp was amplified by nested-PCR assay in a total of 25 µL and in presence of a reaction master mix containing 1X MyTag Red Mix (Bioline, UK) and 40 nM of each primer. .. Subsequently, 20 µL of the second PCR products were separately digested by restriction enzymes Alu I and Bst NI (New England Biolabs Inc., UK) according to the manufacture specification for 2 h in a total volume of 30 µL.

    Purification:

    Article Title: Selection of functional human antibodies from retroviral display libraries
    Article Snippet: After selection, virus was harvested from the cell culture supernatant by ultracentrifugation in an SW41 rotor (Beckman) at 30 000 r.p.m. for 1 h at 4°C and RNA was purified using the QIAamp Viral RNA Mini kit (Qiagen) followed by treatment with DNase I (Promega). .. For the fingerprint analysis, the scFv-coding region was amplified by colony-PCR using primers CB6 and EMoSeq, and the PCR fragments were digested with BstNI (NEB).

    Injection:

    Article Title: Sequential, Divergent, and Cooperative Requirements of Foxl2a and Foxl2b in Ovary Development and Maintenance of Zebrafish
    Article Snippet: At 24 hr after injection of TALEN mRNAs, genomic DNA (gDNA) was extracted from 20 randomly sampled embryos to evaluate the efficiency of TALEN-induced somatic mutations. .. After digestion with Bst N I (restriction enzyme cutting site in the spacer of foxl2a ) or Bsr D I (restriction enzyme cutting site in the spacer of foxl2b ) (New England Biolabs, Beverly, MA) respectively at 60° and 65° for 2 hr, the uncleaved DNA fragments were separated by gel electrophoresis and cloned into pMD-18T vector (Promega).

    Plasmid Preparation:

    Article Title: Sequential, Divergent, and Cooperative Requirements of Foxl2a and Foxl2b in Ovary Development and Maintenance of Zebrafish
    Article Snippet: .. After digestion with Bst N I (restriction enzyme cutting site in the spacer of foxl2a ) or Bsr D I (restriction enzyme cutting site in the spacer of foxl2b ) (New England Biolabs, Beverly, MA) respectively at 60° and 65° for 2 hr, the uncleaved DNA fragments were separated by gel electrophoresis and cloned into pMD-18T vector (Promega). .. Sequence alignments were generated to analyze whether or not the gDNA fragments from embryos injected with TALEN mRNAs were mutated.

    Article Title: Development and Evaluation of a Real-Time PCR Assay for Detection of Klebsiella pneumoniae Carbapenemase Genes ▿
    Article Snippet: In brief, bacterial plasmid DNA was isolated from 2-ml cultures using QIAprep miniprep kits (Qiagen, Germantown, MD). .. The following cycling conditions were used: 95o for 2 min, followed by 35 cycles of 94°C for 2 s, 62°C for 10 s, and 72°C for 15 s. The amplicons from KPC-positive samples were then digested at 48°C for 1 h in RsaI and BstNI (New England Biolabs, Ipswitch, MA) using NEB buffer 2 (New England Biolabs) and electrophoresed on a 2% agarose gel to differentiate bla KPC-1 , bla KPC-2 , and bla KPC-3 .

    Article Title: Selection of functional human antibodies from retroviral display libraries
    Article Snippet: The PCR fragments were subcloned and plasmid from single bacterial clones was sequenced using the standard primers SP6 and T7. .. For the fingerprint analysis, the scFv-coding region was amplified by colony-PCR using primers CB6 and EMoSeq, and the PCR fragments were digested with BstNI (NEB).

    Electrophoresis:

    Article Title: Genetic diversity among Plasmodium vivax isolates along the Thai–Myanmar border of Thailand
    Article Snippet: Subsequently, 20 µL of the second PCR products were separately digested by restriction enzymes Alu I and Bst NI (New England Biolabs Inc., UK) according to the manufacture specification for 2 h in a total volume of 30 µL. .. The DNA fragments were separated by electrophoresis on 3 % agarose gel and visualized under UV illumination after ethidium bromide staining.

    Article Title: Rapid Concerted Evolution of Nuclear Ribosomal DNA in Two Tragopogon Allopolyploids of Recent and Recurrent Origin
    Article Snippet: Cycling conditions were as follows: initial denaturation step (92°, 180 sec) and 35 cycles of 92° for 20 sec, 57° for 30 sec, and 72° for 30 sec, followed by a final 72° extension for 10 min. To discriminate among ITS-1 variants, the PCR products were digested with Bst NI (New England Biolabs, Beverly, MA), which produces species-specific DNA fragments for each diploid progenitor ( ); the resulting fragments were separated on a 7% polyacrylamide gel. .. The gel was stained after electrophoresis with ethidium bromide and photographed.

    Binding Assay:

    Article Title: Hnrnph1 Is A Quantitative Trait Gene for Methamphetamine Sensitivity
    Article Snippet: Genotyping of TALENs-targeted Hnrnph1 +/- and Rufy1 +/- mice An Hnrnph1 forward primer (GTTTTCTCAGACGCGTTCCT) and reverse primer (ACTGACAACTCCCGCCTCA) were designed to target upstream and downstream of the TALENs binding domain in exon 4 of Hnrnph1 . .. PCR products were treated with the BstNI restriction enzyme (New England Biolabs) or a control enzyme-free buffer solution and incubated overnight at 60°C to ensure complete digestion.

    Agarose Gel Electrophoresis:

    Article Title: Selection of Recombinant Antibodies Specific for Pathogenic Streptococcus suis by Subtractive Phage Display
    Article Snippet: PCR products were analyzed on a 1.5% agarose gel containing 0.5 μg of ethidium bromide ml−1 . .. PCR products were digested with Bst NI (New England Biolabs, Beverly, Mass.) or Ava II (Promega, Madison, Wis.).

    Article Title: Development and Evaluation of a Real-Time PCR Assay for Detection of Klebsiella pneumoniae Carbapenemase Genes ▿
    Article Snippet: .. The following cycling conditions were used: 95o for 2 min, followed by 35 cycles of 94°C for 2 s, 62°C for 10 s, and 72°C for 15 s. The amplicons from KPC-positive samples were then digested at 48°C for 1 h in RsaI and BstNI (New England Biolabs, Ipswitch, MA) using NEB buffer 2 (New England Biolabs) and electrophoresed on a 2% agarose gel to differentiate bla KPC-1 , bla KPC-2 , and bla KPC-3 . ..

    Article Title: Hnrnph1 Is A Quantitative Trait Gene for Methamphetamine Sensitivity
    Article Snippet: PCR products were treated with the BstNI restriction enzyme (New England Biolabs) or a control enzyme-free buffer solution and incubated overnight at 60°C to ensure complete digestion. .. Enzyme-treated PCR products and untreated controls were resolved in 2% agarose gel electrophoresis with 0.5 μg/mL ethidium bromide to visualize under UV light.

    Article Title: Genetic diversity among Plasmodium vivax isolates along the Thai–Myanmar border of Thailand
    Article Snippet: Subsequently, 20 µL of the second PCR products were separately digested by restriction enzymes Alu I and Bst NI (New England Biolabs Inc., UK) according to the manufacture specification for 2 h in a total volume of 30 µL. .. The DNA fragments were separated by electrophoresis on 3 % agarose gel and visualized under UV illumination after ethidium bromide staining.

    Concentration Assay:

    Article Title: Development and Evaluation of a Real-Time PCR Assay for Detection of Klebsiella pneumoniae Carbapenemase Genes ▿
    Article Snippet: Amplification was performed using recombinant Taq Polymerase (Qiagen) at a final magnesium concentration of 2 mM. .. The following cycling conditions were used: 95o for 2 min, followed by 35 cycles of 94°C for 2 s, 62°C for 10 s, and 72°C for 15 s. The amplicons from KPC-positive samples were then digested at 48°C for 1 h in RsaI and BstNI (New England Biolabs, Ipswitch, MA) using NEB buffer 2 (New England Biolabs) and electrophoresed on a 2% agarose gel to differentiate bla KPC-1 , bla KPC-2 , and bla KPC-3 .

    Article Title: G388R mutation of the FGFR4 gene is not relevant to breast cancer prognosis
    Article Snippet: Reactions were performed with 500 ng of genomic DNA in a total volume of 50 μ l containing (final concentration) 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 2.5 mM MgCl2 , 0.25 mM of the four deoxynucleotide triphosphates, 1 U of Taq polymerase (Applied Biosystems, Branchburg, NJ, USA) and 0.25 μ M of each primer. .. The digestion reactions contained 10 μ l of PCR product, 0.5 μ l of Bst NI (5 U; New England Biolabs, Beverly, MA, USA), 2 μ l of 10 × NEBuffer 2 (supplied with the enzyme) and 0.2 μ l bovine serum albumin (100 mg l−1 ) in a final volume of 20 μ l. These components were incubated for 60 min at 60°C.

    Marker:

    Article Title: Diagnostic Molecular Markers for Phosphine Resistance in U.S. Populations of Tribolium castaneum and Rhyzopertha dominica
    Article Snippet: Paragraph title: Development of a resistance marker ... The amplified 368bp PCR product from T . castaneum and the 375bp PCR product from R . dominica were subjected to separate restriction enzyme digestion with either MboI or BstNI (New England Biolabs, MA USA) in a 10μl reaction containing 8μl of PCR product, 1μl reaction buffer and 1U restriction enzyme.

    Staining:

    Article Title: G388R mutation of the FGFR4 gene is not relevant to breast cancer prognosis
    Article Snippet: The digestion reactions contained 10 μ l of PCR product, 0.5 μ l of Bst NI (5 U; New England Biolabs, Beverly, MA, USA), 2 μ l of 10 × NEBuffer 2 (supplied with the enzyme) and 0.2 μ l bovine serum albumin (100 mg l−1 ) in a final volume of 20 μ l. These components were incubated for 60 min at 60°C. .. The digestion reactions contained 10 μ l of PCR product, 0.5 μ l of Bst NI (5 U; New England Biolabs, Beverly, MA, USA), 2 μ l of 10 × NEBuffer 2 (supplied with the enzyme) and 0.2 μ l bovine serum albumin (100 mg l−1 ) in a final volume of 20 μ l. These components were incubated for 60 min at 60°C.

    Article Title: Genetic diversity among Plasmodium vivax isolates along the Thai–Myanmar border of Thailand
    Article Snippet: Subsequently, 20 µL of the second PCR products were separately digested by restriction enzymes Alu I and Bst NI (New England Biolabs Inc., UK) according to the manufacture specification for 2 h in a total volume of 30 µL. .. The DNA fragments were separated by electrophoresis on 3 % agarose gel and visualized under UV illumination after ethidium bromide staining.

    Article Title: Rapid Concerted Evolution of Nuclear Ribosomal DNA in Two Tragopogon Allopolyploids of Recent and Recurrent Origin
    Article Snippet: Cycling conditions were as follows: initial denaturation step (92°, 180 sec) and 35 cycles of 92° for 20 sec, 57° for 30 sec, and 72° for 30 sec, followed by a final 72° extension for 10 min. To discriminate among ITS-1 variants, the PCR products were digested with Bst NI (New England Biolabs, Beverly, MA), which produces species-specific DNA fragments for each diploid progenitor ( ); the resulting fragments were separated on a 7% polyacrylamide gel. .. The gel was stained after electrophoresis with ethidium bromide and photographed.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs bstni restriction enzyme
    TALENS-targeted frameshift deletions in Hnrnph 1 +/- mice reveal Hnrnph1 as a quantitative trait gene for MA sensitivity. (a): Left TAL effector (50,191,867–50,191,883 bp) and right TAL effector (50,191,899–50,191,915 bp) separated by the Fok I cleavage zone were used to introduce frameshift deletions in the first coding exon of Hnrnph1 (exon 4) that resulted in premature stop codons ( S8 Fig ). Founder #28 contained a 16 bp deletion and Founder #22 contained an 11 bp deletion. ( b): A <t>PCR</t> amplicon capturing the Fok I cleavage zone was digested with <t>BstNI.</t> Hnrnph1 +/+ mice contained two copies of a functional BstNI restriction site and thus, restriction digest produced a single band containing digested fragments of equal size. Hnrnph1 +/- mice were heterozygous for a deletion of the BstNI site and showed both the digested band and a larger, undigested band. Gel band lanes were cropped and re-ordered to present wild-type first (+/+) followed by B6 control, and heterozygous samples (+/-). ( c): There was a significant upregulation of total Hnrnph1 transcript levels in Hnrnph1 +/- mice as indicated by cDNA amplification using qPCR primers spanning exons 4–5 that hybridized to both genotypes (t 6 = 5.69; p = 0.0013). ( d): An upregulation of total Hnrnph1 transcript levels was also indicated by cDNA amplification using qPCR primers spanning untargeted exons 6–7 (t 6 = 8.53; p = 0.00014). (e): A significant downregulation of the Hnrnph1 +/+ transcript levels was observed in Hnrnph1 +/- mice that was indicated by cDNA amplification using primers spanning exons 4–5, one of which hybridized to the deleted Hnrnph1 +/+ sequence (t 6 = 9.45; p = 0.00091; Fig 5e). *p
    Bstni Restriction Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bstni restriction enzyme/product/New England Biolabs
    Average 90 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    bstni restriction enzyme - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    Image Search Results


    TALENS-targeted frameshift deletions in Hnrnph 1 +/- mice reveal Hnrnph1 as a quantitative trait gene for MA sensitivity. (a): Left TAL effector (50,191,867–50,191,883 bp) and right TAL effector (50,191,899–50,191,915 bp) separated by the Fok I cleavage zone were used to introduce frameshift deletions in the first coding exon of Hnrnph1 (exon 4) that resulted in premature stop codons ( S8 Fig ). Founder #28 contained a 16 bp deletion and Founder #22 contained an 11 bp deletion. ( b): A PCR amplicon capturing the Fok I cleavage zone was digested with BstNI. Hnrnph1 +/+ mice contained two copies of a functional BstNI restriction site and thus, restriction digest produced a single band containing digested fragments of equal size. Hnrnph1 +/- mice were heterozygous for a deletion of the BstNI site and showed both the digested band and a larger, undigested band. Gel band lanes were cropped and re-ordered to present wild-type first (+/+) followed by B6 control, and heterozygous samples (+/-). ( c): There was a significant upregulation of total Hnrnph1 transcript levels in Hnrnph1 +/- mice as indicated by cDNA amplification using qPCR primers spanning exons 4–5 that hybridized to both genotypes (t 6 = 5.69; p = 0.0013). ( d): An upregulation of total Hnrnph1 transcript levels was also indicated by cDNA amplification using qPCR primers spanning untargeted exons 6–7 (t 6 = 8.53; p = 0.00014). (e): A significant downregulation of the Hnrnph1 +/+ transcript levels was observed in Hnrnph1 +/- mice that was indicated by cDNA amplification using primers spanning exons 4–5, one of which hybridized to the deleted Hnrnph1 +/+ sequence (t 6 = 9.45; p = 0.00091; Fig 5e). *p

    Journal: PLoS Genetics

    Article Title: Hnrnph1 Is A Quantitative Trait Gene for Methamphetamine Sensitivity

    doi: 10.1371/journal.pgen.1005713

    Figure Lengend Snippet: TALENS-targeted frameshift deletions in Hnrnph 1 +/- mice reveal Hnrnph1 as a quantitative trait gene for MA sensitivity. (a): Left TAL effector (50,191,867–50,191,883 bp) and right TAL effector (50,191,899–50,191,915 bp) separated by the Fok I cleavage zone were used to introduce frameshift deletions in the first coding exon of Hnrnph1 (exon 4) that resulted in premature stop codons ( S8 Fig ). Founder #28 contained a 16 bp deletion and Founder #22 contained an 11 bp deletion. ( b): A PCR amplicon capturing the Fok I cleavage zone was digested with BstNI. Hnrnph1 +/+ mice contained two copies of a functional BstNI restriction site and thus, restriction digest produced a single band containing digested fragments of equal size. Hnrnph1 +/- mice were heterozygous for a deletion of the BstNI site and showed both the digested band and a larger, undigested band. Gel band lanes were cropped and re-ordered to present wild-type first (+/+) followed by B6 control, and heterozygous samples (+/-). ( c): There was a significant upregulation of total Hnrnph1 transcript levels in Hnrnph1 +/- mice as indicated by cDNA amplification using qPCR primers spanning exons 4–5 that hybridized to both genotypes (t 6 = 5.69; p = 0.0013). ( d): An upregulation of total Hnrnph1 transcript levels was also indicated by cDNA amplification using qPCR primers spanning untargeted exons 6–7 (t 6 = 8.53; p = 0.00014). (e): A significant downregulation of the Hnrnph1 +/+ transcript levels was observed in Hnrnph1 +/- mice that was indicated by cDNA amplification using primers spanning exons 4–5, one of which hybridized to the deleted Hnrnph1 +/+ sequence (t 6 = 9.45; p = 0.00091; Fig 5e). *p

    Article Snippet: PCR products were treated with the BstNI restriction enzyme (New England Biolabs) or a control enzyme-free buffer solution and incubated overnight at 60°C to ensure complete digestion.

    Techniques: TALENs, Mouse Assay, Introduce, Polymerase Chain Reaction, Amplification, Functional Assay, Produced, Real-time Polymerase Chain Reaction, Sequencing