saci  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    SacI
    Description:
    SacI 10 000 units
    Catalog Number:
    R0156L
    Price:
    249
    Category:
    Restriction Enzymes
    Size:
    10 000 units
    Buy from Supplier


    Structured Review

    New England Biolabs saci
    SacI
    SacI 10 000 units
    https://www.bioz.com/result/saci/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    saci - by Bioz Stars, 2021-06
    99/100 stars

    Images

    1) Product Images from "CRISPR-Cas9 genome editing induces megabase-scale chromosomal truncations"

    Article Title: CRISPR-Cas9 genome editing induces megabase-scale chromosomal truncations

    Journal: Nature Communications

    doi: 10.1038/s41467-019-09006-2

    Single nickase-mediated gene editing results in c.217 C clone for CEP disease modeling a (Left) Scheme of gene editing approach to convert wild-type HEK293T (WT HEK) into homozygous c.217 C HEK clone using nickase and a 181nt-ssODN carrying c.217 C mutation (called 181nt-ssODN-c.217 C). (Right) Detailed view of exon 4 region and CRISPR-mediated HDR design using a c.217T-targeting sgRNA and a 181nt-ssODN-c.217 C carrying c.217 C mutation (red) in addition to silent SacI restriction site (blue). Expected cleavage position using nickase is indicated with a red arrow. b – d (From left to right) Illustrative flow cytometry results for fluorocyte analysis, representative RFLP analysis, sequence spanning UROS exon 4 c.217 position obtained by Sanger sequencing and indels and HDR quantification by TIDER analysis ( b ) for WT HEK, ( c ) for cells transfected with nickase and a 181nt-ssODN-c.217 C (Mixed HEK population) and ( d ) for sorted and subcloned fluorocytes (PE-Cy5A-positive), called c.217 C HEK clone. Loq: limit of quantification. e Characterization of c.217 C HEK clone. UROS functionality assay with (Left) quantification of UROS-specific activity and (Right) fluorocyte frequencies from WT HEK or c.217 C HEK clone. Values for UROS-specific activity are normalized against WT HEK. Results are presented as mean ± SEM. For ( e ), source data are provided as a Source data file
    Figure Legend Snippet: Single nickase-mediated gene editing results in c.217 C clone for CEP disease modeling a (Left) Scheme of gene editing approach to convert wild-type HEK293T (WT HEK) into homozygous c.217 C HEK clone using nickase and a 181nt-ssODN carrying c.217 C mutation (called 181nt-ssODN-c.217 C). (Right) Detailed view of exon 4 region and CRISPR-mediated HDR design using a c.217T-targeting sgRNA and a 181nt-ssODN-c.217 C carrying c.217 C mutation (red) in addition to silent SacI restriction site (blue). Expected cleavage position using nickase is indicated with a red arrow. b – d (From left to right) Illustrative flow cytometry results for fluorocyte analysis, representative RFLP analysis, sequence spanning UROS exon 4 c.217 position obtained by Sanger sequencing and indels and HDR quantification by TIDER analysis ( b ) for WT HEK, ( c ) for cells transfected with nickase and a 181nt-ssODN-c.217 C (Mixed HEK population) and ( d ) for sorted and subcloned fluorocytes (PE-Cy5A-positive), called c.217 C HEK clone. Loq: limit of quantification. e Characterization of c.217 C HEK clone. UROS functionality assay with (Left) quantification of UROS-specific activity and (Right) fluorocyte frequencies from WT HEK or c.217 C HEK clone. Values for UROS-specific activity are normalized against WT HEK. Results are presented as mean ± SEM. For ( e ), source data are provided as a Source data file

    Techniques Used: Mutagenesis, CRISPR, Flow Cytometry, Cytometry, Sequencing, Transfection, Activity Assay

    Single nickase-mediated gene editing allows precise genetic and phenotypic correction. a (Left) Scheme of gene editing approach to modify the c.217 C HEK clone and turn it into genetically and phenotypically corrected HEK using nickase and a 181nt-ssODN carrying the c.217 T correcting mutation (called 181nt-ssODN-c.217 T). (Right) Detailed view of the c.217 C HEK clone containing c.217 C mutation (red) and SacI restriction site (blue). Nickase-mediated HDR design using a c.217C- SacI -specific sgRNA and a 181nt-ssODN-c.217 T carrying the c.217 T correcting mutation (grey) in addition to silent SacI restriction site (blue). Expected cleavage position using nickase is indicated with a red arrow. b – d (From left to right) Illustrative FACS (fluorescent activating cell sorting)results for fluorocyte analysis (PE-Cy5A-positive), representative RFLP analysis, sequence spanning UROS exon 4 c.217 position obtained by Sanger sequencing and indels and HDR quantification by TIDER analysis, ( b ) for the c.217 C HEK clone, ( c ) for cells transfected with nickase and 181nt-ssODN-c.217 T (Mix corrected HEK population), and ( d ) for PE-Cy5A-negative HEK293T cells sorted by FACS (called Sorted corrected HEK population). Loq: limit of quantification. e UROS functionality assays with (Left) quantification of UROS-specific activity ( n = 3) and (Right) fluorocytes frequencies from the c.217 C HEK clone, corrected HEK population and sorted corrected HEK population ( n ≥ 3). Values for UROS-specific activity are normalized with WT HEK. Results are presented as mean ± SEM. Data are from independent experiments. Statistical significance is inferred on raw data using two-tailed unpaired t-test for UROS-specific activity and paired one-way ANOVA for fluorocyte frequencies; ** p
    Figure Legend Snippet: Single nickase-mediated gene editing allows precise genetic and phenotypic correction. a (Left) Scheme of gene editing approach to modify the c.217 C HEK clone and turn it into genetically and phenotypically corrected HEK using nickase and a 181nt-ssODN carrying the c.217 T correcting mutation (called 181nt-ssODN-c.217 T). (Right) Detailed view of the c.217 C HEK clone containing c.217 C mutation (red) and SacI restriction site (blue). Nickase-mediated HDR design using a c.217C- SacI -specific sgRNA and a 181nt-ssODN-c.217 T carrying the c.217 T correcting mutation (grey) in addition to silent SacI restriction site (blue). Expected cleavage position using nickase is indicated with a red arrow. b – d (From left to right) Illustrative FACS (fluorescent activating cell sorting)results for fluorocyte analysis (PE-Cy5A-positive), representative RFLP analysis, sequence spanning UROS exon 4 c.217 position obtained by Sanger sequencing and indels and HDR quantification by TIDER analysis, ( b ) for the c.217 C HEK clone, ( c ) for cells transfected with nickase and 181nt-ssODN-c.217 T (Mix corrected HEK population), and ( d ) for PE-Cy5A-negative HEK293T cells sorted by FACS (called Sorted corrected HEK population). Loq: limit of quantification. e UROS functionality assays with (Left) quantification of UROS-specific activity ( n = 3) and (Right) fluorocytes frequencies from the c.217 C HEK clone, corrected HEK population and sorted corrected HEK population ( n ≥ 3). Values for UROS-specific activity are normalized with WT HEK. Results are presented as mean ± SEM. Data are from independent experiments. Statistical significance is inferred on raw data using two-tailed unpaired t-test for UROS-specific activity and paired one-way ANOVA for fluorocyte frequencies; ** p

    Techniques Used: Mutagenesis, FACS, Sequencing, Transfection, Activity Assay, Two Tailed Test

    UROS gene editing strategy and workflow analysis. a Experimental workflow for UROS gene editing and analysis of outcomes. Cells were nucleofected with the 181nt-ssODN template and either with nuclease or nickase followed by puromycin-positive selection. Then, (i) UROS locus was characterized by RFLP to quantify HDR and by TIDER or deep sequencing to evaluate indels and to confirm HDR percentage; (ii) UROS functionality was assessed by quantifying UROS-specific activity and type-I porphyrin accumulation, respectively determined by HPLC and flow cytometry; (iii) Chromosomal integrity was tested for Chr10 loss or Chr10q terminal deletion either by DNA-FISH assay or array-CGH. b (Top) Schematic UROS locus in chromosome 10 with UROS gene overview (middle). (Bottom) Detailed view of exon 4 region and CRISPR-mediated HDR design using a c.217T-targeting sgRNA (highlighted in orange) with adjacent PAM and an 181nt-ssODN carrying a silent SacI restriction site (highlighted in blue) close to c.217 T position. Red arrows indicate expected cleavage site using nuclease. Chr chromosome, CGH comparative genomic hybridization, D day, e exon, HDR homology-directed repair, HPLC high performance liquid chromatography, NGS (next-generation sequencing), RFLP (restriction fragment length polymorphism), PAM protospacer adjacent motif, sgRNA single guide RNA, TIDER (tracking of insertions, deletions and recombination events)
    Figure Legend Snippet: UROS gene editing strategy and workflow analysis. a Experimental workflow for UROS gene editing and analysis of outcomes. Cells were nucleofected with the 181nt-ssODN template and either with nuclease or nickase followed by puromycin-positive selection. Then, (i) UROS locus was characterized by RFLP to quantify HDR and by TIDER or deep sequencing to evaluate indels and to confirm HDR percentage; (ii) UROS functionality was assessed by quantifying UROS-specific activity and type-I porphyrin accumulation, respectively determined by HPLC and flow cytometry; (iii) Chromosomal integrity was tested for Chr10 loss or Chr10q terminal deletion either by DNA-FISH assay or array-CGH. b (Top) Schematic UROS locus in chromosome 10 with UROS gene overview (middle). (Bottom) Detailed view of exon 4 region and CRISPR-mediated HDR design using a c.217T-targeting sgRNA (highlighted in orange) with adjacent PAM and an 181nt-ssODN carrying a silent SacI restriction site (highlighted in blue) close to c.217 T position. Red arrows indicate expected cleavage site using nuclease. Chr chromosome, CGH comparative genomic hybridization, D day, e exon, HDR homology-directed repair, HPLC high performance liquid chromatography, NGS (next-generation sequencing), RFLP (restriction fragment length polymorphism), PAM protospacer adjacent motif, sgRNA single guide RNA, TIDER (tracking of insertions, deletions and recombination events)

    Techniques Used: Selection, Sequencing, Activity Assay, High Performance Liquid Chromatography, Flow Cytometry, Cytometry, Fluorescence In Situ Hybridization, CRISPR, Hybridization, Next-Generation Sequencing

    Nuclease-mediated HDR is associated with predominant indels leading to impaired UROS functionality. a (Left) Scheme of SacI -digested PCR products obtained for alleles with or without HDR. (Center) Illustrative RFLP analysis of non-transfected HEK293T cells (NT) or transfected with nuclease only or co-delivered with the 181nt-ssODN template. (Right) HDR frequency induced by nuclease and a 181nt-ssODN ( n = 5). b (Left) NGS analysis of allelic outcomes and associated HDR/indel ratio following transfection of HEK293T cells with nuclease and 181nt-ssODN. (Center) Frequencies of reads carrying either insertion or deletion. Region spanning sgRNA sequence is highlighted in grey. (Right) Most common observed alleles (with frequencies ≥ 1%) aligned on the sgRNA sequence. HDR modification in blue and indels in red. c (Left) Quantification of UROS-specific activity from HEK293T cells NT or transfected with nuclease and 181nt-ssODN ( n = 3). Values are normalized with NT cells. (Right) Fluorocyte frequencies and illustrative flow cytometry results from NT or HEK293T cells transfected with nuclease and a 181nt-ssODN ( n = 5). Blue and red dots (and associated percentages) depict non-fluorescent cells and fluorocytes, respectively, with type-I porphyrin accumulation. Results are presented as mean ± SEM. The data are from independent experiments. Statistical significance is inferred on raw data using two-tailed unpaired t test for UROS-specific activity. *** p
    Figure Legend Snippet: Nuclease-mediated HDR is associated with predominant indels leading to impaired UROS functionality. a (Left) Scheme of SacI -digested PCR products obtained for alleles with or without HDR. (Center) Illustrative RFLP analysis of non-transfected HEK293T cells (NT) or transfected with nuclease only or co-delivered with the 181nt-ssODN template. (Right) HDR frequency induced by nuclease and a 181nt-ssODN ( n = 5). b (Left) NGS analysis of allelic outcomes and associated HDR/indel ratio following transfection of HEK293T cells with nuclease and 181nt-ssODN. (Center) Frequencies of reads carrying either insertion or deletion. Region spanning sgRNA sequence is highlighted in grey. (Right) Most common observed alleles (with frequencies ≥ 1%) aligned on the sgRNA sequence. HDR modification in blue and indels in red. c (Left) Quantification of UROS-specific activity from HEK293T cells NT or transfected with nuclease and 181nt-ssODN ( n = 3). Values are normalized with NT cells. (Right) Fluorocyte frequencies and illustrative flow cytometry results from NT or HEK293T cells transfected with nuclease and a 181nt-ssODN ( n = 5). Blue and red dots (and associated percentages) depict non-fluorescent cells and fluorocytes, respectively, with type-I porphyrin accumulation. Results are presented as mean ± SEM. The data are from independent experiments. Statistical significance is inferred on raw data using two-tailed unpaired t test for UROS-specific activity. *** p

    Techniques Used: Polymerase Chain Reaction, Transfection, Next-Generation Sequencing, Sequencing, Modification, Activity Assay, Flow Cytometry, Cytometry, Two Tailed Test

    2) Product Images from "Assembly of evolved ligninolytic genes in Saccharomyces cerevisiae"

    Article Title: Assembly of evolved ligninolytic genes in Saccharomyces cerevisiae

    Journal: Bioengineered

    doi: 10.4161/bioe.29167

    Figure 4. In vivo assembly of synthetic genes by IVOE. Each overlapping region allowed crossover events to occur between fragments giving rise to an autonomously repaired vector containing single and double expression cassettes in the correct orientation. ( A ) and ( B ) Single expression cassettes are constructed in pESC by engineering specific primers containing overhangs to foster in vivo cloning with the linearized plasmid in yeast (pJRoC30 was used as template for Vp or Lac amplifications). ( C ) and ( D ) The pESC constructs obtained in ( A ) and ( B ) were used as scaffolds to assemble Lac and Vp genes under the control of different promoter/terminator pairs. Primers used: (1)-MCS1- Vp / Lac -α-BamHI, (2)-MCS2- Vp -ter-NheI, (3)-MCS2- Lac -ter-NheI, (4)-MCS1- Vp / Lac -α-SpeI, (5)-MCS1- Lac -ter-SacI and (6)-MCS1- Vp -ter-SacI. Black arrows indicate the direction of the transcription process.
    Figure Legend Snippet: Figure 4. In vivo assembly of synthetic genes by IVOE. Each overlapping region allowed crossover events to occur between fragments giving rise to an autonomously repaired vector containing single and double expression cassettes in the correct orientation. ( A ) and ( B ) Single expression cassettes are constructed in pESC by engineering specific primers containing overhangs to foster in vivo cloning with the linearized plasmid in yeast (pJRoC30 was used as template for Vp or Lac amplifications). ( C ) and ( D ) The pESC constructs obtained in ( A ) and ( B ) were used as scaffolds to assemble Lac and Vp genes under the control of different promoter/terminator pairs. Primers used: (1)-MCS1- Vp / Lac -α-BamHI, (2)-MCS2- Vp -ter-NheI, (3)-MCS2- Lac -ter-NheI, (4)-MCS1- Vp / Lac -α-SpeI, (5)-MCS1- Lac -ter-SacI and (6)-MCS1- Vp -ter-SacI. Black arrows indicate the direction of the transcription process.

    Techniques Used: In Vivo, Plasmid Preparation, Expressing, Construct, Clone Assay

    3) Product Images from "Codon Usage Optimization and Construction of Plasmid Encoding Iranian Human Papillomavirus Type 16 E7 Oncogene for Lactococcus Lactis Subsp. Cremoris MG1363"

    Article Title: Codon Usage Optimization and Construction of Plasmid Encoding Iranian Human Papillomavirus Type 16 E7 Oncogene for Lactococcus Lactis Subsp. Cremoris MG1363

    Journal: Asian Pacific Journal of Cancer Prevention : APJCP

    doi: 10.22034/APJCP.2017.18.3.783

    The Double Digestion Patterns of the pNZ8148-HPV16-optiE7 Shuttle Plasmid via NcoI and SacI Restriction Endonuclease
    Figure Legend Snippet: The Double Digestion Patterns of the pNZ8148-HPV16-optiE7 Shuttle Plasmid via NcoI and SacI Restriction Endonuclease

    Techniques Used: Plasmid Preparation

    4) Product Images from "The Transcriptional Enhancer of the Pea Plastocyanin Gene Associates with the Nuclear Matrix and Regulates Gene Expression through Histone Acetylation"

    Article Title: The Transcriptional Enhancer of the Pea Plastocyanin Gene Associates with the Nuclear Matrix and Regulates Gene Expression through Histone Acetylation

    Journal: The Plant Cell

    doi: 10.1105/tpc.011825

    Association of the PetE Enhancer Region with Nuclear Matrices in Isolated Nuclei. Nuclei were isolated from E-P-GUS or P-GUS seedlings, extracted with LIS, and digested with PvuII, MfeI, and SacI to separate the enhancer, the uidA coding region, and the nos 3′ region into individual fragments. The nuclear matrices were collected by centrifugation, and DNA was isolated from the pellet (P) and supernatant (S) fractions and analyzed by semiquantitative PCR. Total represents a sample of the digestion mixture taken before centrifugation. The enhancer and promoter regions of PetE were amplified with primer pairs y6 and y13, the uidA coding region was amplified with primer pairs G1 and G2, and the PetE promoter region was amplified with primer pairs c2 and y13.
    Figure Legend Snippet: Association of the PetE Enhancer Region with Nuclear Matrices in Isolated Nuclei. Nuclei were isolated from E-P-GUS or P-GUS seedlings, extracted with LIS, and digested with PvuII, MfeI, and SacI to separate the enhancer, the uidA coding region, and the nos 3′ region into individual fragments. The nuclear matrices were collected by centrifugation, and DNA was isolated from the pellet (P) and supernatant (S) fractions and analyzed by semiquantitative PCR. Total represents a sample of the digestion mixture taken before centrifugation. The enhancer and promoter regions of PetE were amplified with primer pairs y6 and y13, the uidA coding region was amplified with primer pairs G1 and G2, and the PetE promoter region was amplified with primer pairs c2 and y13.

    Techniques Used: Isolation, Centrifugation, Polymerase Chain Reaction, Amplification

    Related Articles

    Plasmid Preparation:

    Article Title: Assembly of evolved ligninolytic genes in Saccharomyces cerevisiae
    Article Snippet: The uracil independent and ampicillin resistance pJRoC30 vector was obtained from the California Institute of Technology (CALTECH). .. The ura3 -deficient S. cerevisiae strain BJ5465 ( α ura3–52 trp1 leu2Δ1 his3Δ200 pep4::HIS2 prb1Δ1.6R can1 GAL1 ) was obtained from LGCPromochem, the NucleoSpin Plasmid kit was purchased from Macherey-Nagel, and the restriction enzymes BamHI, NheI, SpeI, SacI, and NotI from New England Biolabs. ..

    Article Title: Codon Usage Optimization and Construction of Plasmid Encoding Iranian Human Papillomavirus Type 16 E7 Oncogene for Lactococcus Lactis Subsp. Cremoris MG1363
    Article Snippet: The resultant fragment was constructed in a PMD18 vector via Biomatik Company (Biomatik Corporation, Cambridge, Canada). .. Construction of shuttle vectorThe optimized E7 gene, encoding the E7 oncoprotein from HPV 16, was obtained as a 291 bp DNA fragment by digesting plasmid PMD18 with restriction enzymes NcoI and SacI (New England Biolabs). .. The resultant DNA fragment was ligated into the NcoI/SacI site of pNZ8148 shuttle vector (MoBiTec, Germany).

    Article Title: pKBuS13, a KPC-2-Encoding Plasmid from Klebsiella pneumoniae Sequence Type 833, Carrying Tn4401b Inserted into an Xer Site-Specific Recombination Locus
    Article Snippet: The plasmid profile was analyzed after S1 nuclease (Roche) digestion (20 U enzyme in each sample) on crude plasmid extract (30 min at 37°C) and on DNA extracted from cells embedded in agarose plugs ( ) (1 h at 37°C), followed by separation on agarose gel electrophoresis using different running conditions: (i) 20 V for 20 h on 1% agarose gel and (ii) pulsed-field gel electrophoresis (PFGE) on 0.8% agarose gel with a CHEF-DR III apparatus (Bio-Rad) at 14°C and 6 V/cm for 13 h by using pulse times from 1 to 10 s. Separated DNA was hybridized with a digoxigenin (DIG)-labeled bla KPC -specific probe, obtained by amplification of an internal fragment of bla KPC with primers KPC-F and KPC-R ( ) in the presence of 70 μM DIG-11-dUTP (Roche) after capillary blotting onto Hybond-N-positive (N+ ) membranes (Amersham Biosciences, Piscataway, NJ). .. Plasmid restriction analysis was carried on with BamHI, HindIII, PstI, and SacI restriction enzymes according to the manufacturer's instructions (New England BioLabs, Mississauga, Ontario, Canada) followed by separation on 0.8% agarose gel. ..

    Clone Assay:

    Article Title: A Metalloprotease Homolog Venom Protein From a Parasitoid Wasp Suppresses the Toll Pathway in Host Hemocytes
    Article Snippet: The VRF1151−483 was PCR amplified with venom apparatus cDNA as the template and the primers listed in Supplementary Table . .. SacI (NEB) and SacII (NEB) restriction sites were incorporated into the primers for directional cloning of the gene. .. PCR-amplified gene fragments were first cloned into PGEM-Teasy (Promega) and then cloned into the expression vector pIZT/V5-His (Invitrogen).

    Agarose Gel Electrophoresis:

    Article Title: pKBuS13, a KPC-2-Encoding Plasmid from Klebsiella pneumoniae Sequence Type 833, Carrying Tn4401b Inserted into an Xer Site-Specific Recombination Locus
    Article Snippet: The plasmid profile was analyzed after S1 nuclease (Roche) digestion (20 U enzyme in each sample) on crude plasmid extract (30 min at 37°C) and on DNA extracted from cells embedded in agarose plugs ( ) (1 h at 37°C), followed by separation on agarose gel electrophoresis using different running conditions: (i) 20 V for 20 h on 1% agarose gel and (ii) pulsed-field gel electrophoresis (PFGE) on 0.8% agarose gel with a CHEF-DR III apparatus (Bio-Rad) at 14°C and 6 V/cm for 13 h by using pulse times from 1 to 10 s. Separated DNA was hybridized with a digoxigenin (DIG)-labeled bla KPC -specific probe, obtained by amplification of an internal fragment of bla KPC with primers KPC-F and KPC-R ( ) in the presence of 70 μM DIG-11-dUTP (Roche) after capillary blotting onto Hybond-N-positive (N+ ) membranes (Amersham Biosciences, Piscataway, NJ). .. Plasmid restriction analysis was carried on with BamHI, HindIII, PstI, and SacI restriction enzymes according to the manufacturer's instructions (New England BioLabs, Mississauga, Ontario, Canada) followed by separation on 0.8% agarose gel. ..

    Sequencing:

    Article Title: Targeted gene disruption in Candida parapsilosis demonstrates a role for CPAR2_404800 in adhesion to a biotic surface and in a murine model of ascending urinary tract infection
    Article Snippet: To show that the mutant phenotype was caused by the CpALS7 gene deletion, a wild type copy of CpALS7 gene was reintroduced into the als7△/als7△ null mutant strain. p3ALS7 plasmid was used as backbone for the construction of the reintegration cassette. .. Primers 5COM3F and 5COM3R ( Table S2 ), containing ApaI and SacI sites respectively were used in order to amplify the entire coding sequence of CpALS7 (+4439 bp, comprehensive of −26 upstream and +261 downstream bp) using Q5® High-Fidelity DNA Polymerases by New England Biolabs Inc.. .. The PCR product and p3ALS7 were digested with ApaI and SacI restriction enzymes and ligated together.

    Polymerase Chain Reaction:

    Article Title: Aging impairs double‐strand break repair by homologous recombination in Drosophila germ cells
    Article Snippet: Briefly, Sce.white was PCR‐amplified using Sce.white ‐specific primers (Fig. A) (forward, 5′ GTTTTGGGTGGGTAAGCAGG; reverse, 5′ AGACCCACGTAGTCCAGC) using SapphireAmp Fast PCR Master Mix (Clontech, Mountain View, CA, USA). .. For I‐SceI and SacI digests, PCR products were directly digested (New England Biolabs, Ipswich, MA, USA). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs saci
    Single nickase-mediated gene editing results in c.217 C clone for CEP disease modeling a (Left) Scheme of gene editing approach to convert wild-type HEK293T (WT HEK) into homozygous c.217 C HEK clone using nickase and a 181nt-ssODN carrying c.217 C mutation (called 181nt-ssODN-c.217 C). (Right) Detailed view of exon 4 region and CRISPR-mediated HDR design using a c.217T-targeting sgRNA and a 181nt-ssODN-c.217 C carrying c.217 C mutation (red) in addition to silent <t>SacI</t> restriction site (blue). Expected cleavage position using nickase is indicated with a red arrow. b – d (From left to right) Illustrative flow cytometry results for fluorocyte analysis, representative RFLP analysis, sequence spanning <t>UROS</t> exon 4 c.217 position obtained by Sanger sequencing and indels and HDR quantification by TIDER analysis ( b ) for WT HEK, ( c ) for cells transfected with nickase and a 181nt-ssODN-c.217 C (Mixed HEK population) and ( d ) for sorted and subcloned fluorocytes (PE-Cy5A-positive), called c.217 C HEK clone. Loq: limit of quantification. e Characterization of c.217 C HEK clone. UROS functionality assay with (Left) quantification of UROS-specific activity and (Right) fluorocyte frequencies from WT HEK or c.217 C HEK clone. Values for UROS-specific activity are normalized against WT HEK. Results are presented as mean ± SEM. For ( e ), source data are provided as a Source data file
    Saci, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/saci/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    saci - by Bioz Stars, 2021-06
    99/100 stars
      Buy from Supplier

    Image Search Results


    Single nickase-mediated gene editing results in c.217 C clone for CEP disease modeling a (Left) Scheme of gene editing approach to convert wild-type HEK293T (WT HEK) into homozygous c.217 C HEK clone using nickase and a 181nt-ssODN carrying c.217 C mutation (called 181nt-ssODN-c.217 C). (Right) Detailed view of exon 4 region and CRISPR-mediated HDR design using a c.217T-targeting sgRNA and a 181nt-ssODN-c.217 C carrying c.217 C mutation (red) in addition to silent SacI restriction site (blue). Expected cleavage position using nickase is indicated with a red arrow. b – d (From left to right) Illustrative flow cytometry results for fluorocyte analysis, representative RFLP analysis, sequence spanning UROS exon 4 c.217 position obtained by Sanger sequencing and indels and HDR quantification by TIDER analysis ( b ) for WT HEK, ( c ) for cells transfected with nickase and a 181nt-ssODN-c.217 C (Mixed HEK population) and ( d ) for sorted and subcloned fluorocytes (PE-Cy5A-positive), called c.217 C HEK clone. Loq: limit of quantification. e Characterization of c.217 C HEK clone. UROS functionality assay with (Left) quantification of UROS-specific activity and (Right) fluorocyte frequencies from WT HEK or c.217 C HEK clone. Values for UROS-specific activity are normalized against WT HEK. Results are presented as mean ± SEM. For ( e ), source data are provided as a Source data file

    Journal: Nature Communications

    Article Title: CRISPR-Cas9 genome editing induces megabase-scale chromosomal truncations

    doi: 10.1038/s41467-019-09006-2

    Figure Lengend Snippet: Single nickase-mediated gene editing results in c.217 C clone for CEP disease modeling a (Left) Scheme of gene editing approach to convert wild-type HEK293T (WT HEK) into homozygous c.217 C HEK clone using nickase and a 181nt-ssODN carrying c.217 C mutation (called 181nt-ssODN-c.217 C). (Right) Detailed view of exon 4 region and CRISPR-mediated HDR design using a c.217T-targeting sgRNA and a 181nt-ssODN-c.217 C carrying c.217 C mutation (red) in addition to silent SacI restriction site (blue). Expected cleavage position using nickase is indicated with a red arrow. b – d (From left to right) Illustrative flow cytometry results for fluorocyte analysis, representative RFLP analysis, sequence spanning UROS exon 4 c.217 position obtained by Sanger sequencing and indels and HDR quantification by TIDER analysis ( b ) for WT HEK, ( c ) for cells transfected with nickase and a 181nt-ssODN-c.217 C (Mixed HEK population) and ( d ) for sorted and subcloned fluorocytes (PE-Cy5A-positive), called c.217 C HEK clone. Loq: limit of quantification. e Characterization of c.217 C HEK clone. UROS functionality assay with (Left) quantification of UROS-specific activity and (Right) fluorocyte frequencies from WT HEK or c.217 C HEK clone. Values for UROS-specific activity are normalized against WT HEK. Results are presented as mean ± SEM. For ( e ), source data are provided as a Source data file

    Article Snippet: PCR products were purified with Nucleospin® Gel and PCR Clean-up (Macherey-Nagel) and digested with SacI (or ApaI for exon 10 UROS analysis) restriction enzyme (New England Biolabs, Ipswich, MA, USA) for 1 h at 37 °C.

    Techniques: Mutagenesis, CRISPR, Flow Cytometry, Cytometry, Sequencing, Transfection, Activity Assay

    Single nickase-mediated gene editing allows precise genetic and phenotypic correction. a (Left) Scheme of gene editing approach to modify the c.217 C HEK clone and turn it into genetically and phenotypically corrected HEK using nickase and a 181nt-ssODN carrying the c.217 T correcting mutation (called 181nt-ssODN-c.217 T). (Right) Detailed view of the c.217 C HEK clone containing c.217 C mutation (red) and SacI restriction site (blue). Nickase-mediated HDR design using a c.217C- SacI -specific sgRNA and a 181nt-ssODN-c.217 T carrying the c.217 T correcting mutation (grey) in addition to silent SacI restriction site (blue). Expected cleavage position using nickase is indicated with a red arrow. b – d (From left to right) Illustrative FACS (fluorescent activating cell sorting)results for fluorocyte analysis (PE-Cy5A-positive), representative RFLP analysis, sequence spanning UROS exon 4 c.217 position obtained by Sanger sequencing and indels and HDR quantification by TIDER analysis, ( b ) for the c.217 C HEK clone, ( c ) for cells transfected with nickase and 181nt-ssODN-c.217 T (Mix corrected HEK population), and ( d ) for PE-Cy5A-negative HEK293T cells sorted by FACS (called Sorted corrected HEK population). Loq: limit of quantification. e UROS functionality assays with (Left) quantification of UROS-specific activity ( n = 3) and (Right) fluorocytes frequencies from the c.217 C HEK clone, corrected HEK population and sorted corrected HEK population ( n ≥ 3). Values for UROS-specific activity are normalized with WT HEK. Results are presented as mean ± SEM. Data are from independent experiments. Statistical significance is inferred on raw data using two-tailed unpaired t-test for UROS-specific activity and paired one-way ANOVA for fluorocyte frequencies; ** p

    Journal: Nature Communications

    Article Title: CRISPR-Cas9 genome editing induces megabase-scale chromosomal truncations

    doi: 10.1038/s41467-019-09006-2

    Figure Lengend Snippet: Single nickase-mediated gene editing allows precise genetic and phenotypic correction. a (Left) Scheme of gene editing approach to modify the c.217 C HEK clone and turn it into genetically and phenotypically corrected HEK using nickase and a 181nt-ssODN carrying the c.217 T correcting mutation (called 181nt-ssODN-c.217 T). (Right) Detailed view of the c.217 C HEK clone containing c.217 C mutation (red) and SacI restriction site (blue). Nickase-mediated HDR design using a c.217C- SacI -specific sgRNA and a 181nt-ssODN-c.217 T carrying the c.217 T correcting mutation (grey) in addition to silent SacI restriction site (blue). Expected cleavage position using nickase is indicated with a red arrow. b – d (From left to right) Illustrative FACS (fluorescent activating cell sorting)results for fluorocyte analysis (PE-Cy5A-positive), representative RFLP analysis, sequence spanning UROS exon 4 c.217 position obtained by Sanger sequencing and indels and HDR quantification by TIDER analysis, ( b ) for the c.217 C HEK clone, ( c ) for cells transfected with nickase and 181nt-ssODN-c.217 T (Mix corrected HEK population), and ( d ) for PE-Cy5A-negative HEK293T cells sorted by FACS (called Sorted corrected HEK population). Loq: limit of quantification. e UROS functionality assays with (Left) quantification of UROS-specific activity ( n = 3) and (Right) fluorocytes frequencies from the c.217 C HEK clone, corrected HEK population and sorted corrected HEK population ( n ≥ 3). Values for UROS-specific activity are normalized with WT HEK. Results are presented as mean ± SEM. Data are from independent experiments. Statistical significance is inferred on raw data using two-tailed unpaired t-test for UROS-specific activity and paired one-way ANOVA for fluorocyte frequencies; ** p

    Article Snippet: PCR products were purified with Nucleospin® Gel and PCR Clean-up (Macherey-Nagel) and digested with SacI (or ApaI for exon 10 UROS analysis) restriction enzyme (New England Biolabs, Ipswich, MA, USA) for 1 h at 37 °C.

    Techniques: Mutagenesis, FACS, Sequencing, Transfection, Activity Assay, Two Tailed Test

    UROS gene editing strategy and workflow analysis. a Experimental workflow for UROS gene editing and analysis of outcomes. Cells were nucleofected with the 181nt-ssODN template and either with nuclease or nickase followed by puromycin-positive selection. Then, (i) UROS locus was characterized by RFLP to quantify HDR and by TIDER or deep sequencing to evaluate indels and to confirm HDR percentage; (ii) UROS functionality was assessed by quantifying UROS-specific activity and type-I porphyrin accumulation, respectively determined by HPLC and flow cytometry; (iii) Chromosomal integrity was tested for Chr10 loss or Chr10q terminal deletion either by DNA-FISH assay or array-CGH. b (Top) Schematic UROS locus in chromosome 10 with UROS gene overview (middle). (Bottom) Detailed view of exon 4 region and CRISPR-mediated HDR design using a c.217T-targeting sgRNA (highlighted in orange) with adjacent PAM and an 181nt-ssODN carrying a silent SacI restriction site (highlighted in blue) close to c.217 T position. Red arrows indicate expected cleavage site using nuclease. Chr chromosome, CGH comparative genomic hybridization, D day, e exon, HDR homology-directed repair, HPLC high performance liquid chromatography, NGS (next-generation sequencing), RFLP (restriction fragment length polymorphism), PAM protospacer adjacent motif, sgRNA single guide RNA, TIDER (tracking of insertions, deletions and recombination events)

    Journal: Nature Communications

    Article Title: CRISPR-Cas9 genome editing induces megabase-scale chromosomal truncations

    doi: 10.1038/s41467-019-09006-2

    Figure Lengend Snippet: UROS gene editing strategy and workflow analysis. a Experimental workflow for UROS gene editing and analysis of outcomes. Cells were nucleofected with the 181nt-ssODN template and either with nuclease or nickase followed by puromycin-positive selection. Then, (i) UROS locus was characterized by RFLP to quantify HDR and by TIDER or deep sequencing to evaluate indels and to confirm HDR percentage; (ii) UROS functionality was assessed by quantifying UROS-specific activity and type-I porphyrin accumulation, respectively determined by HPLC and flow cytometry; (iii) Chromosomal integrity was tested for Chr10 loss or Chr10q terminal deletion either by DNA-FISH assay or array-CGH. b (Top) Schematic UROS locus in chromosome 10 with UROS gene overview (middle). (Bottom) Detailed view of exon 4 region and CRISPR-mediated HDR design using a c.217T-targeting sgRNA (highlighted in orange) with adjacent PAM and an 181nt-ssODN carrying a silent SacI restriction site (highlighted in blue) close to c.217 T position. Red arrows indicate expected cleavage site using nuclease. Chr chromosome, CGH comparative genomic hybridization, D day, e exon, HDR homology-directed repair, HPLC high performance liquid chromatography, NGS (next-generation sequencing), RFLP (restriction fragment length polymorphism), PAM protospacer adjacent motif, sgRNA single guide RNA, TIDER (tracking of insertions, deletions and recombination events)

    Article Snippet: PCR products were purified with Nucleospin® Gel and PCR Clean-up (Macherey-Nagel) and digested with SacI (or ApaI for exon 10 UROS analysis) restriction enzyme (New England Biolabs, Ipswich, MA, USA) for 1 h at 37 °C.

    Techniques: Selection, Sequencing, Activity Assay, High Performance Liquid Chromatography, Flow Cytometry, Cytometry, Fluorescence In Situ Hybridization, CRISPR, Hybridization, Next-Generation Sequencing

    Nuclease-mediated HDR is associated with predominant indels leading to impaired UROS functionality. a (Left) Scheme of SacI -digested PCR products obtained for alleles with or without HDR. (Center) Illustrative RFLP analysis of non-transfected HEK293T cells (NT) or transfected with nuclease only or co-delivered with the 181nt-ssODN template. (Right) HDR frequency induced by nuclease and a 181nt-ssODN ( n = 5). b (Left) NGS analysis of allelic outcomes and associated HDR/indel ratio following transfection of HEK293T cells with nuclease and 181nt-ssODN. (Center) Frequencies of reads carrying either insertion or deletion. Region spanning sgRNA sequence is highlighted in grey. (Right) Most common observed alleles (with frequencies ≥ 1%) aligned on the sgRNA sequence. HDR modification in blue and indels in red. c (Left) Quantification of UROS-specific activity from HEK293T cells NT or transfected with nuclease and 181nt-ssODN ( n = 3). Values are normalized with NT cells. (Right) Fluorocyte frequencies and illustrative flow cytometry results from NT or HEK293T cells transfected with nuclease and a 181nt-ssODN ( n = 5). Blue and red dots (and associated percentages) depict non-fluorescent cells and fluorocytes, respectively, with type-I porphyrin accumulation. Results are presented as mean ± SEM. The data are from independent experiments. Statistical significance is inferred on raw data using two-tailed unpaired t test for UROS-specific activity. *** p

    Journal: Nature Communications

    Article Title: CRISPR-Cas9 genome editing induces megabase-scale chromosomal truncations

    doi: 10.1038/s41467-019-09006-2

    Figure Lengend Snippet: Nuclease-mediated HDR is associated with predominant indels leading to impaired UROS functionality. a (Left) Scheme of SacI -digested PCR products obtained for alleles with or without HDR. (Center) Illustrative RFLP analysis of non-transfected HEK293T cells (NT) or transfected with nuclease only or co-delivered with the 181nt-ssODN template. (Right) HDR frequency induced by nuclease and a 181nt-ssODN ( n = 5). b (Left) NGS analysis of allelic outcomes and associated HDR/indel ratio following transfection of HEK293T cells with nuclease and 181nt-ssODN. (Center) Frequencies of reads carrying either insertion or deletion. Region spanning sgRNA sequence is highlighted in grey. (Right) Most common observed alleles (with frequencies ≥ 1%) aligned on the sgRNA sequence. HDR modification in blue and indels in red. c (Left) Quantification of UROS-specific activity from HEK293T cells NT or transfected with nuclease and 181nt-ssODN ( n = 3). Values are normalized with NT cells. (Right) Fluorocyte frequencies and illustrative flow cytometry results from NT or HEK293T cells transfected with nuclease and a 181nt-ssODN ( n = 5). Blue and red dots (and associated percentages) depict non-fluorescent cells and fluorocytes, respectively, with type-I porphyrin accumulation. Results are presented as mean ± SEM. The data are from independent experiments. Statistical significance is inferred on raw data using two-tailed unpaired t test for UROS-specific activity. *** p

    Article Snippet: PCR products were purified with Nucleospin® Gel and PCR Clean-up (Macherey-Nagel) and digested with SacI (or ApaI for exon 10 UROS analysis) restriction enzyme (New England Biolabs, Ipswich, MA, USA) for 1 h at 37 °C.

    Techniques: Polymerase Chain Reaction, Transfection, Next-Generation Sequencing, Sequencing, Modification, Activity Assay, Flow Cytometry, Cytometry, Two Tailed Test

    Restriction analysis of pKBuS13 separation on 0.8% agarose gel electrophoresis of pKBuS13 extracted from the E. coli JM101 recipient and digested with BamHI (lane B), HindIII (lane H), SacI (lane S), and PstI (lane P). Lane M, GeneRuler 1-kb DNA ladder (Thermo Scientific).

    Journal: Antimicrobial Agents and Chemotherapy

    Article Title: pKBuS13, a KPC-2-Encoding Plasmid from Klebsiella pneumoniae Sequence Type 833, Carrying Tn4401b Inserted into an Xer Site-Specific Recombination Locus

    doi: 10.1128/AAC.04543-14

    Figure Lengend Snippet: Restriction analysis of pKBuS13 separation on 0.8% agarose gel electrophoresis of pKBuS13 extracted from the E. coli JM101 recipient and digested with BamHI (lane B), HindIII (lane H), SacI (lane S), and PstI (lane P). Lane M, GeneRuler 1-kb DNA ladder (Thermo Scientific).

    Article Snippet: Plasmid restriction analysis was carried on with BamHI, HindIII, PstI, and SacI restriction enzymes according to the manufacturer's instructions (New England BioLabs, Mississauga, Ontario, Canada) followed by separation on 0.8% agarose gel.

    Techniques: Agarose Gel Electrophoresis

    Figure 4. In vivo assembly of synthetic genes by IVOE. Each overlapping region allowed crossover events to occur between fragments giving rise to an autonomously repaired vector containing single and double expression cassettes in the correct orientation. ( A ) and ( B ) Single expression cassettes are constructed in pESC by engineering specific primers containing overhangs to foster in vivo cloning with the linearized plasmid in yeast (pJRoC30 was used as template for Vp or Lac amplifications). ( C ) and ( D ) The pESC constructs obtained in ( A ) and ( B ) were used as scaffolds to assemble Lac and Vp genes under the control of different promoter/terminator pairs. Primers used: (1)-MCS1- Vp / Lac -α-BamHI, (2)-MCS2- Vp -ter-NheI, (3)-MCS2- Lac -ter-NheI, (4)-MCS1- Vp / Lac -α-SpeI, (5)-MCS1- Lac -ter-SacI and (6)-MCS1- Vp -ter-SacI. Black arrows indicate the direction of the transcription process.

    Journal: Bioengineered

    Article Title: Assembly of evolved ligninolytic genes in Saccharomyces cerevisiae

    doi: 10.4161/bioe.29167

    Figure Lengend Snippet: Figure 4. In vivo assembly of synthetic genes by IVOE. Each overlapping region allowed crossover events to occur between fragments giving rise to an autonomously repaired vector containing single and double expression cassettes in the correct orientation. ( A ) and ( B ) Single expression cassettes are constructed in pESC by engineering specific primers containing overhangs to foster in vivo cloning with the linearized plasmid in yeast (pJRoC30 was used as template for Vp or Lac amplifications). ( C ) and ( D ) The pESC constructs obtained in ( A ) and ( B ) were used as scaffolds to assemble Lac and Vp genes under the control of different promoter/terminator pairs. Primers used: (1)-MCS1- Vp / Lac -α-BamHI, (2)-MCS2- Vp -ter-NheI, (3)-MCS2- Lac -ter-NheI, (4)-MCS1- Vp / Lac -α-SpeI, (5)-MCS1- Lac -ter-SacI and (6)-MCS1- Vp -ter-SacI. Black arrows indicate the direction of the transcription process.

    Article Snippet: The ura3 -deficient S. cerevisiae strain BJ5465 ( α ura3–52 trp1 leu2Δ1 his3Δ200 pep4::HIS2 prb1Δ1.6R can1 GAL1 ) was obtained from LGCPromochem, the NucleoSpin Plasmid kit was purchased from Macherey-Nagel, and the restriction enzymes BamHI, NheI, SpeI, SacI, and NotI from New England Biolabs.

    Techniques: In Vivo, Plasmid Preparation, Expressing, Construct, Clone Assay

    HR repair of I‐SceI induced DSB s decreases with age. DSB repair is measured by I‐SceI induced DSB s using the DR ‐ white reporter. (A) The DR ‐ white assay contains two nonfunctional direct repeats of the white gene. The first repeat, Sce.white , is nonfunctional due to the insertion of an I‐SceI recognition sequence into the wild‐type white cDNA . This results in a premature STOP codon. The second repeat, iwhite , is nonfunctional due to 5′ and 3′ truncations, but contains wild‐type white sequence, including a SacI cut site, at the location correspondent to the I‐SceI site in Sce.white . DR ‐ white flies are crossed with flies containing the I ‐ SceI transgene, which results in DSB formation at the I‐SceI recognition sequence. Repair by HR results in restoration of the wild‐type sequence and a red‐eyed fly ( y + w + ) in the progeny. (B) HR repair resulting in gene conversion of the wild‐type SacI sequence can be confirmed molecularly. Sce.white gene is amplified using primers indicated in (A) (gray arrows), followed by digestion of PCR product with SacI or I‐SceI. I‐SceI cleaves only intact Sce.white sequence. SacI cleaves only HR products. (C‐D) Flies containing the DR ‐ white chromosome and the hs‐I‐SceI transgene were heat‐shocked at the indicated ages. Testes were dissected at given time point and stained for γH2Av foci. (C) IF analysis shows more γH2Av foci in spermatogonia of 29‐d.o. flies compared to 1‐d.o. flies, at 24 h after heat shock. Scale bars = 5 μm. (D) Quantification of γH2Av focus number in spermatogonia fixed prior to and at different time points after heat shock shows higher number of γH2Av foci (top) and higher frequency of cells with one or more foci (bottom) in 8‐ and 29‐d.o. flies relative to 1‐d.o. flies, at 24 h after heat shock. Error bars: SEM; * P

    Journal: Aging Cell

    Article Title: Aging impairs double‐strand break repair by homologous recombination in Drosophila germ cells

    doi: 10.1111/acel.12556

    Figure Lengend Snippet: HR repair of I‐SceI induced DSB s decreases with age. DSB repair is measured by I‐SceI induced DSB s using the DR ‐ white reporter. (A) The DR ‐ white assay contains two nonfunctional direct repeats of the white gene. The first repeat, Sce.white , is nonfunctional due to the insertion of an I‐SceI recognition sequence into the wild‐type white cDNA . This results in a premature STOP codon. The second repeat, iwhite , is nonfunctional due to 5′ and 3′ truncations, but contains wild‐type white sequence, including a SacI cut site, at the location correspondent to the I‐SceI site in Sce.white . DR ‐ white flies are crossed with flies containing the I ‐ SceI transgene, which results in DSB formation at the I‐SceI recognition sequence. Repair by HR results in restoration of the wild‐type sequence and a red‐eyed fly ( y + w + ) in the progeny. (B) HR repair resulting in gene conversion of the wild‐type SacI sequence can be confirmed molecularly. Sce.white gene is amplified using primers indicated in (A) (gray arrows), followed by digestion of PCR product with SacI or I‐SceI. I‐SceI cleaves only intact Sce.white sequence. SacI cleaves only HR products. (C‐D) Flies containing the DR ‐ white chromosome and the hs‐I‐SceI transgene were heat‐shocked at the indicated ages. Testes were dissected at given time point and stained for γH2Av foci. (C) IF analysis shows more γH2Av foci in spermatogonia of 29‐d.o. flies compared to 1‐d.o. flies, at 24 h after heat shock. Scale bars = 5 μm. (D) Quantification of γH2Av focus number in spermatogonia fixed prior to and at different time points after heat shock shows higher number of γH2Av foci (top) and higher frequency of cells with one or more foci (bottom) in 8‐ and 29‐d.o. flies relative to 1‐d.o. flies, at 24 h after heat shock. Error bars: SEM; * P

    Article Snippet: For I‐SceI and SacI digests, PCR products were directly digested (New England Biolabs, Ipswich, MA, USA).

    Techniques: Sequencing, Amplification, Polymerase Chain Reaction, Staining