bcli  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    Name:
    BclI
    Description:
    BclI 15 000 units
    Catalog Number:
    R0160L
    Price:
    244
    Size:
    15 000 units
    Category:
    Restriction Enzymes
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs bcli
    BclI
    BclI 15 000 units
    https://www.bioz.com/result/bcli/product/New England Biolabs
    Average 98 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    bcli - by Bioz Stars, 2019-12
    98/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Synergetic Targeted Delivery of Sleeping-Beauty Transposon System to Mesenchymal Stem Cells Using LPD Nanoparticles Modified with a Phage-Displayed Targeting Peptide
    Article Snippet: The neomycin resistance gene in pT2/SVNeo was converted into the EGFP gene by restriction digestion with Bcl I and BstB I (New England Biolabs, Inc. MA, USA). .. The sequence of primer 1 is GCGGTGATCATATGGTGAGCAAGGGC; the primer 2 is GCGGTTCGAACTTTACTTGTACAGCT.

    Amplification:

    Article Title: Genetic variants in the H2AFX promoter region are associated with risk of sporadic breast cancer in non-Hispanic white women aged < =55 years
    Article Snippet: Polymerase chain reactions were performed with a PTC-200 DNA Engine Peltier thermal cycler (formerly MJ Research, Waltham, MA, USA). .. The four amplified fragments were then digested, respectively, by Bcc I, Rsa I, BsiHKA I, and Bcl I (New England BioLabs, Beverly, MA, USA) and separated in 3% agarose gel ( ). .. The χ2 tests were used to compare the distributions of demographic variables and selected risk factors between cases and controls.

    Article Title: Characterization of denitrifying activity by the alphaproteobacterium, Sphingomonas wittichii RW1
    Article Snippet: The amplification product was purified and ligated to the pGEM®-T Vector according to manufacturers' instructions (Promega Corp., Madison, WI). .. Plasmids from positive transformants were purified using Wizard® Plus SV Minipreps DNA Purification System kit (Promega Corp., Madison, WI) and digested with the BclI restriction enzyme (New England BioLabs Inc., Ipswich MA).

    Article Title: Genetic alterations of IDH1 and Vegf in brain tumors, et al. Genetic alterations of IDH1 and Vegf in brain tumors
    Article Snippet: 2.3 IDH1 gene mutation in tumor tissue was determined by PCR‐RFLP (Polymerase Chain Reaction‐Restriction Fragment Length Polymorphism), using BclI restriction enzyme (New England Biolabs). .. Exon 4 of IDH1 gene was amplified using 100 ng of DNA in a final volume of 25 μl.

    Article Title:
    Article Snippet: The G87R mutation created a new BclI restriction site in the mutant PCR amplicon that could distinguish between homozygous, heterozygous, and healthy individuals. .. PCR products were subjected to enzymatic digestion by BclI according to the manufacturer's specifications (New England Biolabs, Ipswich, MA).

    Article Title: Variations in COMT Gene Interact With Parenting to Influence Attention in Early Development
    Article Snippet: The amplification reaction was the same as above, using the primers PSAF and PSGR. .. All PCR products were digested with the restriction enzyme BsaAI (NEB) at 37°C, then BclI (NEB) at 50°C and resolved on a 1.5% agarose gel.

    Article Title: An association between the PTGS2 rs5275 polymorphism and colorectal cancer risk in families with inherited non-syndromic predisposition
    Article Snippet: The genotyping assays were performed in 96-well plates in a LightCycler 480 real-time PCR system (Roche Applied Sciences, Sydney, Australia). .. For PIRA assays, 50 ng of template DNA was amplified (in duplicate) and resultant PCR products digested overnight using BclI (New England Biolabs Inc., Beverly, MA, USA). .. The digested PCR products were separated on a Criterion TBE 10% polyacrylamide gels (Bio-Rad Laboratories, Sydney, Australia) and resolved using Gel Red Nucleic Acid Stain (Biotium, Hayward, CA, USA) and a Typhoon 9400 scanner (GE Healthcare, Sydney, Australia).

    Stable Transfection:

    Article Title: Determinants of the Endosomal Localization of Sorting Nexin 1
    Article Snippet: A similar digestion procedure was followed using the restriction enzymes Nco I and Bcl I (New England Biolabs) at 37°C overnight, and the DNA fragment was isolated from agarose gels and purified. .. Cells were cultured in DMEM with 10% fetal bovine serum (FBS) and antibiotics, including zeocin and balsticidin (Invitrogen).

    Synthesized:

    Article Title: Mapping Out Regions on the Surface of the Aspartate Receptor That Are Essential for Kinase Activation
    Article Snippet: Deoxynucleotides were synthesized by Life Technologies Inc. Kunkel site-directed mutagenesis reagents (T7 DNA polymerase and deoxynucleoside triphosphates) were purchased from BioRad. .. MluI, EcoRI, BsmI, BclI, BsaI, and SacI were from New England Biolabs.

    Construct:

    Article Title: Strain-dependent induction of epithelial cell oncosis by Campylobacter jejuni is correlated with invasion ability and is independent of cytolethal distending toxin
    Article Snippet: Briefly, this mutant was constructed by amplifying the promoterless cdtABC operon from C. jejuni 81-176 using previously described primers P8 and P9 ( ). .. Plasmid DNA was extracted with the QIAprep Spin Miniprep kit (Qiagen) and digested with Bcl I (New England Biolabs, NEB) to generate the deletion.

    Article Title: Synergetic Targeted Delivery of Sleeping-Beauty Transposon System to Mesenchymal Stem Cells Using LPD Nanoparticles Modified with a Phage-Displayed Targeting Peptide
    Article Snippet: The neomycin resistance gene in pT2/SVNeo was converted into the EGFP gene by restriction digestion with Bcl I and BstB I (New England Biolabs, Inc. MA, USA). .. The sequence of primer 1 is GCGGTGATCATATGGTGAGCAAGGGC; the primer 2 is GCGGTTCGAACTTTACTTGTACAGCT.

    Article Title: Mechanistic Characterization of GS-9190 (Tegobuvir), a Novel Nonnucleoside Inhibitor of Hepatitis C Virus NS5B Polymerase
    Article Snippet: PCR fragments were gel purified (Qiagen), digested with SpeI and BclI (New England BioLabs [NEB]), and ligated into an analogously digested and purified pFK I341 PI-Luc/NS3-3′/ET vector fragment. .. The NS5B region was then subcloned into a fresh vector backbone by using BclI and SpeI restriction sites.

    Electrophoresis:

    Article Title: HMGB1 gene polymorphisms in patients with chronic hepatitis B virus infection
    Article Snippet: PCR condition was as follows: one cycle of predenature 3 min at 95 °C, 30 cycles of denature 30 s at 94 °C, hybridization for 30 s at 54 °C, an extension cycle of 50 s at 72 °C, and a last cycle of delay 5 min at 72 °C. .. Restriction enzyme BcLI (recognition site T/GATCA) was obtained from NEB; the fragments were separated by electrophoresis on 3% agarose gel and stained with ethidium bromide for visualization under ultraviolet light. .. The observed genotypes were also identified by direct sequencing before large-scale test was started.

    Article Title: Genetic alterations of IDH1 and Vegf in brain tumors, et al. Genetic alterations of IDH1 and Vegf in brain tumors
    Article Snippet: 2.3 IDH1 gene mutation in tumor tissue was determined by PCR‐RFLP (Polymerase Chain Reaction‐Restriction Fragment Length Polymorphism), using BclI restriction enzyme (New England Biolabs). .. The amplification mix had 15 pmol of each primer (forward 5′‐GATGGGTAAAACCTATCATCATTGA ‐3′, reverse 5′‐TGTGTTGAGATGGACGCCTA‐ 3′; Meyer et al., ), and 20 μl of Platinum ® PCR Supermix High Fidelity (Life technologies) containing polymerase, salts, magnesium, and dNTPs.

    Enzymatic Assay:

    Article Title:
    Article Snippet: Paragraph title: Restriction Enzyme Assay ... PCR products were subjected to enzymatic digestion by BclI according to the manufacturer's specifications (New England Biolabs, Ipswich, MA).

    Gel Extraction:

    Article Title: Determinants of the Endosomal Localization of Sorting Nexin 1
    Article Snippet: The DNA fragment containing GFP-SNX1 was isolated by agarose gel electrophoresis and purified using QIAquick gel extraction kit (QIAGEN, Valencia, CA). .. A similar digestion procedure was followed using the restriction enzymes Nco I and Bcl I (New England Biolabs) at 37°C overnight, and the DNA fragment was isolated from agarose gels and purified.

    Activity Assay:

    Article Title: Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes
    Article Snippet: Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB). .. Ten picomols of two complementary HPLC-purified U-containing oligos as indicated , with the same silent mutation in the lacZ sequence, were annealed and ligated to Bsa BI/Bcl I-digested vector at 16 °C overnight.

    Expressing:

    Article Title: Determinants of the Endosomal Localization of Sorting Nexin 1
    Article Snippet: Paragraph title: Preparation of Human Embryonic Kidney (HEK)293 Cells Expressing Inducible GFP-SNX1 and GFP-SNX2 ... A similar digestion procedure was followed using the restriction enzymes Nco I and Bcl I (New England Biolabs) at 37°C overnight, and the DNA fragment was isolated from agarose gels and purified.

    Article Title: Mapping Out Regions on the Surface of the Aspartate Receptor That Are Essential for Kinase Activation
    Article Snippet: Expression strains and plasmids used to produce CheA (HB101/pMO4) and CheW (HB101/pME5) were generously provided by Jeffrey Stock, Princeton University. .. MluI, EcoRI, BsmI, BclI, BsaI, and SacI were from New England Biolabs.

    Modification:

    Article Title: Attracting AID to targets of somatic hypermutation
    Article Snippet: Nuclei from DT40 cells were isolated and digested as previously described ( ) with modified lysis buffer containing 0.05% NP-40. .. Isolated DNA was digested with Pst I and Bcl I (New England Biolabs, Inc.), and a Sac I/BsrG I fragment from eGFP was used to make a probe using a random-priming synthesis kit (Roche) for Southern blot analysis.

    Transformation Assay:

    Article Title: Determinants of the Endosomal Localization of Sorting Nexin 1
    Article Snippet: The plasmid SNX2/pEGFP-c1 was transformed into E . coli strain SCS110 (Stratagene) to obtain unmethylated DNA. .. A similar digestion procedure was followed using the restriction enzymes Nco I and Bcl I (New England Biolabs) at 37°C overnight, and the DNA fragment was isolated from agarose gels and purified.

    Article Title: Characterization of denitrifying activity by the alphaproteobacterium, Sphingomonas wittichii RW1
    Article Snippet: The ligation mixture was transformed into dam − /dcm − competent E. coli cells (New England BioLabs Inc., Ipswich, MA) and transformants were selected via blue-white screening on LB agar plates containing 0.5 mM IPTG, 80 μg/mL X-Gal, and 100 μg/mL ampicillin. .. Plasmids from positive transformants were purified using Wizard® Plus SV Minipreps DNA Purification System kit (Promega Corp., Madison, WI) and digested with the BclI restriction enzyme (New England BioLabs Inc., Ipswich MA).

    Hybridization:

    Article Title: HMGB1 gene polymorphisms in patients with chronic hepatitis B virus infection
    Article Snippet: PCR condition was as follows: one cycle of predenature 3 min at 95 °C, 30 cycles of denature 30 s at 94 °C, hybridization for 30 s at 54 °C, an extension cycle of 50 s at 72 °C, and a last cycle of delay 5 min at 72 °C. .. Restriction enzyme BcLI (recognition site T/GATCA) was obtained from NEB; the fragments were separated by electrophoresis on 3% agarose gel and stained with ethidium bromide for visualization under ultraviolet light.

    Countercurrent Chromatography:

    Article Title: Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes
    Article Snippet: A silent mutation in the proline codon (CCC to CCG) was introduced between the Bsa BI and Bcl I sites of the bacterial WT lacZ -containing plasmid pCH110, carrying both bacterial and SV40 promoters, to create a variant (but functional) lacZ plasmid pTV123. .. Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB).

    Transfection:

    Article Title: Determinants of the Endosomal Localization of Sorting Nexin 1
    Article Snippet: A similar digestion procedure was followed using the restriction enzymes Nco I and Bcl I (New England Biolabs) at 37°C overnight, and the DNA fragment was isolated from agarose gels and purified. .. The GFP-SNX1 and GFP-SNX2 fragments were ligated to the pcDNA5/FRT/TO-TOPO vector (Invitrogen) following the manufacturer's procedure.

    Southern Blot:

    Article Title: Attracting AID to targets of somatic hypermutation
    Article Snippet: 107 DT40 cells were used for each digestion with 0, 10, and 50 U DNase I (Applied Biosystems) in 250 µl of solution. .. Isolated DNA was digested with Pst I and Bcl I (New England Biolabs, Inc.), and a Sac I/BsrG I fragment from eGFP was used to make a probe using a random-priming synthesis kit (Roche) for Southern blot analysis. .. ChIP assays for acetylated histones H3 and H4 were performed as previously described ( ) with few modifications.

    Ligation:

    Article Title: Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes
    Article Snippet: Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB). .. The linear form of the plasmid was isolated from a 0.8% agarose gel and the concentration of the plasmid DNA measured by NanoView (GE Healthcare).

    Article Title: Synergetic Targeted Delivery of Sleeping-Beauty Transposon System to Mesenchymal Stem Cells Using LPD Nanoparticles Modified with a Phage-Displayed Targeting Peptide
    Article Snippet: The neomycin resistance gene in pT2/SVNeo was converted into the EGFP gene by restriction digestion with Bcl I and BstB I (New England Biolabs, Inc. MA, USA). .. The sequence of primer 1 is GCGGTGATCATATGGTGAGCAAGGGC; the primer 2 is GCGGTTCGAACTTTACTTGTACAGCT.

    Article Title: Characterization of denitrifying activity by the alphaproteobacterium, Sphingomonas wittichii RW1
    Article Snippet: The ligation mixture was transformed into dam − /dcm − competent E. coli cells (New England BioLabs Inc., Ipswich, MA) and transformants were selected via blue-white screening on LB agar plates containing 0.5 mM IPTG, 80 μg/mL X-Gal, and 100 μg/mL ampicillin. .. Plasmids from positive transformants were purified using Wizard® Plus SV Minipreps DNA Purification System kit (Promega Corp., Madison, WI) and digested with the BclI restriction enzyme (New England BioLabs Inc., Ipswich MA).

    Transferring:

    Article Title: Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes
    Article Snippet: The variant plasmid was necessary to distinguish it from the WT lacZ (transcribed from HEK293 stable cells), which served as a template for transferring the missing sequence into the gapped variant plasmid ( ). .. Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB).

    Cell Culture:

    Article Title: Determinants of the Endosomal Localization of Sorting Nexin 1
    Article Snippet: A similar digestion procedure was followed using the restriction enzymes Nco I and Bcl I (New England Biolabs) at 37°C overnight, and the DNA fragment was isolated from agarose gels and purified. .. The resulting GFP-SNX1/pcDNA5/FRT/TO-TOPO and GFP-SNX2/pcDNA5/FRT/TO-TOPO plasmids were transfected into Flp-in T-REx-293 cells (Invitrogen) by using Transfectene (QIAGEN).

    DNA Sequencing:

    Article Title: Relationship between cyclooxygenase 8473T>C polymorphism and the risk of lung cancer: a case-control study
    Article Snippet: The PCR products were digested overnight with 10 units of Bcl I (New England BioLabs, Inc., Beverly, MA, USA) at 50°C. .. The PCR products were digested overnight with 10 units of Bcl I (New England BioLabs, Inc., Beverly, MA, USA) at 50°C.

    Article Title: Mechanistic Characterization of GS-9190 (Tegobuvir), a Novel Nonnucleoside Inhibitor of Hepatitis C Virus NS5B Polymerase
    Article Snippet: The junctions of the resulting chimeric replicon (1b NS4A4B/2a) were confirmed by DNA sequencing. .. PCR fragments were gel purified (Qiagen), digested with SpeI and BclI (New England BioLabs [NEB]), and ligated into an analogously digested and purified pFK I341 PI-Luc/NS3-3′/ET vector fragment.

    Article Title:
    Article Snippet: DNA sequencing results were used for designing a restriction enzyme assay. .. PCR products were subjected to enzymatic digestion by BclI according to the manufacturer's specifications (New England Biolabs, Ipswich, MA).

    Polymerase Chain Reaction:

    Article Title: Genetic variants in the H2AFX promoter region are associated with risk of sporadic breast cancer in non-Hispanic white women aged < =55 years
    Article Snippet: The four H2AFX SNPs were genotyped using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method with the pairs of primers as listed in . .. The four amplified fragments were then digested, respectively, by Bcc I, Rsa I, BsiHKA I, and Bcl I (New England BioLabs, Beverly, MA, USA) and separated in 3% agarose gel ( ).

    Article Title: Relationship between cyclooxygenase 8473T>C polymorphism and the risk of lung cancer: a case-control study
    Article Snippet: The COX-2 8473T>C genotype was determined using PCR-based primer-introduced restriction analysis (PIRA) as described by Hu et al. [ ]. .. The PCR products were digested overnight with 10 units of Bcl I (New England BioLabs, Inc., Beverly, MA, USA) at 50°C. .. The digested PCR products were resolved on 6% acrylamide gel and stained with ethidium bromide for visualization under UV light.

    Article Title: A polymorphism rs4705341 in the flanking region of miR-143/145 predicts risk and prognosis of colorectal cancer
    Article Snippet: PCR reaction was performed in a total volume of 10 μl, containing 50 ng genomic DNA, 20 pM each primer, and 5 μl 2X PCR mix (Aidlab Biotech, Beijing, China). .. The PCR products were digested with Bcl I (New England BioLabs, Beverly, MA). .. The rs4705341A allele was cut into two fragments of 106 and 17 bp, whereas the rs4705341G allele remained intact.

    Article Title: Strain-dependent induction of epithelial cell oncosis by Campylobacter jejuni is correlated with invasion ability and is independent of cytolethal distending toxin
    Article Snippet: All PCR reactions were carried out in 20 μl volumes and contained 1× reaction buffer, 0.2 mM dNTPs, 2 mM MgCl2 , 0.5 μM of each primer and 1 U HotStar Taq polymerase (Qiagen). .. Plasmid DNA was extracted with the QIAprep Spin Miniprep kit (Qiagen) and digested with Bcl I (New England Biolabs, NEB) to generate the deletion.

    Article Title: Characterization of denitrifying activity by the alphaproteobacterium, Sphingomonas wittichii RW1
    Article Snippet: The region from bp 203 to 776 of the norZ ch gene was PCR-amplified from S. wittichii RW1 genomic DNA with primers 203F 5′ aactggaacaggccgatg 3′ and 776R 5′ cgatcgccttcatcttcg 3′ to make use of an internal BclI restriction site [Primer3 Input 0.4.0 software (Rozen and Skaletsky, )]. .. Plasmids from positive transformants were purified using Wizard® Plus SV Minipreps DNA Purification System kit (Promega Corp., Madison, WI) and digested with the BclI restriction enzyme (New England BioLabs Inc., Ipswich MA).

    Article Title: HMGB1 gene polymorphisms in patients with chronic hepatitis B virus infection
    Article Snippet: PCR condition was as follows: one cycle of predenature 3 min at 95 °C, 30 cycles of denature 30 s at 94 °C, hybridization for 30 s at 54 °C, an extension cycle of 50 s at 72 °C, and a last cycle of delay 5 min at 72 °C. .. Restriction enzyme BcLI (recognition site T/GATCA) was obtained from NEB; the fragments were separated by electrophoresis on 3% agarose gel and stained with ethidium bromide for visualization under ultraviolet light.

    Article Title: Genetic alterations of IDH1 and Vegf in brain tumors, et al. Genetic alterations of IDH1 and Vegf in brain tumors
    Article Snippet: DNA from tumor tissue and peripheral blood was extracted using the DNeasy Blood & Tissue Kit (QIAGEN® Hilden, Germany) according to the manufacturer's instructions. .. 2.3 IDH1 gene mutation in tumor tissue was determined by PCR‐RFLP (Polymerase Chain Reaction‐Restriction Fragment Length Polymorphism), using BclI restriction enzyme (New England Biolabs). .. Exon 4 of IDH1 gene was amplified using 100 ng of DNA in a final volume of 25 μl.

    Article Title: Mechanistic Characterization of GS-9190 (Tegobuvir), a Novel Nonnucleoside Inhibitor of Hepatitis C Virus NS5B Polymerase
    Article Snippet: A 2a NS5B/1b chimeric replicon was created by amplifying the NS5B-3′-untranslated region (UTR) via PCR from the pJFH plasmid using the primers 2a5′NS5BBclIfw (5′-GATCGACTGATCACTCCCTGTAGCCCCGAAGAGG-3′) and 2a3′UTRSpeIrev2 (5′-AGCTTAGACTAGTACATGATCTGCAGAGAGACCAG-3′). .. PCR fragments were gel purified (Qiagen), digested with SpeI and BclI (New England BioLabs [NEB]), and ligated into an analogously digested and purified pFK I341 PI-Luc/NS3-3′/ET vector fragment. .. A β-hairpin chimera was created using multiple rounds of site-directed mutagenesis (QuikChange XL; Stratagene) to change amino acids 434 to 455 of the NS5B region in pFK I341 PI-Luc/NS3-3′/ET to that of genotype 2a (JFH1).

    Article Title: European Ancestry Predominates in Neuromyelitis Optica and Multiple Sclerosis Patients from Brazil
    Article Snippet: FY-NULL *1, RB1 *1, LPL *1, AT3 *1, APOA *1, and PV92*1, and SB19.3*1 were genotyped as previously reported . .. CKM *1 and DRD2-Bcl I*1 single nucleotide polymorphisms were identified using PCR-amplified DNA digested with TaqI and BclI (New England Biolabs, Ipswitch, MA). .. MID-52*1, MID-575*1, and MID-93*1 indel polymorphisms were identified using PCR-amplified DNA, followed by direct detection in polyacrylamide gels after silver nitrate staining.

    Article Title:
    Article Snippet: The G87R mutation created a new BclI restriction site in the mutant PCR amplicon that could distinguish between homozygous, heterozygous, and healthy individuals. .. PCR products were subjected to enzymatic digestion by BclI according to the manufacturer's specifications (New England Biolabs, Ipswich, MA). .. The resulting products were electrophoresed on 2% agarose gels.

    Article Title: Variations in COMT Gene Interact With Parenting to Influence Attention in Early Development
    Article Snippet: The amplification reaction was the same as above, using the primers PSAF and PSGR. .. All PCR products were digested with the restriction enzyme BsaAI (NEB) at 37°C, then BclI (NEB) at 50°C and resolved on a 1.5% agarose gel. .. An LPS genotype has a 971bp product, APS has a 1357bp product, and HPS has as 1055bp product.

    Article Title: An association between the PTGS2 rs5275 polymorphism and colorectal cancer risk in families with inherited non-syndromic predisposition
    Article Snippet: The genotyping assays were performed in 96-well plates in a LightCycler 480 real-time PCR system (Roche Applied Sciences, Sydney, Australia). .. For PIRA assays, 50 ng of template DNA was amplified (in duplicate) and resultant PCR products digested overnight using BclI (New England Biolabs Inc., Beverly, MA, USA). .. The digested PCR products were separated on a Criterion TBE 10% polyacrylamide gels (Bio-Rad Laboratories, Sydney, Australia) and resolved using Gel Red Nucleic Acid Stain (Biotium, Hayward, CA, USA) and a Typhoon 9400 scanner (GE Healthcare, Sydney, Australia).

    Mutagenesis:

    Article Title: Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes
    Article Snippet: A silent mutation in the proline codon (CCC to CCG) was introduced between the Bsa BI and Bcl I sites of the bacterial WT lacZ -containing plasmid pCH110, carrying both bacterial and SV40 promoters, to create a variant (but functional) lacZ plasmid pTV123. .. Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB).

    Article Title: Strain-dependent induction of epithelial cell oncosis by Campylobacter jejuni is correlated with invasion ability and is independent of cytolethal distending toxin
    Article Snippet: Paragraph title: Construction and characterization of isogenic CDT mutant. ... Plasmid DNA was extracted with the QIAprep Spin Miniprep kit (Qiagen) and digested with Bcl I (New England Biolabs, NEB) to generate the deletion.

    Article Title: Characterization of denitrifying activity by the alphaproteobacterium, Sphingomonas wittichii RW1
    Article Snippet: Paragraph title: Construction of norZ ch mutant of S. wittichii RW1 ... Plasmids from positive transformants were purified using Wizard® Plus SV Minipreps DNA Purification System kit (Promega Corp., Madison, WI) and digested with the BclI restriction enzyme (New England BioLabs Inc., Ipswich MA).

    Article Title: Genetic alterations of IDH1 and Vegf in brain tumors, et al. Genetic alterations of IDH1 and Vegf in brain tumors
    Article Snippet: DNA from tumor tissue and peripheral blood was extracted using the DNeasy Blood & Tissue Kit (QIAGEN® Hilden, Germany) according to the manufacturer's instructions. .. 2.3 IDH1 gene mutation in tumor tissue was determined by PCR‐RFLP (Polymerase Chain Reaction‐Restriction Fragment Length Polymorphism), using BclI restriction enzyme (New England Biolabs). .. Exon 4 of IDH1 gene was amplified using 100 ng of DNA in a final volume of 25 μl.

    Article Title: Mapping Out Regions on the Surface of the Aspartate Receptor That Are Essential for Kinase Activation
    Article Snippet: Deoxynucleotides were synthesized by Life Technologies Inc. Kunkel site-directed mutagenesis reagents (T7 DNA polymerase and deoxynucleoside triphosphates) were purchased from BioRad. .. MluI, EcoRI, BsmI, BclI, BsaI, and SacI were from New England Biolabs.

    Article Title: Mechanistic Characterization of GS-9190 (Tegobuvir), a Novel Nonnucleoside Inhibitor of Hepatitis C Virus NS5B Polymerase
    Article Snippet: Paragraph title: Construction of mutant and chimeric replicons. ... PCR fragments were gel purified (Qiagen), digested with SpeI and BclI (New England BioLabs [NEB]), and ligated into an analogously digested and purified pFK I341 PI-Luc/NS3-3′/ET vector fragment.

    Article Title:
    Article Snippet: The G87R mutation created a new BclI restriction site in the mutant PCR amplicon that could distinguish between homozygous, heterozygous, and healthy individuals. .. PCR products were subjected to enzymatic digestion by BclI according to the manufacturer's specifications (New England Biolabs, Ipswich, MA).

    Isolation:

    Article Title: Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes
    Article Snippet: The variant plasmid was necessary to distinguish it from the WT lacZ (transcribed from HEK293 stable cells), which served as a template for transferring the missing sequence into the gapped variant plasmid ( ). .. Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB). .. Ten picomols of two complementary HPLC-purified U-containing oligos as indicated , with the same silent mutation in the lacZ sequence, were annealed and ligated to Bsa BI/Bcl I-digested vector at 16 °C overnight.

    Article Title: Determinants of the Endosomal Localization of Sorting Nexin 1
    Article Snippet: The plasmid SNX2/pEGFP-c1 was transformed into E . coli strain SCS110 (Stratagene) to obtain unmethylated DNA. .. A similar digestion procedure was followed using the restriction enzymes Nco I and Bcl I (New England Biolabs) at 37°C overnight, and the DNA fragment was isolated from agarose gels and purified. .. The GFP-SNX1 and GFP-SNX2 fragments were ligated to the pcDNA5/FRT/TO-TOPO vector (Invitrogen) following the manufacturer's procedure.

    Article Title: Attracting AID to targets of somatic hypermutation
    Article Snippet: 107 DT40 cells were used for each digestion with 0, 10, and 50 U DNase I (Applied Biosystems) in 250 µl of solution. .. Isolated DNA was digested with Pst I and Bcl I (New England Biolabs, Inc.), and a Sac I/BsrG I fragment from eGFP was used to make a probe using a random-priming synthesis kit (Roche) for Southern blot analysis. .. ChIP assays for acetylated histones H3 and H4 were performed as previously described ( ) with few modifications.

    Size-exclusion Chromatography:

    Article Title: Variations in COMT Gene Interact With Parenting to Influence Attention in Early Development
    Article Snippet: The amplification conditions were as follows: 94°C 3 min, followed by 35 cycles of 94°C 20 sec, 56°C 20 sec, 72°C 90 sec, and a final incubation at 72°C 3 min. Carriers of the APS haplotype were confirmed by specifically amplifying loci with the A,A alleles of rs6269 and rs4680, using the same conditions above and the primers PSAF 5′-TGAACCTTGCCCCTCTGCA and PSAR 5′-ATGCACACCTTGTCCTTCAT. .. All PCR products were digested with the restriction enzyme BsaAI (NEB) at 37°C, then BclI (NEB) at 50°C and resolved on a 1.5% agarose gel.

    Labeling:

    Article Title: Synergetic Targeted Delivery of Sleeping-Beauty Transposon System to Mesenchymal Stem Cells Using LPD Nanoparticles Modified with a Phage-Displayed Targeting Peptide
    Article Snippet: The neomycin resistance gene in pT2/SVNeo was converted into the EGFP gene by restriction digestion with Bcl I and BstB I (New England Biolabs, Inc. MA, USA). .. After the appropriate fragments were gel purified and recovered, the EGFP fragment was cloned by ligation into the pT2/SVNeo, giving rise to pT2/EGFP constructs. pT2/EGFP and pSB11 plasmid were purified using the EndoFree Plasmid Max Kit (Qiagen, CA, USA).

    Purification:

    Article Title: Determinants of the Endosomal Localization of Sorting Nexin 1
    Article Snippet: The plasmid SNX2/pEGFP-c1 was transformed into E . coli strain SCS110 (Stratagene) to obtain unmethylated DNA. .. A similar digestion procedure was followed using the restriction enzymes Nco I and Bcl I (New England Biolabs) at 37°C overnight, and the DNA fragment was isolated from agarose gels and purified. .. The GFP-SNX1 and GFP-SNX2 fragments were ligated to the pcDNA5/FRT/TO-TOPO vector (Invitrogen) following the manufacturer's procedure.

    Article Title: Strain-dependent induction of epithelial cell oncosis by Campylobacter jejuni is correlated with invasion ability and is independent of cytolethal distending toxin
    Article Snippet: Plasmid DNA was extracted with the QIAprep Spin Miniprep kit (Qiagen) and digested with Bcl I (New England Biolabs, NEB) to generate the deletion. .. Plasmid DNA was extracted with the QIAprep Spin Miniprep kit (Qiagen) and digested with Bcl I (New England Biolabs, NEB) to generate the deletion.

    Article Title: Synergetic Targeted Delivery of Sleeping-Beauty Transposon System to Mesenchymal Stem Cells Using LPD Nanoparticles Modified with a Phage-Displayed Targeting Peptide
    Article Snippet: The neomycin resistance gene in pT2/SVNeo was converted into the EGFP gene by restriction digestion with Bcl I and BstB I (New England Biolabs, Inc. MA, USA). .. The sequence of primer 1 is GCGGTGATCATATGGTGAGCAAGGGC; the primer 2 is GCGGTTCGAACTTTACTTGTACAGCT.

    Article Title: Characterization of denitrifying activity by the alphaproteobacterium, Sphingomonas wittichii RW1
    Article Snippet: The ligation mixture was transformed into dam − /dcm − competent E. coli cells (New England BioLabs Inc., Ipswich, MA) and transformants were selected via blue-white screening on LB agar plates containing 0.5 mM IPTG, 80 μg/mL X-Gal, and 100 μg/mL ampicillin. .. Plasmids from positive transformants were purified using Wizard® Plus SV Minipreps DNA Purification System kit (Promega Corp., Madison, WI) and digested with the BclI restriction enzyme (New England BioLabs Inc., Ipswich MA). .. The digest was run on a 0.8% agarose gel and linearized vector was gel-purified using the Wizard® SV Gel and PCR Clean-Up System kit (Promega Corp., Madison, WI).

    Article Title: Mapping Out Regions on the Surface of the Aspartate Receptor That Are Essential for Kinase Activation
    Article Snippet: The methods and materials used to express and isolate purified CheA, CheW, and CheY have been previously described ( ). .. MluI, EcoRI, BsmI, BclI, BsaI, and SacI were from New England Biolabs.

    Article Title: Mechanistic Characterization of GS-9190 (Tegobuvir), a Novel Nonnucleoside Inhibitor of Hepatitis C Virus NS5B Polymerase
    Article Snippet: A 2a NS5B/1b chimeric replicon was created by amplifying the NS5B-3′-untranslated region (UTR) via PCR from the pJFH plasmid using the primers 2a5′NS5BBclIfw (5′-GATCGACTGATCACTCCCTGTAGCCCCGAAGAGG-3′) and 2a3′UTRSpeIrev2 (5′-AGCTTAGACTAGTACATGATCTGCAGAGAGACCAG-3′). .. PCR fragments were gel purified (Qiagen), digested with SpeI and BclI (New England BioLabs [NEB]), and ligated into an analogously digested and purified pFK I341 PI-Luc/NS3-3′/ET vector fragment. .. A β-hairpin chimera was created using multiple rounds of site-directed mutagenesis (QuikChange XL; Stratagene) to change amino acids 434 to 455 of the NS5B region in pFK I341 PI-Luc/NS3-3′/ET to that of genotype 2a (JFH1).

    Sequencing:

    Article Title: Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes
    Article Snippet: The variant plasmid was necessary to distinguish it from the WT lacZ (transcribed from HEK293 stable cells), which served as a template for transferring the missing sequence into the gapped variant plasmid ( ). .. Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB).

    Article Title: A polymorphism rs4705341 in the flanking region of miR-143/145 predicts risk and prognosis of colorectal cancer
    Article Snippet: The PCR products were digested with Bcl I (New England BioLabs, Beverly, MA). .. The PCR products were digested with Bcl I (New England BioLabs, Beverly, MA).

    Article Title: Synergetic Targeted Delivery of Sleeping-Beauty Transposon System to Mesenchymal Stem Cells Using LPD Nanoparticles Modified with a Phage-Displayed Targeting Peptide
    Article Snippet: The neomycin resistance gene in pT2/SVNeo was converted into the EGFP gene by restriction digestion with Bcl I and BstB I (New England Biolabs, Inc. MA, USA). .. The fragment excised by the two restriction enzymes from pT2/SVNeo plasmids was discarded and replaced by a PCR fragment of pEGFP-N1 with a similar restriction digestion.

    Article Title: Mechanistic Characterization of GS-9190 (Tegobuvir), a Novel Nonnucleoside Inhibitor of Hepatitis C Virus NS5B Polymerase
    Article Snippet: PCR fragments were gel purified (Qiagen), digested with SpeI and BclI (New England BioLabs [NEB]), and ligated into an analogously digested and purified pFK I341 PI-Luc/NS3-3′/ET vector fragment. .. The NS5B region was then subcloned into a fresh vector backbone by using BclI and SpeI restriction sites.

    Blocking Assay:

    Article Title: Killer Cell Immunoglobulin-Like Receptors (KIR) Typing By DNA Sequencing
    Article Snippet: Genomic DNA from cells carrying KIR2DL3. describes the use of restriction enzyme digestion to eliminate a highly homologous gene when present in the sample. .. Restriction endonuclease BclI (15U/µl) and 10X NE Buffer 3 (New England BioLabs, Ipswich, MA, USA) Reagent grade water Phenol:chloroform:isoamyl alcohol 25:24:1,V/V/V (e.g., UltraPure™ phenol:chloroform:isoamyl alcohol, Invitrogen) (see ) 3M sodium acetate (Sigma-Aldrich) 70% ethanol in water (Warner-Graham Company) at −20°C Heating block at 50°C -20 oC freezer Supplies and equipment described in Section 2.2 .. Nested PCR amplicon of KIR2DS4 from Section 2.3. describes the use of cloning to separate alleles in specific KIR2DS4 heterozygous samples.

    Lysis:

    Article Title: Attracting AID to targets of somatic hypermutation
    Article Snippet: Nuclei from DT40 cells were isolated and digested as previously described ( ) with modified lysis buffer containing 0.05% NP-40. .. Isolated DNA was digested with Pst I and Bcl I (New England Biolabs, Inc.), and a Sac I/BsrG I fragment from eGFP was used to make a probe using a random-priming synthesis kit (Roche) for Southern blot analysis.

    Article Title: Herpesvirus telomeric repeats facilitate genomic integration into host telomeres and mobilization of viral DNA during reactivation
    Article Snippet: PFGE analysis was performed as described previously ( ). .. 1 × 107 /ml LCLs were embedded in 1% agarose and digested at 50°C for 48 h hours in lysis buffer (0.5 M EDTA and 1% wt/vol N -laurylsarcosine) containing 1 mg/ml proteinase K. Proteinase K was inactivated with 0.01 mM phenylmethanesulfonyl fluoride, and agarose plugs were digested with either SfiI or BclI (New England Biolabs) overnight according to the manufacturer’s instructions. .. DNA fragments were resolved via PFGE using the CHEF-DR III system (Bio-Rad Laboratories).

    Mouse Assay:

    Article Title: Generation of Mitochondrial-nuclear eXchange Mice via Pronuclear Transfer
    Article Snippet: 26 gauge needle 1 or 3 ml syringe Microscope slides CellTram vario syringe 10 centimeter tissue culture dishes Female donor mice (3–4 weeks of age) of desired nuclear or mitochondrial genetic backgrounds Male breeders (proven) of matching nuclear background as donor females Female recipient mice (8–10 weeks of age) Vasectomized male mice (proven) Gonadotropin from pregnant mare serum (PMS) (Sigma-Aldrich, catalog number: G4877) Note: This product has been discontinued. .. Human chorionic gonadotropin (HCG) (Sigma-Aldrich, catalog number: CG10) M2 medium (Sigma-Aldrich, catalog number: M7167) Cytochalasin B from Drechslera dematioidea (Sigma-Aldrich, catalog number: C6762) Colcemid (Sigma-Aldrich, catalog number: D1925) Embryo tested mineral oil (Sigma-Aldrich, catalog number: M8410) Water for embryo transfer (Sigma-Aldrich, catalog number: W1503) Restriction enzyme: BclI (New England Biolabs) PflFI/AspI (New England Biolabs) Dilution of PMS (see Recipes) Dilution of HCG (see Recipes) Dilution of cytochalasin B (see Recipes) Dilution of colcemid (see Recipes)

    Plasmid Preparation:

    Article Title: Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes
    Article Snippet: Paragraph title: Generation of a double-strand break-containing plasmid ... Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB).

    Article Title: Determinants of the Endosomal Localization of Sorting Nexin 1
    Article Snippet: The plasmid SNX2/pEGFP-c1 was transformed into E . coli strain SCS110 (Stratagene) to obtain unmethylated DNA. .. A similar digestion procedure was followed using the restriction enzymes Nco I and Bcl I (New England Biolabs) at 37°C overnight, and the DNA fragment was isolated from agarose gels and purified.

    Article Title: Strain-dependent induction of epithelial cell oncosis by Campylobacter jejuni is correlated with invasion ability and is independent of cytolethal distending toxin
    Article Snippet: Mutants were selected on Luria–Bertani agar (LB) containing ampicillin (100 μg ml−1 ). .. Plasmid DNA was extracted with the QIAprep Spin Miniprep kit (Qiagen) and digested with Bcl I (New England Biolabs, NEB) to generate the deletion. .. A 987 bp fragment of pACYC177 containing the Tn903 kanamycin-resistance cassette [aph (3′)-1a(KnR )] was amplified by PCR using primers F2kanbamH1 (5′-TTGT GGATCC TCAACAAAGCCACGTTGTGT-3′) and R2kanbamH1 (5′-TTGT GGATCC TCCCGTCAAGTCAGCGTAAT-3′) (Bam HI restriction site underlined).

    Article Title: Synergetic Targeted Delivery of Sleeping-Beauty Transposon System to Mesenchymal Stem Cells Using LPD Nanoparticles Modified with a Phage-Displayed Targeting Peptide
    Article Snippet: Paragraph title: Plasmid Development ... The neomycin resistance gene in pT2/SVNeo was converted into the EGFP gene by restriction digestion with Bcl I and BstB I (New England Biolabs, Inc. MA, USA).

    Article Title: Characterization of denitrifying activity by the alphaproteobacterium, Sphingomonas wittichii RW1
    Article Snippet: The amplification product was purified and ligated to the pGEM®-T Vector according to manufacturers' instructions (Promega Corp., Madison, WI). .. Plasmids from positive transformants were purified using Wizard® Plus SV Minipreps DNA Purification System kit (Promega Corp., Madison, WI) and digested with the BclI restriction enzyme (New England BioLabs Inc., Ipswich MA).

    Article Title: Mapping Out Regions on the Surface of the Aspartate Receptor That Are Essential for Kinase Activation
    Article Snippet: The strain and plasmid used to generate CheY (RBB455/pRBB40) were kindly provided by Robert Bourret, University of North Carolina. .. MluI, EcoRI, BsmI, BclI, BsaI, and SacI were from New England Biolabs.

    Article Title: Mechanistic Characterization of GS-9190 (Tegobuvir), a Novel Nonnucleoside Inhibitor of Hepatitis C Virus NS5B Polymerase
    Article Snippet: A 2a NS5B/1b chimeric replicon was created by amplifying the NS5B-3′-untranslated region (UTR) via PCR from the pJFH plasmid using the primers 2a5′NS5BBclIfw (5′-GATCGACTGATCACTCCCTGTAGCCCCGAAGAGG-3′) and 2a3′UTRSpeIrev2 (5′-AGCTTAGACTAGTACATGATCTGCAGAGAGACCAG-3′). .. PCR fragments were gel purified (Qiagen), digested with SpeI and BclI (New England BioLabs [NEB]), and ligated into an analogously digested and purified pFK I341 PI-Luc/NS3-3′/ET vector fragment. .. A β-hairpin chimera was created using multiple rounds of site-directed mutagenesis (QuikChange XL; Stratagene) to change amino acids 434 to 455 of the NS5B region in pFK I341 PI-Luc/NS3-3′/ET to that of genotype 2a (JFH1).

    Software:

    Article Title: Characterization of denitrifying activity by the alphaproteobacterium, Sphingomonas wittichii RW1
    Article Snippet: The region from bp 203 to 776 of the norZ ch gene was PCR-amplified from S. wittichii RW1 genomic DNA with primers 203F 5′ aactggaacaggccgatg 3′ and 776R 5′ cgatcgccttcatcttcg 3′ to make use of an internal BclI restriction site [Primer3 Input 0.4.0 software (Rozen and Skaletsky, )]. .. Plasmids from positive transformants were purified using Wizard® Plus SV Minipreps DNA Purification System kit (Promega Corp., Madison, WI) and digested with the BclI restriction enzyme (New England BioLabs Inc., Ipswich MA).

    Article Title: HMGB1 gene polymorphisms in patients with chronic hepatitis B virus infection
    Article Snippet: Appropriate primer pairs (sense 5’-3’GTCTCCTTTGCCCAGTGTATCTC and anti-sense 5’-3’GTACACAGCCTTTGTCTGAGTCTG) were designed by Primer Premier 5.0 software (Premier Biosoft International, Palo Alto, CA, United States). .. Restriction enzyme BcLI (recognition site T/GATCA) was obtained from NEB; the fragments were separated by electrophoresis on 3% agarose gel and stained with ethidium bromide for visualization under ultraviolet light.

    Microscopy:

    Article Title: Generation of Mitochondrial-nuclear eXchange Mice via Pronuclear Transfer
    Article Snippet: 26 gauge needle 1 or 3 ml syringe Microscope slides CellTram vario syringe 10 centimeter tissue culture dishes Female donor mice (3–4 weeks of age) of desired nuclear or mitochondrial genetic backgrounds Male breeders (proven) of matching nuclear background as donor females Female recipient mice (8–10 weeks of age) Vasectomized male mice (proven) Gonadotropin from pregnant mare serum (PMS) (Sigma-Aldrich, catalog number: G4877) Note: This product has been discontinued. .. Human chorionic gonadotropin (HCG) (Sigma-Aldrich, catalog number: CG10) M2 medium (Sigma-Aldrich, catalog number: M7167) Cytochalasin B from Drechslera dematioidea (Sigma-Aldrich, catalog number: C6762) Colcemid (Sigma-Aldrich, catalog number: D1925) Embryo tested mineral oil (Sigma-Aldrich, catalog number: M8410) Water for embryo transfer (Sigma-Aldrich, catalog number: W1503) Restriction enzyme: BclI (New England Biolabs) PflFI/AspI (New England Biolabs) Dilution of PMS (see Recipes) Dilution of HCG (see Recipes) Dilution of cytochalasin B (see Recipes) Dilution of colcemid (see Recipes)

    Real-time Polymerase Chain Reaction:

    Article Title: An association between the PTGS2 rs5275 polymorphism and colorectal cancer risk in families with inherited non-syndromic predisposition
    Article Snippet: The genotyping assays were performed in 96-well plates in a LightCycler 480 real-time PCR system (Roche Applied Sciences, Sydney, Australia). .. For PIRA assays, 50 ng of template DNA was amplified (in duplicate) and resultant PCR products digested overnight using BclI (New England Biolabs Inc., Beverly, MA, USA).

    Functional Assay:

    Article Title: Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes
    Article Snippet: A silent mutation in the proline codon (CCC to CCG) was introduced between the Bsa BI and Bcl I sites of the bacterial WT lacZ -containing plasmid pCH110, carrying both bacterial and SV40 promoters, to create a variant (but functional) lacZ plasmid pTV123. .. Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB).

    Selection:

    Article Title: European Ancestry Predominates in Neuromyelitis Optica and Multiple Sclerosis Patients from Brazil
    Article Snippet: Paragraph title: Ancestry Informative Markers (AIMs) Selection and Genotyping ... CKM *1 and DRD2-Bcl I*1 single nucleotide polymorphisms were identified using PCR-amplified DNA digested with TaqI and BclI (New England Biolabs, Ipswitch, MA).

    Agarose Gel Electrophoresis:

    Article Title: Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes
    Article Snippet: Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB). .. Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB).

    Article Title: Determinants of the Endosomal Localization of Sorting Nexin 1
    Article Snippet: The DNA fragment containing GFP-SNX1 was isolated by agarose gel electrophoresis and purified using QIAquick gel extraction kit (QIAGEN, Valencia, CA). .. A similar digestion procedure was followed using the restriction enzymes Nco I and Bcl I (New England Biolabs) at 37°C overnight, and the DNA fragment was isolated from agarose gels and purified.

    Article Title: Genetic variants in the H2AFX promoter region are associated with risk of sporadic breast cancer in non-Hispanic white women aged < =55 years
    Article Snippet: Polymerase chain reactions were performed with a PTC-200 DNA Engine Peltier thermal cycler (formerly MJ Research, Waltham, MA, USA). .. The four amplified fragments were then digested, respectively, by Bcc I, Rsa I, BsiHKA I, and Bcl I (New England BioLabs, Beverly, MA, USA) and separated in 3% agarose gel ( ). .. The χ2 tests were used to compare the distributions of demographic variables and selected risk factors between cases and controls.

    Article Title: Characterization of denitrifying activity by the alphaproteobacterium, Sphingomonas wittichii RW1
    Article Snippet: Plasmids from positive transformants were purified using Wizard® Plus SV Minipreps DNA Purification System kit (Promega Corp., Madison, WI) and digested with the BclI restriction enzyme (New England BioLabs Inc., Ipswich MA). .. Plasmids from positive transformants were purified using Wizard® Plus SV Minipreps DNA Purification System kit (Promega Corp., Madison, WI) and digested with the BclI restriction enzyme (New England BioLabs Inc., Ipswich MA).

    Article Title: HMGB1 gene polymorphisms in patients with chronic hepatitis B virus infection
    Article Snippet: PCR condition was as follows: one cycle of predenature 3 min at 95 °C, 30 cycles of denature 30 s at 94 °C, hybridization for 30 s at 54 °C, an extension cycle of 50 s at 72 °C, and a last cycle of delay 5 min at 72 °C. .. Restriction enzyme BcLI (recognition site T/GATCA) was obtained from NEB; the fragments were separated by electrophoresis on 3% agarose gel and stained with ethidium bromide for visualization under ultraviolet light. .. The observed genotypes were also identified by direct sequencing before large-scale test was started.

    Article Title: Variations in COMT Gene Interact With Parenting to Influence Attention in Early Development
    Article Snippet: The amplification reaction was the same as above, using the primers PSAF and PSGR. .. All PCR products were digested with the restriction enzyme BsaAI (NEB) at 37°C, then BclI (NEB) at 50°C and resolved on a 1.5% agarose gel. .. An LPS genotype has a 971bp product, APS has a 1357bp product, and HPS has as 1055bp product.

    Incubation:

    Article Title: Variations in COMT Gene Interact With Parenting to Influence Attention in Early Development
    Article Snippet: The amplification conditions were as follows: 94°C 3 min, followed by 35 cycles of 94°C 20 sec, 56°C 20 sec, 72°C 90 sec, and a final incubation at 72°C 3 min. Carriers of the APS haplotype were confirmed by specifically amplifying loci with the A,A alleles of rs6269 and rs4680, using the same conditions above and the primers PSAF 5′-TGAACCTTGCCCCTCTGCA and PSAR 5′-ATGCACACCTTGTCCTTCAT. .. All PCR products were digested with the restriction enzyme BsaAI (NEB) at 37°C, then BclI (NEB) at 50°C and resolved on a 1.5% agarose gel.

    Concentration Assay:

    Article Title: Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes
    Article Snippet: Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB). .. To create DSB-containing 3′-P ends, plasmids were digested with Udg and Fpg (both from NEB) at 37 °C for 1 h per the manufacturer's protocol, except that 2 mM EDTA was added to the reaction buffer to avoid non-specific nuclease activity.

    DNA Purification:

    Article Title: Characterization of denitrifying activity by the alphaproteobacterium, Sphingomonas wittichii RW1
    Article Snippet: The ligation mixture was transformed into dam − /dcm − competent E. coli cells (New England BioLabs Inc., Ipswich, MA) and transformants were selected via blue-white screening on LB agar plates containing 0.5 mM IPTG, 80 μg/mL X-Gal, and 100 μg/mL ampicillin. .. Plasmids from positive transformants were purified using Wizard® Plus SV Minipreps DNA Purification System kit (Promega Corp., Madison, WI) and digested with the BclI restriction enzyme (New England BioLabs Inc., Ipswich MA). .. The digest was run on a 0.8% agarose gel and linearized vector was gel-purified using the Wizard® SV Gel and PCR Clean-Up System kit (Promega Corp., Madison, WI).

    Staining:

    Article Title: HMGB1 gene polymorphisms in patients with chronic hepatitis B virus infection
    Article Snippet: PCR condition was as follows: one cycle of predenature 3 min at 95 °C, 30 cycles of denature 30 s at 94 °C, hybridization for 30 s at 54 °C, an extension cycle of 50 s at 72 °C, and a last cycle of delay 5 min at 72 °C. .. Restriction enzyme BcLI (recognition site T/GATCA) was obtained from NEB; the fragments were separated by electrophoresis on 3% agarose gel and stained with ethidium bromide for visualization under ultraviolet light. .. The observed genotypes were also identified by direct sequencing before large-scale test was started.

    Variant Assay:

    Article Title: Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes
    Article Snippet: The variant plasmid was necessary to distinguish it from the WT lacZ (transcribed from HEK293 stable cells), which served as a template for transferring the missing sequence into the gapped variant plasmid ( ). .. Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    New England Biolabs bcli
    Bcli, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bcli/product/New England Biolabs
    Average 98 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    bcli - by Bioz Stars, 2019-12
    98/100 stars
      Buy from Supplier

    Image Search Results