bsteii restriction enzyme  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    BstEII
    Description:
    BstEII 10 000 units
    Catalog Number:
    r0162l
    Price:
    257
    Size:
    10 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs bsteii restriction enzyme
    BstEII
    BstEII 10 000 units
    https://www.bioz.com/result/bsteii restriction enzyme/product/New England Biolabs
    Average 90 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    bsteii restriction enzyme - by Bioz Stars, 2020-03
    90/100 stars

    Images

    1) Product Images from "Clinical and neuropathological phenotype associated with the novel V189I mutation in the prion protein gene"

    Article Title: Clinical and neuropathological phenotype associated with the novel V189I mutation in the prion protein gene

    Journal: Acta Neuropathologica Communications

    doi: 10.1186/s40478-018-0656-4

    Genetic studies. a : Pedigree of family of Cases 1 and 2. The proband is marked by arrow, grey symbols denote family members affected by rapidly progressive dementia, black symbols indicate family members with CJD, white symbols denote unaffected members. Crossing lines refer to deceased subjects. b : Analysis of PRNP gene by restriction fragment length polymorphism. A 448 bp region was amplified by PCR from a control subject (WT, lane 1) and a mutated heterozygous carrier (V189I, lane 3) . Digestion of PCR product by BstEII generated two fragments (244 and 204 bp) in the WT subject (lane 2). The presence of the mutation abolished the restriction site. So, a 448 bp fragment (corresponding to the mutated allele) and two 244 and 204 bp fragments (corresponding to the WT allele) were observed, as expected, in the V189I heterozygous carrier (lane 4). c : Sequence chromatogram of a subject carrying the heterozygous V189I mutation
    Figure Legend Snippet: Genetic studies. a : Pedigree of family of Cases 1 and 2. The proband is marked by arrow, grey symbols denote family members affected by rapidly progressive dementia, black symbols indicate family members with CJD, white symbols denote unaffected members. Crossing lines refer to deceased subjects. b : Analysis of PRNP gene by restriction fragment length polymorphism. A 448 bp region was amplified by PCR from a control subject (WT, lane 1) and a mutated heterozygous carrier (V189I, lane 3) . Digestion of PCR product by BstEII generated two fragments (244 and 204 bp) in the WT subject (lane 2). The presence of the mutation abolished the restriction site. So, a 448 bp fragment (corresponding to the mutated allele) and two 244 and 204 bp fragments (corresponding to the WT allele) were observed, as expected, in the V189I heterozygous carrier (lane 4). c : Sequence chromatogram of a subject carrying the heterozygous V189I mutation

    Techniques Used: Amplification, Polymerase Chain Reaction, Generated, Mutagenesis, Sequencing

    Related Articles

    Clone Assay:

    Article Title: Cloning, Transformation and Expression of Human Interferon ?2b Gene in Tobacco Plant (Nicotiana tabacum cv. xanthi)
    Article Snippet: Paragraph title: 3.4. Cloning of INFα-2b Gene in pCAMBIA1304 ... So, this was digested with BstEII and NcoI (NEB Co).

    Article Title: Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿ †
    Article Snippet: NL4-3 was chosen because this strain is commonly used for in vitro mutagenesis studies of HIV-1 replication, and its Gag sequence displays greater similarity to consensus subtype B than to other available molecular clones (13 amino acid differences from consensus subtype B, 2004). .. Plasmid pNL4-3ΔGag-Protease was developed by inserting unique BstEII restriction sites at the 5′ end of Gag and the 3′ end of the protease by using the QuikChange XL kit (Stratagene), followed by the deletion of the Gag-Protease region by BstEII digestion (New England Biolabs).

    Article Title: Mutations in Yeast Replication Proteins That Increase CAG/CTG Expansions Also Increase Repeat Fragility
    Article Snippet: Genomic DNA was digested with Bst EII (New England Biolabs), separated on a 1% agarose gel, probed with a digoxigenin-labeled probe of lambda DNA digested with Hin dIII, and detected by a chemiluminescent or colorimetric system (Roche). .. Yeast telomere addition to the C4 A4 sequence was confirmed by amplification of the junction sequence by using primers CAX29 (CGGCYCGAGCACCCACACCACACCCACAC) and C4 A4 YIP5 (ATCATTACGACCGAGATTCC), cloning the resulting PCR products, and sequence analysis of clones.

    Amplification:

    Article Title: Cloning, Transformation and Expression of Human Interferon ?2b Gene in Tobacco Plant (Nicotiana tabacum cv. xanthi)
    Article Snippet: The gene was amplified using mentioned primers, and then, PCR product was extracted from the gel using QIAGEN kit. .. So, this was digested with BstEII and NcoI (NEB Co).

    Article Title: Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿ †
    Article Snippet: Briefly, the Gag-Protease region was amplified by reverse transcription (RT)-PCR from plasma HIV-1 RNA using sequence-specific primers. .. Plasmid pNL4-3ΔGag-Protease was developed by inserting unique BstEII restriction sites at the 5′ end of Gag and the 3′ end of the protease by using the QuikChange XL kit (Stratagene), followed by the deletion of the Gag-Protease region by BstEII digestion (New England Biolabs).

    Article Title: Clinical and neuropathological phenotype associated with the novel V189I mutation in the prion protein gene
    Article Snippet: .. The presence of the V189I mutation in the PRNP gene (Fig. ) was confirmed by restriction fragment length polymorphism analysis; briefly, a 448 bp region was amplified by PCR using the primers 5’-CAACATGAAGCACATGGCTGGT-3′ and 5’-CCTTCCTCATCCCACTATCAGG-3′, the PCR product was digested by BstEII restriction enzyme (NEB) and resolved by electrophoresis on 2% agarose gel (Fig. b). .. We explored the recurrence of this mutation by consulting the Exome Aggregation Consortium (ExAC) database [ ] and found that the V189I PRNP variant is not reported.

    Article Title: Direct Identification of Mycobacterium haemophilum in Skin Lesions of Immunocompromised Patients by PCR-Restriction Endonuclease Analysis
    Article Snippet: .. Amplified DNA was restricted using BstEII and HaeIII (New England Biolabs, Beverly, Mass.) as described previously ( , ). .. Restriction fragments were electrophoresed using 3% Metaphor agarose (4-bp resolution; BioWhittaker Molecular Application, Rockland, Maine) and a Mini-Sub-Cell electrophoresis system (Scie-Plas, Warwickshire, United Kingdom) at 100 V for 1.5 to 2.0 h. PRA band sizes were estimated visually by comparison with the following molecular size markers: a 50-bp ladder (MBI Fermentas), a 100-bp ladder (BioWhittaker Molecular Application), and the PRA bands corresponding to control strains included in each run.

    Article Title: Mutations in Yeast Replication Proteins That Increase CAG/CTG Expansions Also Increase Repeat Fragility
    Article Snippet: Genomic DNA was digested with Bst EII (New England Biolabs), separated on a 1% agarose gel, probed with a digoxigenin-labeled probe of lambda DNA digested with Hin dIII, and detected by a chemiluminescent or colorimetric system (Roche). .. Yeast telomere addition to the C4 A4 sequence was confirmed by amplification of the junction sequence by using primers CAX29 (CGGCYCGAGCACCCACACCACACCCACAC) and C4 A4 YIP5 (ATCATTACGACCGAGATTCC), cloning the resulting PCR products, and sequence analysis of clones.

    Synthesized:

    Article Title: The Length of the Shortest Telomere as the Major Determinant of the Onset of Replicative Senescence
    Article Snippet: Materials Infrared fluorescent oligonucleotide probes, with either DY682 or DY782 fluorophores at the 5′- and 3′-ends, were synthesized by and purchased from Eurofins MWG Operon. .. Nde I, Bst EII, and Bst NI enzymes were purchased from New England Biolabs.

    Lambda DNA Preparation:

    Article Title: Mutations in Yeast Replication Proteins That Increase CAG/CTG Expansions Also Increase Repeat Fragility
    Article Snippet: .. Genomic DNA was digested with Bst EII (New England Biolabs), separated on a 1% agarose gel, probed with a digoxigenin-labeled probe of lambda DNA digested with Hin dIII, and detected by a chemiluminescent or colorimetric system (Roche). ..

    Construct:

    Article Title: Adeno-associated Virus Genome Population Sequencing Achieves Full Vector Genome Resolution and Reveals Human-Vector Chimeras
    Article Snippet: DNA from purified rAAV preparations was spiked with 10% λDNA digested by BstEII (NEB, Ipswich) for normalization. .. For the libraries constructed on scAAV genomes, the overall ligation efficiency was ∼14%–17%, approximately 49.0%–56.6% of standard libraries.

    Electrophoresis:

    Article Title: Preferential Repair of the Transcribed DNA Strand in Plants
    Article Snippet: Paragraph title: DNA extraction, digestion, electrophoresis, blotting, and hybridization ... DNA concentration was measured using a DyNA Quanti 200 Fluoremeter (Hoefer Pharmacia, San Francisco, CA, USA) and digested with Bst EII (New England Biolabs, Beverly, MA, USA) in the presence of 5 mM spermidine.

    Article Title: Clinical and neuropathological phenotype associated with the novel V189I mutation in the prion protein gene
    Article Snippet: .. The presence of the V189I mutation in the PRNP gene (Fig. ) was confirmed by restriction fragment length polymorphism analysis; briefly, a 448 bp region was amplified by PCR using the primers 5’-CAACATGAAGCACATGGCTGGT-3′ and 5’-CCTTCCTCATCCCACTATCAGG-3′, the PCR product was digested by BstEII restriction enzyme (NEB) and resolved by electrophoresis on 2% agarose gel (Fig. b). .. We explored the recurrence of this mutation by consulting the Exome Aggregation Consortium (ExAC) database [ ] and found that the V189I PRNP variant is not reported.

    Article Title: Direct Identification of Mycobacterium haemophilum in Skin Lesions of Immunocompromised Patients by PCR-Restriction Endonuclease Analysis
    Article Snippet: Amplified DNA was restricted using BstEII and HaeIII (New England Biolabs, Beverly, Mass.) as described previously ( , ). .. Restriction fragments were electrophoresed using 3% Metaphor agarose (4-bp resolution; BioWhittaker Molecular Application, Rockland, Maine) and a Mini-Sub-Cell electrophoresis system (Scie-Plas, Warwickshire, United Kingdom) at 100 V for 1.5 to 2.0 h. PRA band sizes were estimated visually by comparison with the following molecular size markers: a 50-bp ladder (MBI Fermentas), a 100-bp ladder (BioWhittaker Molecular Application), and the PRA bands corresponding to control strains included in each run.

    Article Title: Molecular Classification of Human Adenovirus Type 7 Isolated From Acute Respiratory Disease Outbreak (ARD) in Korea, 2005-2006
    Article Snippet: .. 3.3 Viral DNA RFLP analysis DNA of isolated HAdV was digested with restriction enzymes Bam HI, Sma I, and Bst EII, and electrophoresis was carried out. .. The resulting Bam HI patterns produced two groups: one comprised the isolates in 2005, and the other comprised the isolates in 2006.

    Article Title: Molecular Classification of Human Adenovirus Type 7 Isolated From Acute Respiratory Disease Outbreak (ARD) in Korea, 2005-2006
    Article Snippet: .. The DNA was digested with 20U of restriction enzymes Bam HI, Sma I, and Bst EII (New England Biolabs, MA, USA) for 4 hours, and electrophoresis was carried out using 1% SeaKem Gold agarose (BioWhittaker, ME, USA) in 0.5X Tris-borate-EDTA buffer (Promega,WI, USA) at 2 V/cm for 16 hours with a switching time of 50–90 seconds, using recirculating 0.5X Tris-borate-EDTA buffer. .. Gels were stained using ethidium bromide.

    Expressing:

    Article Title: ?-Fetoprotein gene sequences mediating Afr2 regulation during liver regeneration
    Article Snippet: Xba I linkers (New England Biolabs) were ligated, and the DNA was digested with both Xba I and BsteII (New England Biolabs). .. This fragment was inserted into a plasmid to drive expression of the AFP MG, which encodes a 500-nt transcript that is easily distinguished from the endogenous 2.2-kb mRNA by RNase protection assay ( , ).

    Transformation Assay:

    Article Title: Cloning, Transformation and Expression of Human Interferon ?2b Gene in Tobacco Plant (Nicotiana tabacum cv. xanthi)
    Article Snippet: So, this was digested with BstEII and NcoI (NEB Co). .. The digested PCR product was extracted from gel using gel extraction kit again and then ligated with digested pCAMBIA1304 vector by T4 DNA ligase in 16°C overnight and the results were transformed to E. coli.

    Hybridization:

    Article Title: Preferential Repair of the Transcribed DNA Strand in Plants
    Article Snippet: Paragraph title: DNA extraction, digestion, electrophoresis, blotting, and hybridization ... DNA concentration was measured using a DyNA Quanti 200 Fluoremeter (Hoefer Pharmacia, San Francisco, CA, USA) and digested with Bst EII (New England Biolabs, Beverly, MA, USA) in the presence of 5 mM spermidine.

    Electroporation:

    Article Title: Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿ †
    Article Snippet: Plasmid pNL4-3ΔGag-Protease was developed by inserting unique BstEII restriction sites at the 5′ end of Gag and the 3′ end of the protease by using the QuikChange XL kit (Stratagene), followed by the deletion of the Gag-Protease region by BstEII digestion (New England Biolabs). .. To generate recombinant viruses, 10 μg of BstEII-linearized plasmid plus 50 μl of the second-round amplicon (approximately 5 μg) were mixed with 2.0 × 106 cells of a Tat-driven green fluorescent protein (GFP) reporter T-cell line (GXR 25 cells [ ]) in 800 μl of R10+ medium (RPMI 1640 medium containing 10% fetal calf serum [FCS], 2 mM l -glutamine, 100 units/ml penicillin, and 100 μg/ml streptomycin) and transfected by electroporation using a Bio-Rad GenePulser II instrument (exponential protocol of 300 V and 500 μF).

    Transfection:

    Article Title: Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿ †
    Article Snippet: Plasmid pNL4-3ΔGag-Protease was developed by inserting unique BstEII restriction sites at the 5′ end of Gag and the 3′ end of the protease by using the QuikChange XL kit (Stratagene), followed by the deletion of the Gag-Protease region by BstEII digestion (New England Biolabs). .. To generate recombinant viruses, 10 μg of BstEII-linearized plasmid plus 50 μl of the second-round amplicon (approximately 5 μg) were mixed with 2.0 × 106 cells of a Tat-driven green fluorescent protein (GFP) reporter T-cell line (GXR 25 cells [ ]) in 800 μl of R10+ medium (RPMI 1640 medium containing 10% fetal calf serum [FCS], 2 mM l -glutamine, 100 units/ml penicillin, and 100 μg/ml streptomycin) and transfected by electroporation using a Bio-Rad GenePulser II instrument (exponential protocol of 300 V and 500 μF).

    Sequencing:

    Article Title: Adeno-associated Virus Genome Population Sequencing Achieves Full Vector Genome Resolution and Reveals Human-Vector Chimeras
    Article Snippet: Paragraph title: SMRT Sequencing and Data Analysis ... DNA from purified rAAV preparations was spiked with 10% λDNA digested by BstEII (NEB, Ipswich) for normalization.

    Article Title: ?-Fetoprotein gene sequences mediating Afr2 regulation during liver regeneration
    Article Snippet: pAFP 5′ with 7.6 kb of AFP 5′-flanking sequence was digested with Bam HI (New England Biolabs), and the 5′-overhangs were filled in by the Klenow fragment of DNA polymerase I (Boehringer Mannheim). .. Xba I linkers (New England Biolabs) were ligated, and the DNA was digested with both Xba I and BsteII (New England Biolabs).

    Article Title: Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿ †
    Article Snippet: Second-round PCR was performed by using PAGE-purified recombination primers designed to match the NL4-3 sequence directly upstream of Gag (forward primer GACTC GGCTT GCTGA AGCGC GCACG GCAAG AGGCG AGGGG CGGCG ACTGG TGAGT ACGCC AAAAA TTTTG ACTAG CGGAG GCTAG AAGGA GAGAG ATGGG) and downstream of protease (reverse primer GGCCC AATTT TTGAA ATTTT TCCTT CCTTT TCCAT TTCTG TACAA ATTTC TACTA ATGCT TTTAT TTTTT CTTCT GTCAA TGGCC ATTGT TTAAC TTTTG). .. Plasmid pNL4-3ΔGag-Protease was developed by inserting unique BstEII restriction sites at the 5′ end of Gag and the 3′ end of the protease by using the QuikChange XL kit (Stratagene), followed by the deletion of the Gag-Protease region by BstEII digestion (New England Biolabs).

    Article Title: Clinical and neuropathological phenotype associated with the novel V189I mutation in the prion protein gene
    Article Snippet: Sequence analysis of full-length coding region of PRNP , microtubule-associated protein Tau (MAPT ), exons 16 and 17 of amyloid-beta precursor protein (APP ) and Presenilin 1 and 2 (PSEN1 and PSEN2 ) genes was performed by Sanger sequencing using an ABI 3130xl DNA Analyzer (Applied Biosystems). .. The presence of the V189I mutation in the PRNP gene (Fig. ) was confirmed by restriction fragment length polymorphism analysis; briefly, a 448 bp region was amplified by PCR using the primers 5’-CAACATGAAGCACATGGCTGGT-3′ and 5’-CCTTCCTCATCCCACTATCAGG-3′, the PCR product was digested by BstEII restriction enzyme (NEB) and resolved by electrophoresis on 2% agarose gel (Fig. b).

    Article Title: Mutations in Yeast Replication Proteins That Increase CAG/CTG Expansions Also Increase Repeat Fragility
    Article Snippet: Genomic DNA was digested with Bst EII (New England Biolabs), separated on a 1% agarose gel, probed with a digoxigenin-labeled probe of lambda DNA digested with Hin dIII, and detected by a chemiluminescent or colorimetric system (Roche). .. Yeast telomere addition to the C4 A4 sequence was confirmed by amplification of the junction sequence by using primers CAX29 (CGGCYCGAGCACCCACACCACACCCACAC) and C4 A4 YIP5 (ATCATTACGACCGAGATTCC), cloning the resulting PCR products, and sequence analysis of clones.

    Ligation:

    Article Title: Adeno-associated Virus Genome Population Sequencing Achieves Full Vector Genome Resolution and Reveals Human-Vector Chimeras
    Article Snippet: DNA from purified rAAV preparations was spiked with 10% λDNA digested by BstEII (NEB, Ipswich) for normalization. .. DNAs were subjected to DNA nick and end repair, followed by direct ligation to SMRTbell adapters at a 1:1 adaptor-to-vector molecular ratio, 1.8× AMPurePB bead purification, and sequenced on a Pacific Biosciences RSII Instrument running the SMRT Analysis v2.3 software packages at the Deep Sequencing Core Facility at University of Massachusetts Medical School.

    Article Title: Cloning, Transformation and Expression of Human Interferon ?2b Gene in Tobacco Plant (Nicotiana tabacum cv. xanthi)
    Article Snippet: So, this was digested with BstEII and NcoI (NEB Co). .. Consequently, the INFα2b fragment was replaced in GUS- GFP region of pCAMBIA1304 under the control of the CaMV35s promoter and the NOS terminator by ligation process ( ).

    RFLP Assay:

    Article Title: Molecular Classification of Human Adenovirus Type 7 Isolated From Acute Respiratory Disease Outbreak (ARD) in Korea, 2005-2006
    Article Snippet: 2.3 Viral DNA RFLP One microgram of full-length viral genomic DNA was used for each of RFLP assay. .. The DNA was digested with 20U of restriction enzymes Bam HI, Sma I, and Bst EII (New England Biolabs, MA, USA) for 4 hours, and electrophoresis was carried out using 1% SeaKem Gold agarose (BioWhittaker, ME, USA) in 0.5X Tris-borate-EDTA buffer (Promega,WI, USA) at 2 V/cm for 16 hours with a switching time of 50–90 seconds, using recirculating 0.5X Tris-borate-EDTA buffer.

    Generated:

    Article Title: Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿ †
    Article Snippet: Recombinant viruses were generated on an NL4-3 background as described previously ( , ). .. Plasmid pNL4-3ΔGag-Protease was developed by inserting unique BstEII restriction sites at the 5′ end of Gag and the 3′ end of the protease by using the QuikChange XL kit (Stratagene), followed by the deletion of the Gag-Protease region by BstEII digestion (New England Biolabs).

    other:

    Article Title: Molecular Classification of Human Adenovirus Type 7 Isolated From Acute Respiratory Disease Outbreak (ARD) in Korea, 2005-2006
    Article Snippet: RFLP that is used for the general method of classification of genome type of HAdV was also performed using the restriction enzymes Bam HI, Sma I, which are classically used in RFLP genome analyses, and Bst EII, which allows classification of HAdV Types 7b, 7d2, and 7h.

    Polymerase Chain Reaction:

    Article Title: Cloning, Transformation and Expression of Human Interferon ?2b Gene in Tobacco Plant (Nicotiana tabacum cv. xanthi)
    Article Snippet: The gene was amplified using mentioned primers, and then, PCR product was extracted from the gel using QIAGEN kit. .. So, this was digested with BstEII and NcoI (NEB Co).

    Article Title: Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿ †
    Article Snippet: Second-round PCR was performed by using PAGE-purified recombination primers designed to match the NL4-3 sequence directly upstream of Gag (forward primer GACTC GGCTT GCTGA AGCGC GCACG GCAAG AGGCG AGGGG CGGCG ACTGG TGAGT ACGCC AAAAA TTTTG ACTAG CGGAG GCTAG AAGGA GAGAG ATGGG) and downstream of protease (reverse primer GGCCC AATTT TTGAA ATTTT TCCTT CCTTT TCCAT TTCTG TACAA ATTTC TACTA ATGCT TTTAT TTTTT CTTCT GTCAA TGGCC ATTGT TTAAC TTTTG). .. Plasmid pNL4-3ΔGag-Protease was developed by inserting unique BstEII restriction sites at the 5′ end of Gag and the 3′ end of the protease by using the QuikChange XL kit (Stratagene), followed by the deletion of the Gag-Protease region by BstEII digestion (New England Biolabs).

    Article Title: Clinical and neuropathological phenotype associated with the novel V189I mutation in the prion protein gene
    Article Snippet: .. The presence of the V189I mutation in the PRNP gene (Fig. ) was confirmed by restriction fragment length polymorphism analysis; briefly, a 448 bp region was amplified by PCR using the primers 5’-CAACATGAAGCACATGGCTGGT-3′ and 5’-CCTTCCTCATCCCACTATCAGG-3′, the PCR product was digested by BstEII restriction enzyme (NEB) and resolved by electrophoresis on 2% agarose gel (Fig. b). .. We explored the recurrence of this mutation by consulting the Exome Aggregation Consortium (ExAC) database [ ] and found that the V189I PRNP variant is not reported.

    Article Title: Mutations in Yeast Replication Proteins That Increase CAG/CTG Expansions Also Increase Repeat Fragility
    Article Snippet: Genomic DNA was digested with Bst EII (New England Biolabs), separated on a 1% agarose gel, probed with a digoxigenin-labeled probe of lambda DNA digested with Hin dIII, and detected by a chemiluminescent or colorimetric system (Roche). .. Yeast telomere addition to the C4 A4 sequence was confirmed by amplification of the junction sequence by using primers CAX29 (CGGCYCGAGCACCCACACCACACCCACAC) and C4 A4 YIP5 (ATCATTACGACCGAGATTCC), cloning the resulting PCR products, and sequence analysis of clones.

    Recombinant:

    Article Title: Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿ †
    Article Snippet: Paragraph title: Generation of recombinant Gag-Protease viruses. ... Plasmid pNL4-3ΔGag-Protease was developed by inserting unique BstEII restriction sites at the 5′ end of Gag and the 3′ end of the protease by using the QuikChange XL kit (Stratagene), followed by the deletion of the Gag-Protease region by BstEII digestion (New England Biolabs).

    DNA Extraction:

    Article Title: Preferential Repair of the Transcribed DNA Strand in Plants
    Article Snippet: Paragraph title: DNA extraction, digestion, electrophoresis, blotting, and hybridization ... DNA concentration was measured using a DyNA Quanti 200 Fluoremeter (Hoefer Pharmacia, San Francisco, CA, USA) and digested with Bst EII (New England Biolabs, Beverly, MA, USA) in the presence of 5 mM spermidine.

    Rnase Protection Assay:

    Article Title: ?-Fetoprotein gene sequences mediating Afr2 regulation during liver regeneration
    Article Snippet: Xba I linkers (New England Biolabs) were ligated, and the DNA was digested with both Xba I and BsteII (New England Biolabs). .. This fragment was inserted into a plasmid to drive expression of the AFP MG, which encodes a 500-nt transcript that is easily distinguished from the endogenous 2.2-kb mRNA by RNase protection assay ( , ).

    Mutagenesis:

    Article Title: Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿ †
    Article Snippet: NL4-3 was chosen because this strain is commonly used for in vitro mutagenesis studies of HIV-1 replication, and its Gag sequence displays greater similarity to consensus subtype B than to other available molecular clones (13 amino acid differences from consensus subtype B, 2004). .. Plasmid pNL4-3ΔGag-Protease was developed by inserting unique BstEII restriction sites at the 5′ end of Gag and the 3′ end of the protease by using the QuikChange XL kit (Stratagene), followed by the deletion of the Gag-Protease region by BstEII digestion (New England Biolabs).

    Article Title: Clinical and neuropathological phenotype associated with the novel V189I mutation in the prion protein gene
    Article Snippet: .. The presence of the V189I mutation in the PRNP gene (Fig. ) was confirmed by restriction fragment length polymorphism analysis; briefly, a 448 bp region was amplified by PCR using the primers 5’-CAACATGAAGCACATGGCTGGT-3′ and 5’-CCTTCCTCATCCCACTATCAGG-3′, the PCR product was digested by BstEII restriction enzyme (NEB) and resolved by electrophoresis on 2% agarose gel (Fig. b). .. We explored the recurrence of this mutation by consulting the Exome Aggregation Consortium (ExAC) database [ ] and found that the V189I PRNP variant is not reported.

    Isolation:

    Article Title: ?-Fetoprotein gene sequences mediating Afr2 regulation during liver regeneration
    Article Snippet: Xba I linkers (New England Biolabs) were ligated, and the DNA was digested with both Xba I and BsteII (New England Biolabs). .. The BsteII to Xba I (formerly the Bam HI site at the 1.0 kb upstream of the transcriptional start site, which is at the 3′-end of AFP enhancer element I) was isolated from a gel and was ligated into the original plasmid digested with BsteII and Xba I.

    Article Title: Direct Identification of Mycobacterium haemophilum in Skin Lesions of Immunocompromised Patients by PCR-Restriction Endonuclease Analysis
    Article Snippet: Amplified DNA was restricted using BstEII and HaeIII (New England Biolabs, Beverly, Mass.) as described previously ( , ). .. Visual PRA identifications were made prior to and independent of culture isolation and identification.

    Article Title: Molecular Classification of Human Adenovirus Type 7 Isolated From Acute Respiratory Disease Outbreak (ARD) in Korea, 2005-2006
    Article Snippet: .. 3.3 Viral DNA RFLP analysis DNA of isolated HAdV was digested with restriction enzymes Bam HI, Sma I, and Bst EII, and electrophoresis was carried out. .. The resulting Bam HI patterns produced two groups: one comprised the isolates in 2005, and the other comprised the isolates in 2006.

    Article Title: Mutations in Yeast Replication Proteins That Increase CAG/CTG Expansions Also Increase Repeat Fragility
    Article Snippet: FOAR colonies were grown 16 to 24 h in YC-Leu or yeast extract-peptone-dextrose (YEPD) medium, and genomic DNA was isolated by the glass bead method. .. Genomic DNA was digested with Bst EII (New England Biolabs), separated on a 1% agarose gel, probed with a digoxigenin-labeled probe of lambda DNA digested with Hin dIII, and detected by a chemiluminescent or colorimetric system (Roche).

    Purification:

    Article Title: Adeno-associated Virus Genome Population Sequencing Achieves Full Vector Genome Resolution and Reveals Human-Vector Chimeras
    Article Snippet: .. DNA from purified rAAV preparations was spiked with 10% λDNA digested by BstEII (NEB, Ipswich) for normalization. .. DNAs were subjected to DNA nick and end repair, followed by direct ligation to SMRTbell adapters at a 1:1 adaptor-to-vector molecular ratio, 1.8× AMPurePB bead purification, and sequenced on a Pacific Biosciences RSII Instrument running the SMRT Analysis v2.3 software packages at the Deep Sequencing Core Facility at University of Massachusetts Medical School.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿ †
    Article Snippet: Briefly, the Gag-Protease region was amplified by reverse transcription (RT)-PCR from plasma HIV-1 RNA using sequence-specific primers. .. Plasmid pNL4-3ΔGag-Protease was developed by inserting unique BstEII restriction sites at the 5′ end of Gag and the 3′ end of the protease by using the QuikChange XL kit (Stratagene), followed by the deletion of the Gag-Protease region by BstEII digestion (New England Biolabs).

    Polyacrylamide Gel Electrophoresis:

    Article Title: Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿ †
    Article Snippet: Second-round PCR was performed by using PAGE-purified recombination primers designed to match the NL4-3 sequence directly upstream of Gag (forward primer GACTC GGCTT GCTGA AGCGC GCACG GCAAG AGGCG AGGGG CGGCG ACTGG TGAGT ACGCC AAAAA TTTTG ACTAG CGGAG GCTAG AAGGA GAGAG ATGGG) and downstream of protease (reverse primer GGCCC AATTT TTGAA ATTTT TCCTT CCTTT TCCAT TTCTG TACAA ATTTC TACTA ATGCT TTTAT TTTTT CTTCT GTCAA TGGCC ATTGT TTAAC TTTTG). .. Plasmid pNL4-3ΔGag-Protease was developed by inserting unique BstEII restriction sites at the 5′ end of Gag and the 3′ end of the protease by using the QuikChange XL kit (Stratagene), followed by the deletion of the Gag-Protease region by BstEII digestion (New England Biolabs).

    Gel Extraction:

    Article Title: Cloning, Transformation and Expression of Human Interferon ?2b Gene in Tobacco Plant (Nicotiana tabacum cv. xanthi)
    Article Snippet: So, this was digested with BstEII and NcoI (NEB Co). .. The digested PCR product was extracted from gel using gel extraction kit again and then ligated with digested pCAMBIA1304 vector by T4 DNA ligase in 16°C overnight and the results were transformed to E. coli.

    Plasmid Preparation:

    Article Title: ?-Fetoprotein gene sequences mediating Afr2 regulation during liver regeneration
    Article Snippet: Xba I linkers (New England Biolabs) were ligated, and the DNA was digested with both Xba I and BsteII (New England Biolabs). .. The BsteII to Xba I (formerly the Bam HI site at the 1.0 kb upstream of the transcriptional start site, which is at the 3′-end of AFP enhancer element I) was isolated from a gel and was ligated into the original plasmid digested with BsteII and Xba I.

    Article Title: Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿ †
    Article Snippet: .. Plasmid pNL4-3ΔGag-Protease was developed by inserting unique BstEII restriction sites at the 5′ end of Gag and the 3′ end of the protease by using the QuikChange XL kit (Stratagene), followed by the deletion of the Gag-Protease region by BstEII digestion (New England Biolabs). .. This plasmid was maintained by using Escherichia coli Stbl3 cells (Invitrogen).

    Software:

    Article Title: Adeno-associated Virus Genome Population Sequencing Achieves Full Vector Genome Resolution and Reveals Human-Vector Chimeras
    Article Snippet: DNA from purified rAAV preparations was spiked with 10% λDNA digested by BstEII (NEB, Ipswich) for normalization. .. DNAs were subjected to DNA nick and end repair, followed by direct ligation to SMRTbell adapters at a 1:1 adaptor-to-vector molecular ratio, 1.8× AMPurePB bead purification, and sequenced on a Pacific Biosciences RSII Instrument running the SMRT Analysis v2.3 software packages at the Deep Sequencing Core Facility at University of Massachusetts Medical School.

    Irradiation:

    Article Title: Preferential Repair of the Transcribed DNA Strand in Plants
    Article Snippet: .. CPD content was measured in seedlings immediately after irradiation and after 24 h. The DNA was restriction digested with Bst EII, divided in equal aliquots, one aliquot was treated with T4 endonuclease V, and the resulting preparations loaded onto a denaturing gel. ..

    Agarose Gel Electrophoresis:

    Article Title: Clinical and neuropathological phenotype associated with the novel V189I mutation in the prion protein gene
    Article Snippet: .. The presence of the V189I mutation in the PRNP gene (Fig. ) was confirmed by restriction fragment length polymorphism analysis; briefly, a 448 bp region was amplified by PCR using the primers 5’-CAACATGAAGCACATGGCTGGT-3′ and 5’-CCTTCCTCATCCCACTATCAGG-3′, the PCR product was digested by BstEII restriction enzyme (NEB) and resolved by electrophoresis on 2% agarose gel (Fig. b). .. We explored the recurrence of this mutation by consulting the Exome Aggregation Consortium (ExAC) database [ ] and found that the V189I PRNP variant is not reported.

    Article Title: Mutations in Yeast Replication Proteins That Increase CAG/CTG Expansions Also Increase Repeat Fragility
    Article Snippet: .. Genomic DNA was digested with Bst EII (New England Biolabs), separated on a 1% agarose gel, probed with a digoxigenin-labeled probe of lambda DNA digested with Hin dIII, and detected by a chemiluminescent or colorimetric system (Roche). ..

    In Vitro:

    Article Title: Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿Early Selection in Gag by Protective HLA Alleles Contributes to Reduced HIV-1 Replication Capacity That May Be Largely Compensated for in Chronic Infection ▿ †
    Article Snippet: NL4-3 was chosen because this strain is commonly used for in vitro mutagenesis studies of HIV-1 replication, and its Gag sequence displays greater similarity to consensus subtype B than to other available molecular clones (13 amino acid differences from consensus subtype B, 2004). .. Plasmid pNL4-3ΔGag-Protease was developed by inserting unique BstEII restriction sites at the 5′ end of Gag and the 3′ end of the protease by using the QuikChange XL kit (Stratagene), followed by the deletion of the Gag-Protease region by BstEII digestion (New England Biolabs).

    Concentration Assay:

    Article Title: Preferential Repair of the Transcribed DNA Strand in Plants
    Article Snippet: .. DNA concentration was measured using a DyNA Quanti 200 Fluoremeter (Hoefer Pharmacia, San Francisco, CA, USA) and digested with Bst EII (New England Biolabs, Beverly, MA, USA) in the presence of 5 mM spermidine. ..

    Marker:

    Article Title: Isolation and characterisation of a ruminant alphaherpesvirus closely related to bovine herpesvirus 1 in a free-ranging red deer
    Article Snippet: Restriction enzyme analysis Viral DNA was submitted to BamHI and BstEII restriction endonucleases (New England Biolabs, England, United Kingdom). .. SmartLadder (10 kb; Eurogentec, Liège, Belgium) was used as molecular mass marker.

    Staining:

    Article Title: Molecular Classification of Human Adenovirus Type 7 Isolated From Acute Respiratory Disease Outbreak (ARD) in Korea, 2005-2006
    Article Snippet: The DNA was digested with 20U of restriction enzymes Bam HI, Sma I, and Bst EII (New England Biolabs, MA, USA) for 4 hours, and electrophoresis was carried out using 1% SeaKem Gold agarose (BioWhittaker, ME, USA) in 0.5X Tris-borate-EDTA buffer (Promega,WI, USA) at 2 V/cm for 16 hours with a switching time of 50–90 seconds, using recirculating 0.5X Tris-borate-EDTA buffer. .. Gels were stained using ethidium bromide.

    Variant Assay:

    Article Title: Clinical and neuropathological phenotype associated with the novel V189I mutation in the prion protein gene
    Article Snippet: The presence of the V189I mutation in the PRNP gene (Fig. ) was confirmed by restriction fragment length polymorphism analysis; briefly, a 448 bp region was amplified by PCR using the primers 5’-CAACATGAAGCACATGGCTGGT-3′ and 5’-CCTTCCTCATCCCACTATCAGG-3′, the PCR product was digested by BstEII restriction enzyme (NEB) and resolved by electrophoresis on 2% agarose gel (Fig. b). .. We explored the recurrence of this mutation by consulting the Exome Aggregation Consortium (ExAC) database [ ] and found that the V189I PRNP variant is not reported.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs bsteii restriction enzyme
    Genetic studies. a : Pedigree of family of Cases 1 and 2. The proband is marked by arrow, grey symbols denote family members affected by rapidly progressive dementia, black symbols indicate family members with CJD, white symbols denote unaffected members. Crossing lines refer to deceased subjects. b : Analysis of PRNP gene by restriction fragment length polymorphism. A 448 bp region was amplified by <t>PCR</t> from a control subject (WT, lane 1) and a mutated heterozygous carrier (V189I, lane 3) . Digestion of PCR product by <t>BstEII</t> generated two fragments (244 and 204 bp) in the WT subject (lane 2). The presence of the mutation abolished the restriction site. So, a 448 bp fragment (corresponding to the mutated allele) and two 244 and 204 bp fragments (corresponding to the WT allele) were observed, as expected, in the V189I heterozygous carrier (lane 4). c : Sequence chromatogram of a subject carrying the heterozygous V189I mutation
    Bsteii Restriction Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsteii restriction enzyme/product/New England Biolabs
    Average 90 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    bsteii restriction enzyme - by Bioz Stars, 2020-03
    90/100 stars
      Buy from Supplier

    Image Search Results


    Genetic studies. a : Pedigree of family of Cases 1 and 2. The proband is marked by arrow, grey symbols denote family members affected by rapidly progressive dementia, black symbols indicate family members with CJD, white symbols denote unaffected members. Crossing lines refer to deceased subjects. b : Analysis of PRNP gene by restriction fragment length polymorphism. A 448 bp region was amplified by PCR from a control subject (WT, lane 1) and a mutated heterozygous carrier (V189I, lane 3) . Digestion of PCR product by BstEII generated two fragments (244 and 204 bp) in the WT subject (lane 2). The presence of the mutation abolished the restriction site. So, a 448 bp fragment (corresponding to the mutated allele) and two 244 and 204 bp fragments (corresponding to the WT allele) were observed, as expected, in the V189I heterozygous carrier (lane 4). c : Sequence chromatogram of a subject carrying the heterozygous V189I mutation

    Journal: Acta Neuropathologica Communications

    Article Title: Clinical and neuropathological phenotype associated with the novel V189I mutation in the prion protein gene

    doi: 10.1186/s40478-018-0656-4

    Figure Lengend Snippet: Genetic studies. a : Pedigree of family of Cases 1 and 2. The proband is marked by arrow, grey symbols denote family members affected by rapidly progressive dementia, black symbols indicate family members with CJD, white symbols denote unaffected members. Crossing lines refer to deceased subjects. b : Analysis of PRNP gene by restriction fragment length polymorphism. A 448 bp region was amplified by PCR from a control subject (WT, lane 1) and a mutated heterozygous carrier (V189I, lane 3) . Digestion of PCR product by BstEII generated two fragments (244 and 204 bp) in the WT subject (lane 2). The presence of the mutation abolished the restriction site. So, a 448 bp fragment (corresponding to the mutated allele) and two 244 and 204 bp fragments (corresponding to the WT allele) were observed, as expected, in the V189I heterozygous carrier (lane 4). c : Sequence chromatogram of a subject carrying the heterozygous V189I mutation

    Article Snippet: The presence of the V189I mutation in the PRNP gene (Fig. ) was confirmed by restriction fragment length polymorphism analysis; briefly, a 448 bp region was amplified by PCR using the primers 5’-CAACATGAAGCACATGGCTGGT-3′ and 5’-CCTTCCTCATCCCACTATCAGG-3′, the PCR product was digested by BstEII restriction enzyme (NEB) and resolved by electrophoresis on 2% agarose gel (Fig. b).

    Techniques: Amplification, Polymerase Chain Reaction, Generated, Mutagenesis, Sequencing