hphi  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Name:
    HphI
    Description:
    HphI 5 000 units
    Catalog Number:
    R0158L
    Price:
    269
    Category:
    Restriction Enzymes
    Size:
    5 000 units
    Buy from Supplier


    Structured Review

    New England Biolabs hphi
    HphI
    HphI 5 000 units
    https://www.bioz.com/result/hphi/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hphi - by Bioz Stars, 2021-06
    94/100 stars

    Images

    1) Product Images from "ACVR1 Gene Mutation in Sporadic Korean Patients with Fibrodysplasia Ossificans Progressiva"

    Article Title: ACVR1 Gene Mutation in Sporadic Korean Patients with Fibrodysplasia Ossificans Progressiva

    Journal: Journal of Korean Medical Science

    doi: 10.3346/jkms.2009.24.3.433

    Mutation analysis of the ACVR1 in FOP patients with definite clinical manifestations. ( A ) Direct sequencing of the PCR products of the ACVR1 showed the presence of the c.617G > A mutation. R=adenine or guanine, ( B ) Restriction endonuclease digestion of the PCR product (350 bp). The G allele (control) was digested by Cac8I to produce three bands, whereas the A allele appeared as two bands. Because FOP patients were heterozygous for this mutation, the 139 bp and 114 bp bands were also presented. The PCR product not digested with HphI corresponds to the G allele (control) in contrast to digested products corresponding to the A allele (FOP).
    Figure Legend Snippet: Mutation analysis of the ACVR1 in FOP patients with definite clinical manifestations. ( A ) Direct sequencing of the PCR products of the ACVR1 showed the presence of the c.617G > A mutation. R=adenine or guanine, ( B ) Restriction endonuclease digestion of the PCR product (350 bp). The G allele (control) was digested by Cac8I to produce three bands, whereas the A allele appeared as two bands. Because FOP patients were heterozygous for this mutation, the 139 bp and 114 bp bands were also presented. The PCR product not digested with HphI corresponds to the G allele (control) in contrast to digested products corresponding to the A allele (FOP).

    Techniques Used: Mutagenesis, Sequencing, Polymerase Chain Reaction

    2) Product Images from "Investigation of the Genes Involved in Antigenic Switching at the vlsE Locus in Borrelia burgdorferi: An Essential Role for the RuvAB Branch MigraseCentral Role of the Holliday Junction Helicase RuvAB in vlsE Recombination and Infectivity of Borrelia burgdorferi"

    Article Title: Investigation of the Genes Involved in Antigenic Switching at the vlsE Locus in Borrelia burgdorferi: An Essential Role for the RuvAB Branch MigraseCentral Role of the Holliday Junction Helicase RuvAB in vlsE Recombination and Infectivity of Borrelia burgdorferi

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1000680

    Restriction fragment length polymorphism assay for switching at vlsE . A portion of the vlsE expression site containing the variable regions was amplified using primers B248 and B249 to give a product of 776 bp. PCR reactions were performed on B. burgdorferi grown from ear biopsies taken at day 21 and the products were digested with HphI and run on a 1.2% agarose gel in TAE buffer at 75V for 1.5 hours and stained with ethidium bromide (see Materials and Methods ). Wild-type B. burgdorferi B31-5A4 recovered following infection of a C3H/HeN mouse was used as a template in lanes 1 and 2. An unswitched template (not exposed to mouse infection) is shown in lanes 3 and 4. PCR products from rep2 and mutS2 /1 DNA templates are found in lanes 5 6, and 7 8 respectively. M denotes a 100bp molecular weight marker.
    Figure Legend Snippet: Restriction fragment length polymorphism assay for switching at vlsE . A portion of the vlsE expression site containing the variable regions was amplified using primers B248 and B249 to give a product of 776 bp. PCR reactions were performed on B. burgdorferi grown from ear biopsies taken at day 21 and the products were digested with HphI and run on a 1.2% agarose gel in TAE buffer at 75V for 1.5 hours and stained with ethidium bromide (see Materials and Methods ). Wild-type B. burgdorferi B31-5A4 recovered following infection of a C3H/HeN mouse was used as a template in lanes 1 and 2. An unswitched template (not exposed to mouse infection) is shown in lanes 3 and 4. PCR products from rep2 and mutS2 /1 DNA templates are found in lanes 5 6, and 7 8 respectively. M denotes a 100bp molecular weight marker.

    Techniques Used: Polymorphism Assay, Expressing, Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining, Infection, Molecular Weight, Marker

    3) Product Images from "Imaging cytoplasmic lipid droplets in vivo with fluorescent perilipin 2 and perilipin 3 knockin zebrafish"

    Article Title: Imaging cytoplasmic lipid droplets in vivo with fluorescent perilipin 2 and perilipin 3 knockin zebrafish

    Journal: bioRxiv

    doi: 10.1101/2021.01.10.426109

    Generation of in-frame fluorescent reporters in the endogenous plin2 and plin3 loci. (A,B) Representative images of whole mount in situ hybridization with probes against zebrafish plin2 ( ENSDARG00000042332 ) and zgc:77486 ( plin3/4/5 ) ( ENSDARG00000013711 ) at 6 dpf either unfed or following feeding with a high fat meal for 90 min. ISH was performed 3 times for each gene with n = 10 larvae per probe per experiment; scale = 500 μm (A), scale = 100 μm (B). Plin2 is expressed in the intestine only following a high-fat meal whereas plin3 is expressed in the intestine in unfed fish and has stronger expression following a high fat meal. (C) Overview of the location and strategy used for TALEN-mediated genome editing. EGFP was fused in-frame at the N-terminus of plin2 . TALEN targets in plin2 are located in exon 1 of the plin2-203 ENSDART00000175378.2 transcript and flank a FokI restriction site, loss of which was used to confirm cutting activity. A donor plasmid with the coding sequence for EGFP and plin2 homology arms was co-injected with TALEN mRNA into 1-cell stage embryos to be used as a template for homology directed repair. mTag-RFP-t was fused in frame at the C-terminus of plin3 . TALEN targets were located in exon 8 of the plin3 ENSDART00000100473.5 transcript and flank the termination codon and a HphI restriction site, loss of which was used to confirm cutting activity. A donor plasmid with the coding sequence for mTagRFP-t and plin3 homology arms was co-injected with TALEN mRNA into 1-cell stage embryos to be used as a template for homology directed repair. (D) Following identification of fluorescent embryos in the F1 generation, RT-PCR and sequencing of genomic DNA using the primers noted on the knock-in loci depicted in (C) were used to confirm successful in-frame integration of the fluorescent tags. The size of the amplicons expected for correct integration were as follows: F1-R1 1033bp, F2-R2 1340bp, F3-R3 440bp for WT 1224bp for Fus ( EGFP-plin2 ) fusion, F4-R4 1218bp, F5-R5 1274bp, F6-R6 401bp for WT 1187 for Fus ( plin3-RFP ). Arrows indicate the larger amplicon in heterozygous fish carrying the fusion alleles. (E) Imaging in live larvae (6 dpf) reveals expression of EGFP-plin2 only in the intestine of larvae fed a high-fat meal (7 h post-start of 2 h meal) and plin3-RFP is expressed in the intestine of both unfed and fed larvae (4.5 h post-start of 2 h meal, larvae are heterozygous for the fusion proteins; the lumen of the intestine has strong autofluorescence in wild-type and transgenic fish; see Figure 1 – figure supplement 2 for images of whole fish). Scale = 500 μm. (F) Examples of larvae expressing both EGFP-plin2 and plin3-RFP (7 h post start of meal). Scale = 500 μm.
    Figure Legend Snippet: Generation of in-frame fluorescent reporters in the endogenous plin2 and plin3 loci. (A,B) Representative images of whole mount in situ hybridization with probes against zebrafish plin2 ( ENSDARG00000042332 ) and zgc:77486 ( plin3/4/5 ) ( ENSDARG00000013711 ) at 6 dpf either unfed or following feeding with a high fat meal for 90 min. ISH was performed 3 times for each gene with n = 10 larvae per probe per experiment; scale = 500 μm (A), scale = 100 μm (B). Plin2 is expressed in the intestine only following a high-fat meal whereas plin3 is expressed in the intestine in unfed fish and has stronger expression following a high fat meal. (C) Overview of the location and strategy used for TALEN-mediated genome editing. EGFP was fused in-frame at the N-terminus of plin2 . TALEN targets in plin2 are located in exon 1 of the plin2-203 ENSDART00000175378.2 transcript and flank a FokI restriction site, loss of which was used to confirm cutting activity. A donor plasmid with the coding sequence for EGFP and plin2 homology arms was co-injected with TALEN mRNA into 1-cell stage embryos to be used as a template for homology directed repair. mTag-RFP-t was fused in frame at the C-terminus of plin3 . TALEN targets were located in exon 8 of the plin3 ENSDART00000100473.5 transcript and flank the termination codon and a HphI restriction site, loss of which was used to confirm cutting activity. A donor plasmid with the coding sequence for mTagRFP-t and plin3 homology arms was co-injected with TALEN mRNA into 1-cell stage embryos to be used as a template for homology directed repair. (D) Following identification of fluorescent embryos in the F1 generation, RT-PCR and sequencing of genomic DNA using the primers noted on the knock-in loci depicted in (C) were used to confirm successful in-frame integration of the fluorescent tags. The size of the amplicons expected for correct integration were as follows: F1-R1 1033bp, F2-R2 1340bp, F3-R3 440bp for WT 1224bp for Fus ( EGFP-plin2 ) fusion, F4-R4 1218bp, F5-R5 1274bp, F6-R6 401bp for WT 1187 for Fus ( plin3-RFP ). Arrows indicate the larger amplicon in heterozygous fish carrying the fusion alleles. (E) Imaging in live larvae (6 dpf) reveals expression of EGFP-plin2 only in the intestine of larvae fed a high-fat meal (7 h post-start of 2 h meal) and plin3-RFP is expressed in the intestine of both unfed and fed larvae (4.5 h post-start of 2 h meal, larvae are heterozygous for the fusion proteins; the lumen of the intestine has strong autofluorescence in wild-type and transgenic fish; see Figure 1 – figure supplement 2 for images of whole fish). Scale = 500 μm. (F) Examples of larvae expressing both EGFP-plin2 and plin3-RFP (7 h post start of meal). Scale = 500 μm.

    Techniques Used: In Situ Hybridization, Fluorescence In Situ Hybridization, Expressing, Activity Assay, Plasmid Preparation, Sequencing, Injection, Reverse Transcription Polymerase Chain Reaction, Knock-In, Amplification, Imaging, Transgenic Assay

    4) Product Images from "Methyltransferases acquired by lactococcal 936-type phage provide protection against restriction endonuclease activity"

    Article Title: Methyltransferases acquired by lactococcal 936-type phage provide protection against restriction endonuclease activity

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-15-831

    DNA restriction analyses. A) i) Phi93 and Phi145 (DAM negative) cut with Dpn1 (cuts methylated GATC) and DpnII (cuts unmethylated GATC). ii) Phi145, Phi93 (MTase positive) and Phi15 (MTase negative) with HphI. B) i) Plasmid pPiM.93DAM cut with Dpn1 (cuts methylated GATC) and DpnII (cuts unmethylated GATC) under induced (I) and un-induced (NI) conditions. ii) Plasmid pPTPi (P), pPiM.145I cut with HphI under induced (I) and un-induced (NI) conditions. iii) Plasmid pPTPi (P), pPiM.145II cut with HphI under induced (I) and un-induced (NI) conditions.
    Figure Legend Snippet: DNA restriction analyses. A) i) Phi93 and Phi145 (DAM negative) cut with Dpn1 (cuts methylated GATC) and DpnII (cuts unmethylated GATC). ii) Phi145, Phi93 (MTase positive) and Phi15 (MTase negative) with HphI. B) i) Plasmid pPiM.93DAM cut with Dpn1 (cuts methylated GATC) and DpnII (cuts unmethylated GATC) under induced (I) and un-induced (NI) conditions. ii) Plasmid pPTPi (P), pPiM.145I cut with HphI under induced (I) and un-induced (NI) conditions. iii) Plasmid pPTPi (P), pPiM.145II cut with HphI under induced (I) and un-induced (NI) conditions.

    Techniques Used: Methylation, Plasmid Preparation

    5) Product Images from "Telomere damage induces internal loops that generate telomeric circles"

    Article Title: Telomere damage induces internal loops that generate telomeric circles

    Journal: Nature Communications

    doi: 10.1038/s41467-020-19139-4

    A two-step procedure for the purification of mammalian telomeres. a Top: agarose gel showing the separation of the large telomeric repeat fragments from the bulk genomic DNA in a sucrose gradient. Genomic DNA (∼2.5 mg) from SV40LT-immortalized MEFs was digested with HinfI and MspI. The digested DNA was separated by centrifugation on a sucrose gradient. Seven fractions were collected and an aliquot (∼1/500) of each fraction was loaded on an agarose gel. Bottom: the gel was blotted onto a membrane and hybridized with a TTAGGG repeats probe to verify that telomeric repeats remained in the high molecular weight (HMW) fractions. Source data are provided as a Source Data File. b Left: agarose gel showing the separation of the large telomeric repeat fragments from the remaining non-telomeric DNA, in the second purification round. The HMW DNA, contained in the last four fractions of the sucrose gradient described in (a), was recovered and digested with RsaI, AluI, MboI, HinfI, MspI, HphI, and MnlI. The digested DNA was separated on a preparative agarose gel and the DNA migrating in the area above 5 kb was extracted from the gel. The image shows an aliquot (∼1/100) of the digested DNA, separated on an agarose gel. Right: the gel was blotted onto a membrane and hybridized with a TTAGGG repeats probe to verify that telomeric repeats remained in the HMW area. Source data are provided as a Source Data File. c Dot blot analysis showing the enrichment of telomeric repeats. The indicated amounts of DNA from each enrichment step were spotted on a membrane and hybridized either with a probe recognizing the long interspersed L1 repeats or TTAGGG repeats. The amount of TTAGGG repeat signal/ng was quantified and reported relative to the signal/ng value in the initial, non-enriched DNA. Source data are provided as a Source Data File. d Single-molecule analysis showing the enrichment of the telomeric repeats. The DNA was combed onto silanized coverslips, denatured in situ and labeled sequentially with an antibody against single-stranded DNA and a Cy3-labeled (TTAGGG) 3 PNA probe.
    Figure Legend Snippet: A two-step procedure for the purification of mammalian telomeres. a Top: agarose gel showing the separation of the large telomeric repeat fragments from the bulk genomic DNA in a sucrose gradient. Genomic DNA (∼2.5 mg) from SV40LT-immortalized MEFs was digested with HinfI and MspI. The digested DNA was separated by centrifugation on a sucrose gradient. Seven fractions were collected and an aliquot (∼1/500) of each fraction was loaded on an agarose gel. Bottom: the gel was blotted onto a membrane and hybridized with a TTAGGG repeats probe to verify that telomeric repeats remained in the high molecular weight (HMW) fractions. Source data are provided as a Source Data File. b Left: agarose gel showing the separation of the large telomeric repeat fragments from the remaining non-telomeric DNA, in the second purification round. The HMW DNA, contained in the last four fractions of the sucrose gradient described in (a), was recovered and digested with RsaI, AluI, MboI, HinfI, MspI, HphI, and MnlI. The digested DNA was separated on a preparative agarose gel and the DNA migrating in the area above 5 kb was extracted from the gel. The image shows an aliquot (∼1/100) of the digested DNA, separated on an agarose gel. Right: the gel was blotted onto a membrane and hybridized with a TTAGGG repeats probe to verify that telomeric repeats remained in the HMW area. Source data are provided as a Source Data File. c Dot blot analysis showing the enrichment of telomeric repeats. The indicated amounts of DNA from each enrichment step were spotted on a membrane and hybridized either with a probe recognizing the long interspersed L1 repeats or TTAGGG repeats. The amount of TTAGGG repeat signal/ng was quantified and reported relative to the signal/ng value in the initial, non-enriched DNA. Source data are provided as a Source Data File. d Single-molecule analysis showing the enrichment of the telomeric repeats. The DNA was combed onto silanized coverslips, denatured in situ and labeled sequentially with an antibody against single-stranded DNA and a Cy3-labeled (TTAGGG) 3 PNA probe.

    Techniques Used: Purification, Agarose Gel Electrophoresis, Centrifugation, Molecular Weight, Dot Blot, In Situ, Labeling

    6) Product Images from "90-Kilodalton Heat Shock Protein, Hsp90, as a Target for Genotyping Cryptosporidium spp. Known To Infect Humans ▿ spp. Known To Infect Humans ▿ †"

    Article Title: 90-Kilodalton Heat Shock Protein, Hsp90, as a Target for Genotyping Cryptosporidium spp. Known To Infect Humans ▿ spp. Known To Infect Humans ▿ †

    Journal: Eukaryotic Cell

    doi: 10.1128/EC.00294-08

    Differentiation of intestinal Cryptosporidium spp. by RFLP analysis of hsp90 PCR gene products using StyI and HphI. Lanes 1 to 4, C. parvum ; lanes 5 to 9 and 28, C. hominis ; lanes 11 to 14, C. canis ; lanes 15 and 29, 100-bp molecular markers; lanes 16
    Figure Legend Snippet: Differentiation of intestinal Cryptosporidium spp. by RFLP analysis of hsp90 PCR gene products using StyI and HphI. Lanes 1 to 4, C. parvum ; lanes 5 to 9 and 28, C. hominis ; lanes 11 to 14, C. canis ; lanes 15 and 29, 100-bp molecular markers; lanes 16

    Techniques Used: Polymerase Chain Reaction

    7) Product Images from "Inactivation of Individual SeqA Binding Sites of the E. coli Origin Reveals Robustness of Replication Initiation Synchrony"

    Article Title: Inactivation of Individual SeqA Binding Sites of the E. coli Origin Reveals Robustness of Replication Initiation Synchrony

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0166722

    Sequence of oriC showing its major protein binding sites. (A) Sequence of oriC that includes the minimal region (coordinates 1–246) required for origin function. The coordinate 1 correspondence to 3923744 of gb|U00096.3|. The region includes several GATC sites (shown in red) which are methylated by the Dam methylase enzyme. There are three 13-mer repeats of AT rich sequences where the origin initially unwinds. The remainder of the origin has mainly 9-mer DnaA binding sites as well as sites for binding IHF and FIS proteins. DnaA sites have either high (R1, R2 and R4) or low (τ1, R5, τ2, I1, I2, C3, C2, I3 and C1) affinity for DnaA. The numbers #1–9 mark the GATC sites studied here. A TaqI site (TCGA) overlapping each of the nine GATC sites was created by converting their two upstream bases to TC ( NNGA TC to TCGA TC). (B) A linear map of oriC features described above. The map also shows location of sites for restriction enzymes MboII and HphI that naturally occurs in oriC .
    Figure Legend Snippet: Sequence of oriC showing its major protein binding sites. (A) Sequence of oriC that includes the minimal region (coordinates 1–246) required for origin function. The coordinate 1 correspondence to 3923744 of gb|U00096.3|. The region includes several GATC sites (shown in red) which are methylated by the Dam methylase enzyme. There are three 13-mer repeats of AT rich sequences where the origin initially unwinds. The remainder of the origin has mainly 9-mer DnaA binding sites as well as sites for binding IHF and FIS proteins. DnaA sites have either high (R1, R2 and R4) or low (τ1, R5, τ2, I1, I2, C3, C2, I3 and C1) affinity for DnaA. The numbers #1–9 mark the GATC sites studied here. A TaqI site (TCGA) overlapping each of the nine GATC sites was created by converting their two upstream bases to TC ( NNGA TC to TCGA TC). (B) A linear map of oriC features described above. The map also shows location of sites for restriction enzymes MboII and HphI that naturally occurs in oriC .

    Techniques Used: Sequencing, Protein Binding, Methylation, Binding Assay, Immunohistofluorescence

    8) Product Images from "Telomere damage induces internal loops that generate telomeric circles"

    Article Title: Telomere damage induces internal loops that generate telomeric circles

    Journal: bioRxiv

    doi: 10.1101/2020.01.29.924951

    A two-step procedure for the purification of mammalian telomeres A. Top: agarose gel showing the separation of the large telomeric repeat fragments from the bulk DNA in a sucrose gradient. Genomic DNA (~2.5 mg) from SV40-MEFs was digested with HinfI and MspI. The digested DNA was separated by centrifugation on a sucrose gradient. Seven fractions were collected and an aliquot (~1/500) of each fraction was loaded on an agarose gel. Bottom: the gel was blotted onto a membrane and hybridized with a TTAGGG repeats probe to verify that telomeric repeats remained in the high molecular weight (HMW) fractions. B. Left: agarose gel showing the separation of the large telomeric repeat fragments from the remaining non-telomeric DNA, in the second purification round. The HMW DNA, contained in the last four fractions of the sucrose gradient described in (A), was recovered and digested with RsaI, AluI, MboI, HinfI, MspI, HphI and MnlI. The digested DNA was separated on a preparative agarose gel and the DNA migrating in the area above 5 kb was extracted from the gel. The image shows an aliquot (~1/100) of the digested DNA, separated on an agarose gel. Right: the gel was blotted onto a membrane and hybridized with a TTAGGG repeats probe to verify that telomeric repeats remained in the HMW area. C. Dot blot analysis showing the enrichment of telomeric repeats. The indicated amounts of DNA from each enrichment step were spotted on a membrane and hybridized either with a probe recognizing the long interspersed BamHI repeats or TTAGGG repeats. The amount of TTAGGG repeat signal/ng was quantified and reported relative to the signal/ng value in the initial, non-enriched DNA. D. Single molecule analysis showing the enrichment of the telomeric repeats. The DNA was combed onto silanized coverslips, denatured in situ and labeled sequentially with an antibody against single-stranded DNA and a Cy3-labeled (TTAGGG) 3 PNA probe.
    Figure Legend Snippet: A two-step procedure for the purification of mammalian telomeres A. Top: agarose gel showing the separation of the large telomeric repeat fragments from the bulk DNA in a sucrose gradient. Genomic DNA (~2.5 mg) from SV40-MEFs was digested with HinfI and MspI. The digested DNA was separated by centrifugation on a sucrose gradient. Seven fractions were collected and an aliquot (~1/500) of each fraction was loaded on an agarose gel. Bottom: the gel was blotted onto a membrane and hybridized with a TTAGGG repeats probe to verify that telomeric repeats remained in the high molecular weight (HMW) fractions. B. Left: agarose gel showing the separation of the large telomeric repeat fragments from the remaining non-telomeric DNA, in the second purification round. The HMW DNA, contained in the last four fractions of the sucrose gradient described in (A), was recovered and digested with RsaI, AluI, MboI, HinfI, MspI, HphI and MnlI. The digested DNA was separated on a preparative agarose gel and the DNA migrating in the area above 5 kb was extracted from the gel. The image shows an aliquot (~1/100) of the digested DNA, separated on an agarose gel. Right: the gel was blotted onto a membrane and hybridized with a TTAGGG repeats probe to verify that telomeric repeats remained in the HMW area. C. Dot blot analysis showing the enrichment of telomeric repeats. The indicated amounts of DNA from each enrichment step were spotted on a membrane and hybridized either with a probe recognizing the long interspersed BamHI repeats or TTAGGG repeats. The amount of TTAGGG repeat signal/ng was quantified and reported relative to the signal/ng value in the initial, non-enriched DNA. D. Single molecule analysis showing the enrichment of the telomeric repeats. The DNA was combed onto silanized coverslips, denatured in situ and labeled sequentially with an antibody against single-stranded DNA and a Cy3-labeled (TTAGGG) 3 PNA probe.

    Techniques Used: Purification, Agarose Gel Electrophoresis, Centrifugation, Molecular Weight, Dot Blot, In Situ, Labeling

    Related Articles

    Polymerase Chain Reaction:

    Article Title: 90-Kilodalton Heat Shock Protein, Hsp90, as a Target for Genotyping Cryptosporidium spp. Known To Infect Humans ▿ spp. Known To Infect Humans ▿ †
    Article Snippet: .. Ten microliters of the secondary PCR products of the Hsp90 gene was digested with StyI, HphI, or BbsI (New England BioLabs, Ipswich, MA) under the conditions suggested by the manufacturer, and the products were visualized by electrophoresis through a 2% agarose gel. ..

    Article Title: Investigation of the Genes Involved in Antigenic Switching at the vlsE Locus in Borrelia burgdorferi: An Essential Role for the RuvAB Branch MigraseCentral Role of the Holliday Junction Helicase RuvAB in vlsE Recombination and Infectivity of Borrelia burgdorferi
    Article Snippet: Phusion polymerase (Finnzymes) was used for PCR and the product was purified using the QIAquick PCR Purification Kit (Qiagen). .. Approximately 200ng of PCR product was digested with 2 units of HphI (New England BioLabs) for 1.5 hours. .. Reaction products were analyzed on a 1.2% agarose gel run at 75 V for 1.5 hours in Tris-acetate buffer, stained with 0.5 µg/ml ethidium bromide and images acquired using a FluorChem 8900 imaging system.

    Article Title: Identification and functional characterization of a novel splicing mutation in RP gene PRPF31
    Article Snippet: The first exon/intron boundary of the PRPF31 gene was amplified using PCR primers 5′ aacgctagaaacagtggtgc 3′ (forward primer) and 5′ aggttgcaatgagccgagatc 3′ (reverse primer). .. The 222 bp PCR product was digested with 1 unit of Hph I (NEB, USA) at 37°C overnight, and the resulting products were separated on a 2.0% agarose gel. .. Total RNA was extracted from peripheral whole blood samples from individuals III-13, III-15, IV-5, IV-13, IV-15, V-2, V-3, V-6, V-12, V-16 and V-24 (see ) using the Trizol reagent (Invitrogen, USA).

    Article Title: Genome-scale investigation of phenotypically distinct but nearly clonal Trichoderma strains
    Article Snippet: .. All PCR products were digested to completion with Hph I (New England Biolabs). shows the banding patterns for LU132, LU140 and IMI206040. .. The SNP1-containing region could also be amplified from five T. atroviride strains from Europe and Asia and three T. atroviride strains from New Zealand but the digest banding pattern resembled that of LU140 and IMI206040.

    Article Title: ACVR1 Gene Mutation in Sporadic Korean Patients with Fibrodysplasia Ossificans Progressiva
    Article Snippet: PCR products were sequenced directly using an ABI Prism 3700 automated sequencer (Applied Biosystems, Foster City, CA, U.S.A.). .. Results were further verified by restriction endonuclease digestion of PCR products using Cac8I (New England Biolabs, Beverly, MA, U.S.A.) and HphI (New England Biolabs). .. RESULTS DNA sequence analysis demonstrated the invariable presence of a heterozygous point mutation of c.617G > A in all ten patients with obvious clinical manifestations ( ).

    Electrophoresis:

    Article Title: 90-Kilodalton Heat Shock Protein, Hsp90, as a Target for Genotyping Cryptosporidium spp. Known To Infect Humans ▿ spp. Known To Infect Humans ▿ †
    Article Snippet: .. Ten microliters of the secondary PCR products of the Hsp90 gene was digested with StyI, HphI, or BbsI (New England BioLabs, Ipswich, MA) under the conditions suggested by the manufacturer, and the products were visualized by electrophoresis through a 2% agarose gel. ..

    Agarose Gel Electrophoresis:

    Article Title: 90-Kilodalton Heat Shock Protein, Hsp90, as a Target for Genotyping Cryptosporidium spp. Known To Infect Humans ▿ spp. Known To Infect Humans ▿ †
    Article Snippet: .. Ten microliters of the secondary PCR products of the Hsp90 gene was digested with StyI, HphI, or BbsI (New England BioLabs, Ipswich, MA) under the conditions suggested by the manufacturer, and the products were visualized by electrophoresis through a 2% agarose gel. ..

    Article Title: Identification and functional characterization of a novel splicing mutation in RP gene PRPF31
    Article Snippet: The first exon/intron boundary of the PRPF31 gene was amplified using PCR primers 5′ aacgctagaaacagtggtgc 3′ (forward primer) and 5′ aggttgcaatgagccgagatc 3′ (reverse primer). .. The 222 bp PCR product was digested with 1 unit of Hph I (NEB, USA) at 37°C overnight, and the resulting products were separated on a 2.0% agarose gel. .. Total RNA was extracted from peripheral whole blood samples from individuals III-13, III-15, IV-5, IV-13, IV-15, V-2, V-3, V-6, V-12, V-16 and V-24 (see ) using the Trizol reagent (Invitrogen, USA).

    Article Title: Telomere damage induces internal loops that generate telomeric circles
    Article Snippet: The digestion was precipitated and loaded on a sucrose gradient, 10%–20%–30% sucrose, 8 ml each fraction, in TNE buffer and centrifuged in SW32-Ti rotor (Beckman) at 30100 rpm (111265 g) for 16 h. The HMW fractions containing the telomeric repeats were collected, concentrated, and washed twice with Tris 10 mM pH 8.0 in Amicon Ultra-15 Ultracel-PL PLTK, 30 kDa MWCO (Millipore/MERCK UFC903024) filters. .. The DNA was then digested overnight with 50 units each of RsaI, AluI, MboI, HinfI, MspI, HphI, MnlI (NEB), and then separated on a 0.7% low-melting agarose gel (SeaPlaque Agarose, Lonza, 50100), without ethidium bromide. .. Fragments migrating above the 5 kb band of the marker were extracted using the Silica Bead DNA gel extraction kit (Thermo Fisher Scientific, K0513) following the manufacturer’s instructions, except that once the DNA was bound, the beads were not resuspended to avoid mechanical shearing of the DNA.

    Plasmid Preparation:

    Article Title: Methyltransferases acquired by lactococcal 936-type phage provide protection against restriction endonuclease activity
    Article Snippet: Following a 3 h incubation at 30°C, the induced cells harboring pPiM.93DAM, pPiM.145I and pPiM.145II were harvested by centrifugation (5, 580 × g, 10 min) and subsequently incubated in protoplast buffer (20 mM Tris–HCl, pH 7.5, 5 mM EDTA, 0.75 M sucrose, 10 mg mL−1 lysozyme and 50 units mL−1 mutanolysin; Sigma) at 37°C for 30 min. Each sample was centrifuged at 1,700 × g for 5 min and plasmid preparations were performed using the GeneJet plasmid miniprep kit as described by the manufacturer (Thermo Scientific, Dublin, Ireland). .. Restriction endonuclease digests were performed on phage DNA, plasmid DNA and bacterial genomic DNA using DpnI and DpnII (Roche, United States), or HphI (NEB, United States), all according to the manufacturer’s instructions. .. Nucleotide sequence accession numbers All the sequences generated have been submitted to GenBank database with the following accession numbers: Phi15 [GenBank: KM091442], Phi93 [GenBank: KM091443] and Phi145 [GenBank: KM091444].

    In Vitro:

    Article Title: Imaging cytoplasmic lipid droplets in vivo with fluorescent perilipin 2 and perilipin 3 knockin zebrafish
    Article Snippet: .. TALEN mRNA was in vitro transcribed using the T3 Message Machine Kit (Thermo Fisher Scientific, AM1348), injected into 1-cell stage zebrafish embryos, and cutting efficiency of each pair was assessed by monitoring the loss of either FokI (NEB R0109) or HphI (NEB R0158) digestion due to TALEN nuclease activity. .. Nuclease activity was higher for plin2 TALEN pair 1 and plin3 TALEN pair 1 and these were used subsequently for genome integration.

    Injection:

    Article Title: Imaging cytoplasmic lipid droplets in vivo with fluorescent perilipin 2 and perilipin 3 knockin zebrafish
    Article Snippet: .. TALEN mRNA was in vitro transcribed using the T3 Message Machine Kit (Thermo Fisher Scientific, AM1348), injected into 1-cell stage zebrafish embryos, and cutting efficiency of each pair was assessed by monitoring the loss of either FokI (NEB R0109) or HphI (NEB R0158) digestion due to TALEN nuclease activity. .. Nuclease activity was higher for plin2 TALEN pair 1 and plin3 TALEN pair 1 and these were used subsequently for genome integration.

    Activity Assay:

    Article Title: Imaging cytoplasmic lipid droplets in vivo with fluorescent perilipin 2 and perilipin 3 knockin zebrafish
    Article Snippet: .. TALEN mRNA was in vitro transcribed using the T3 Message Machine Kit (Thermo Fisher Scientific, AM1348), injected into 1-cell stage zebrafish embryos, and cutting efficiency of each pair was assessed by monitoring the loss of either FokI (NEB R0109) or HphI (NEB R0158) digestion due to TALEN nuclease activity. .. Nuclease activity was higher for plin2 TALEN pair 1 and plin3 TALEN pair 1 and these were used subsequently for genome integration.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    New England Biolabs hphi
    Mutation analysis of the ACVR1 in FOP patients with definite clinical manifestations. ( A ) Direct sequencing of the <t>PCR</t> products of the ACVR1 showed the presence of the c.617G > A mutation. R=adenine or guanine, ( B ) Restriction endonuclease digestion of the PCR product (350 bp). The G allele (control) was digested by Cac8I to produce three bands, whereas the A allele appeared as two bands. Because FOP patients were heterozygous for this mutation, the 139 bp and 114 bp bands were also presented. The PCR product not digested with <t>HphI</t> corresponds to the G allele (control) in contrast to digested products corresponding to the A allele (FOP).
    Hphi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hphi/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hphi - by Bioz Stars, 2021-06
    94/100 stars
      Buy from Supplier

    Image Search Results


    Mutation analysis of the ACVR1 in FOP patients with definite clinical manifestations. ( A ) Direct sequencing of the PCR products of the ACVR1 showed the presence of the c.617G > A mutation. R=adenine or guanine, ( B ) Restriction endonuclease digestion of the PCR product (350 bp). The G allele (control) was digested by Cac8I to produce three bands, whereas the A allele appeared as two bands. Because FOP patients were heterozygous for this mutation, the 139 bp and 114 bp bands were also presented. The PCR product not digested with HphI corresponds to the G allele (control) in contrast to digested products corresponding to the A allele (FOP).

    Journal: Journal of Korean Medical Science

    Article Title: ACVR1 Gene Mutation in Sporadic Korean Patients with Fibrodysplasia Ossificans Progressiva

    doi: 10.3346/jkms.2009.24.3.433

    Figure Lengend Snippet: Mutation analysis of the ACVR1 in FOP patients with definite clinical manifestations. ( A ) Direct sequencing of the PCR products of the ACVR1 showed the presence of the c.617G > A mutation. R=adenine or guanine, ( B ) Restriction endonuclease digestion of the PCR product (350 bp). The G allele (control) was digested by Cac8I to produce three bands, whereas the A allele appeared as two bands. Because FOP patients were heterozygous for this mutation, the 139 bp and 114 bp bands were also presented. The PCR product not digested with HphI corresponds to the G allele (control) in contrast to digested products corresponding to the A allele (FOP).

    Article Snippet: Results were further verified by restriction endonuclease digestion of PCR products using Cac8I (New England Biolabs, Beverly, MA, U.S.A.) and HphI (New England Biolabs).

    Techniques: Mutagenesis, Sequencing, Polymerase Chain Reaction

    Restriction fragment length polymorphism assay for switching at vlsE . A portion of the vlsE expression site containing the variable regions was amplified using primers B248 and B249 to give a product of 776 bp. PCR reactions were performed on B. burgdorferi grown from ear biopsies taken at day 21 and the products were digested with HphI and run on a 1.2% agarose gel in TAE buffer at 75V for 1.5 hours and stained with ethidium bromide (see Materials and Methods ). Wild-type B. burgdorferi B31-5A4 recovered following infection of a C3H/HeN mouse was used as a template in lanes 1 and 2. An unswitched template (not exposed to mouse infection) is shown in lanes 3 and 4. PCR products from rep2 and mutS2 /1 DNA templates are found in lanes 5 6, and 7 8 respectively. M denotes a 100bp molecular weight marker.

    Journal: PLoS Pathogens

    Article Title: Investigation of the Genes Involved in Antigenic Switching at the vlsE Locus in Borrelia burgdorferi: An Essential Role for the RuvAB Branch MigraseCentral Role of the Holliday Junction Helicase RuvAB in vlsE Recombination and Infectivity of Borrelia burgdorferi

    doi: 10.1371/journal.ppat.1000680

    Figure Lengend Snippet: Restriction fragment length polymorphism assay for switching at vlsE . A portion of the vlsE expression site containing the variable regions was amplified using primers B248 and B249 to give a product of 776 bp. PCR reactions were performed on B. burgdorferi grown from ear biopsies taken at day 21 and the products were digested with HphI and run on a 1.2% agarose gel in TAE buffer at 75V for 1.5 hours and stained with ethidium bromide (see Materials and Methods ). Wild-type B. burgdorferi B31-5A4 recovered following infection of a C3H/HeN mouse was used as a template in lanes 1 and 2. An unswitched template (not exposed to mouse infection) is shown in lanes 3 and 4. PCR products from rep2 and mutS2 /1 DNA templates are found in lanes 5 6, and 7 8 respectively. M denotes a 100bp molecular weight marker.

    Article Snippet: Approximately 200ng of PCR product was digested with 2 units of HphI (New England BioLabs) for 1.5 hours.

    Techniques: Polymorphism Assay, Expressing, Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining, Infection, Molecular Weight, Marker

    Generation of in-frame fluorescent reporters in the endogenous plin2 and plin3 loci. (A,B) Representative images of whole mount in situ hybridization with probes against zebrafish plin2 ( ENSDARG00000042332 ) and zgc:77486 ( plin3/4/5 ) ( ENSDARG00000013711 ) at 6 dpf either unfed or following feeding with a high fat meal for 90 min. ISH was performed 3 times for each gene with n = 10 larvae per probe per experiment; scale = 500 μm (A), scale = 100 μm (B). Plin2 is expressed in the intestine only following a high-fat meal whereas plin3 is expressed in the intestine in unfed fish and has stronger expression following a high fat meal. (C) Overview of the location and strategy used for TALEN-mediated genome editing. EGFP was fused in-frame at the N-terminus of plin2 . TALEN targets in plin2 are located in exon 1 of the plin2-203 ENSDART00000175378.2 transcript and flank a FokI restriction site, loss of which was used to confirm cutting activity. A donor plasmid with the coding sequence for EGFP and plin2 homology arms was co-injected with TALEN mRNA into 1-cell stage embryos to be used as a template for homology directed repair. mTag-RFP-t was fused in frame at the C-terminus of plin3 . TALEN targets were located in exon 8 of the plin3 ENSDART00000100473.5 transcript and flank the termination codon and a HphI restriction site, loss of which was used to confirm cutting activity. A donor plasmid with the coding sequence for mTagRFP-t and plin3 homology arms was co-injected with TALEN mRNA into 1-cell stage embryos to be used as a template for homology directed repair. (D) Following identification of fluorescent embryos in the F1 generation, RT-PCR and sequencing of genomic DNA using the primers noted on the knock-in loci depicted in (C) were used to confirm successful in-frame integration of the fluorescent tags. The size of the amplicons expected for correct integration were as follows: F1-R1 1033bp, F2-R2 1340bp, F3-R3 440bp for WT 1224bp for Fus ( EGFP-plin2 ) fusion, F4-R4 1218bp, F5-R5 1274bp, F6-R6 401bp for WT 1187 for Fus ( plin3-RFP ). Arrows indicate the larger amplicon in heterozygous fish carrying the fusion alleles. (E) Imaging in live larvae (6 dpf) reveals expression of EGFP-plin2 only in the intestine of larvae fed a high-fat meal (7 h post-start of 2 h meal) and plin3-RFP is expressed in the intestine of both unfed and fed larvae (4.5 h post-start of 2 h meal, larvae are heterozygous for the fusion proteins; the lumen of the intestine has strong autofluorescence in wild-type and transgenic fish; see Figure 1 – figure supplement 2 for images of whole fish). Scale = 500 μm. (F) Examples of larvae expressing both EGFP-plin2 and plin3-RFP (7 h post start of meal). Scale = 500 μm.

    Journal: bioRxiv

    Article Title: Imaging cytoplasmic lipid droplets in vivo with fluorescent perilipin 2 and perilipin 3 knockin zebrafish

    doi: 10.1101/2021.01.10.426109

    Figure Lengend Snippet: Generation of in-frame fluorescent reporters in the endogenous plin2 and plin3 loci. (A,B) Representative images of whole mount in situ hybridization with probes against zebrafish plin2 ( ENSDARG00000042332 ) and zgc:77486 ( plin3/4/5 ) ( ENSDARG00000013711 ) at 6 dpf either unfed or following feeding with a high fat meal for 90 min. ISH was performed 3 times for each gene with n = 10 larvae per probe per experiment; scale = 500 μm (A), scale = 100 μm (B). Plin2 is expressed in the intestine only following a high-fat meal whereas plin3 is expressed in the intestine in unfed fish and has stronger expression following a high fat meal. (C) Overview of the location and strategy used for TALEN-mediated genome editing. EGFP was fused in-frame at the N-terminus of plin2 . TALEN targets in plin2 are located in exon 1 of the plin2-203 ENSDART00000175378.2 transcript and flank a FokI restriction site, loss of which was used to confirm cutting activity. A donor plasmid with the coding sequence for EGFP and plin2 homology arms was co-injected with TALEN mRNA into 1-cell stage embryos to be used as a template for homology directed repair. mTag-RFP-t was fused in frame at the C-terminus of plin3 . TALEN targets were located in exon 8 of the plin3 ENSDART00000100473.5 transcript and flank the termination codon and a HphI restriction site, loss of which was used to confirm cutting activity. A donor plasmid with the coding sequence for mTagRFP-t and plin3 homology arms was co-injected with TALEN mRNA into 1-cell stage embryos to be used as a template for homology directed repair. (D) Following identification of fluorescent embryos in the F1 generation, RT-PCR and sequencing of genomic DNA using the primers noted on the knock-in loci depicted in (C) were used to confirm successful in-frame integration of the fluorescent tags. The size of the amplicons expected for correct integration were as follows: F1-R1 1033bp, F2-R2 1340bp, F3-R3 440bp for WT 1224bp for Fus ( EGFP-plin2 ) fusion, F4-R4 1218bp, F5-R5 1274bp, F6-R6 401bp for WT 1187 for Fus ( plin3-RFP ). Arrows indicate the larger amplicon in heterozygous fish carrying the fusion alleles. (E) Imaging in live larvae (6 dpf) reveals expression of EGFP-plin2 only in the intestine of larvae fed a high-fat meal (7 h post-start of 2 h meal) and plin3-RFP is expressed in the intestine of both unfed and fed larvae (4.5 h post-start of 2 h meal, larvae are heterozygous for the fusion proteins; the lumen of the intestine has strong autofluorescence in wild-type and transgenic fish; see Figure 1 – figure supplement 2 for images of whole fish). Scale = 500 μm. (F) Examples of larvae expressing both EGFP-plin2 and plin3-RFP (7 h post start of meal). Scale = 500 μm.

    Article Snippet: TALEN mRNA was in vitro transcribed using the T3 Message Machine Kit (Thermo Fisher Scientific, AM1348), injected into 1-cell stage zebrafish embryos, and cutting efficiency of each pair was assessed by monitoring the loss of either FokI (NEB R0109) or HphI (NEB R0158) digestion due to TALEN nuclease activity.

    Techniques: In Situ Hybridization, Fluorescence In Situ Hybridization, Expressing, Activity Assay, Plasmid Preparation, Sequencing, Injection, Reverse Transcription Polymerase Chain Reaction, Knock-In, Amplification, Imaging, Transgenic Assay

    DNA restriction analyses. A) i) Phi93 and Phi145 (DAM negative) cut with Dpn1 (cuts methylated GATC) and DpnII (cuts unmethylated GATC). ii) Phi145, Phi93 (MTase positive) and Phi15 (MTase negative) with HphI. B) i) Plasmid pPiM.93DAM cut with Dpn1 (cuts methylated GATC) and DpnII (cuts unmethylated GATC) under induced (I) and un-induced (NI) conditions. ii) Plasmid pPTPi (P), pPiM.145I cut with HphI under induced (I) and un-induced (NI) conditions. iii) Plasmid pPTPi (P), pPiM.145II cut with HphI under induced (I) and un-induced (NI) conditions.

    Journal: BMC Genomics

    Article Title: Methyltransferases acquired by lactococcal 936-type phage provide protection against restriction endonuclease activity

    doi: 10.1186/1471-2164-15-831

    Figure Lengend Snippet: DNA restriction analyses. A) i) Phi93 and Phi145 (DAM negative) cut with Dpn1 (cuts methylated GATC) and DpnII (cuts unmethylated GATC). ii) Phi145, Phi93 (MTase positive) and Phi15 (MTase negative) with HphI. B) i) Plasmid pPiM.93DAM cut with Dpn1 (cuts methylated GATC) and DpnII (cuts unmethylated GATC) under induced (I) and un-induced (NI) conditions. ii) Plasmid pPTPi (P), pPiM.145I cut with HphI under induced (I) and un-induced (NI) conditions. iii) Plasmid pPTPi (P), pPiM.145II cut with HphI under induced (I) and un-induced (NI) conditions.

    Article Snippet: Restriction endonuclease digests were performed on phage DNA, plasmid DNA and bacterial genomic DNA using DpnI and DpnII (Roche, United States), or HphI (NEB, United States), all according to the manufacturer’s instructions.

    Techniques: Methylation, Plasmid Preparation