pvuii restriction enzyme  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    PvuII
    Description:
    PvuII 25 000 units
    Catalog Number:
    r0151l
    Price:
    249
    Size:
    25 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs pvuii restriction enzyme
    PvuII
    PvuII 25 000 units
    https://www.bioz.com/result/pvuii restriction enzyme/product/New England Biolabs
    Average 90 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    pvuii restriction enzyme - by Bioz Stars, 2020-04
    90/100 stars

    Images

    1) Product Images from "Nuclear myosin/actin-motored contact between homologous chromosomes is initiated by ATM kinase and homology-directed repair proteins at double-strand DNA breaks to suppress chromosome rearrangements"

    Article Title: Nuclear myosin/actin-motored contact between homologous chromosomes is initiated by ATM kinase and homology-directed repair proteins at double-strand DNA breaks to suppress chromosome rearrangements

    Journal: Oncotarget

    doi: 10.18632/oncotarget.24434

    ATM activity and F-actin polymerization are required for chromosomal stability after induction of DSBs HTori-3 cells were treated for 4 h with ATM kinase inhibitor KU55933 or DNA-PK inhibitor NU7441 immediately after electroporation with PvuII restriction endonuclease. (A) Graph showing the effect of ATM and DNA-PK inhibition on the formation of RET/PTC rearrangements in HTori-3 cells with and without PvuII-induced DNA DSBs. (B) Graph showing that F-actin polymerization deficiency after introduction of G13R-mutated actin increased the frequency of RET/PTC rearrangements in HTori-3 cells treated with PvuII endonuclease. Data are presented as means with 95%CI; * , P
    Figure Legend Snippet: ATM activity and F-actin polymerization are required for chromosomal stability after induction of DSBs HTori-3 cells were treated for 4 h with ATM kinase inhibitor KU55933 or DNA-PK inhibitor NU7441 immediately after electroporation with PvuII restriction endonuclease. (A) Graph showing the effect of ATM and DNA-PK inhibition on the formation of RET/PTC rearrangements in HTori-3 cells with and without PvuII-induced DNA DSBs. (B) Graph showing that F-actin polymerization deficiency after introduction of G13R-mutated actin increased the frequency of RET/PTC rearrangements in HTori-3 cells treated with PvuII endonuclease. Data are presented as means with 95%CI; * , P

    Techniques Used: Activity Assay, Electroporation, Inhibition

    2) Product Images from "Genomic Sequencing of High-Efficiency Transducing Streptococcal Bacteriophage A25: Consequences of Escape from Lysogeny"

    Article Title: Genomic Sequencing of High-Efficiency Transducing Streptococcal Bacteriophage A25: Consequences of Escape from Lysogeny

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.00358-18

    (A) Phage A25 is predicted to use pac -type DNA packaging. Phylogenetic tree construction of the terminase large subunit following Clustal alignment to bacteriophages with known packaging mechanisms and infecting Gram-positive bacteria predicts that A25 employs pac -type DNA packaging. The shaded region indicates the location of A25 within the group. A25 was found to group with pac -type packaging bacteriophages and was phylogenetically separate from cos -type packaging bacteriophages. (B) The presence of submolar digest fragments confirms pac -type packaging mechanism in A25. A frequent consequence of pac ). A25 genomic DNA was digested with PvuII, and the fragments were separated by reversed-field gel electrophoresis. The digestion products predicted by the genome sequence are indicated by the arrows on the right. Asterisks indicate the presence of submolar digestion fragments; these regions are associated with the region of the genome that would be expected to contain the pac sequence. Molecular weight markers in kilobases are shown on the left.
    Figure Legend Snippet: (A) Phage A25 is predicted to use pac -type DNA packaging. Phylogenetic tree construction of the terminase large subunit following Clustal alignment to bacteriophages with known packaging mechanisms and infecting Gram-positive bacteria predicts that A25 employs pac -type DNA packaging. The shaded region indicates the location of A25 within the group. A25 was found to group with pac -type packaging bacteriophages and was phylogenetically separate from cos -type packaging bacteriophages. (B) The presence of submolar digest fragments confirms pac -type packaging mechanism in A25. A frequent consequence of pac ). A25 genomic DNA was digested with PvuII, and the fragments were separated by reversed-field gel electrophoresis. The digestion products predicted by the genome sequence are indicated by the arrows on the right. Asterisks indicate the presence of submolar digestion fragments; these regions are associated with the region of the genome that would be expected to contain the pac sequence. Molecular weight markers in kilobases are shown on the left.

    Techniques Used: Nucleic Acid Electrophoresis, Sequencing, Molecular Weight

    3) Product Images from "RNase H1 Regulates Mitochondrial Transcription and Translation via the Degradation of 7S RNA"

    Article Title: RNase H1 Regulates Mitochondrial Transcription and Translation via the Degradation of 7S RNA

    Journal: Frontiers in Genetics

    doi: 10.3389/fgene.2019.01393

    Mitochondrial DNA maintenance in mutant RNASEH1 fibroblasts. (A) Southern blot of total DNA digested with Pvu II from control (C1 and C2) and patient (P) fibroblasts grown in either glucose- or galactose-containing medium. A radioactive probe against mtDNA was used to detect both linearized mtDNA (empty arrowhead) and 7S DNA (filled arrowhead and bracket), while a probe against 18S rDNA was used as loading control. (B) Relative mitochondrial DNA copy number in control (C1 and C2) and patient (P) fibroblasts grown in either glucose- or galactose-containing medium, calculated as the linearized mtDNA/18S rDNA signal ratio. Data are shown as mean ± SD, n = 4, ***p
    Figure Legend Snippet: Mitochondrial DNA maintenance in mutant RNASEH1 fibroblasts. (A) Southern blot of total DNA digested with Pvu II from control (C1 and C2) and patient (P) fibroblasts grown in either glucose- or galactose-containing medium. A radioactive probe against mtDNA was used to detect both linearized mtDNA (empty arrowhead) and 7S DNA (filled arrowhead and bracket), while a probe against 18S rDNA was used as loading control. (B) Relative mitochondrial DNA copy number in control (C1 and C2) and patient (P) fibroblasts grown in either glucose- or galactose-containing medium, calculated as the linearized mtDNA/18S rDNA signal ratio. Data are shown as mean ± SD, n = 4, ***p

    Techniques Used: Mutagenesis, Southern Blot

    4) Product Images from "Nuclear myosin/actin-motored contact between homologous chromosomes is initiated by ATM kinase and homology-directed repair proteins at double-strand DNA breaks to suppress chromosome rearrangements"

    Article Title: Nuclear myosin/actin-motored contact between homologous chromosomes is initiated by ATM kinase and homology-directed repair proteins at double-strand DNA breaks to suppress chromosome rearrangements

    Journal: Oncotarget

    doi: 10.18632/oncotarget.24434

    ATM activity and F-actin polymerization are required for chromosomal stability after induction of DSBs HTori-3 cells were treated for 4 h with ATM kinase inhibitor KU55933 or DNA-PK inhibitor NU7441 immediately after electroporation with PvuII restriction endonuclease. (A) Graph showing the effect of ATM and DNA-PK inhibition on the formation of RET/PTC rearrangements in HTori-3 cells with and without PvuII-induced DNA DSBs. (B) Graph showing that F-actin polymerization deficiency after introduction of G13R-mutated actin increased the frequency of RET/PTC rearrangements in HTori-3 cells treated with PvuII endonuclease. Data are presented as means with 95%CI; * , P
    Figure Legend Snippet: ATM activity and F-actin polymerization are required for chromosomal stability after induction of DSBs HTori-3 cells were treated for 4 h with ATM kinase inhibitor KU55933 or DNA-PK inhibitor NU7441 immediately after electroporation with PvuII restriction endonuclease. (A) Graph showing the effect of ATM and DNA-PK inhibition on the formation of RET/PTC rearrangements in HTori-3 cells with and without PvuII-induced DNA DSBs. (B) Graph showing that F-actin polymerization deficiency after introduction of G13R-mutated actin increased the frequency of RET/PTC rearrangements in HTori-3 cells treated with PvuII endonuclease. Data are presented as means with 95%CI; * , P

    Techniques Used: Activity Assay, Electroporation, Inhibition

    Related Articles

    Clone Assay:

    Article Title: Sequence and Structural Elements at the 3? Terminus of Bovine Viral Diarrhea Virus Genomic RNA: Functional Role during RNA Replication
    Article Snippet: By cutting with Pst I- Sca I, the mutations were next inserted into a second cloning intermediate (pCAS) previously created by cloning the 1,220-bp Cla I- Sma I fragment ( Cla I at position 11061 of BVDV CP7) of pA/BVDV/D9 into pBluescript KS. .. All mutations were confirmed by dideoxy sequencing. pΔPvu is a pBluescript KS derivative which was originated from pPS: pPS was cut with Kpn I (pBluescript MCS) and Pvu II (position 12070 of BVDV CP7) and both sites were blunted with T4 DNA polymerase (NEB) and religated.

    Article Title: Defining characteristics of Tn5 Transposase non-specific DNA binding
    Article Snippet: Following digestion with EcoRI, EZ::Tn < KAN-2 > was cloned into EcoRI digested pUC19 to create pWSR6092. .. To create linear fragments of differing sizes containing a single Tnp recognition ES, pWSR6103 was digested with PflMI and either XmnI, AatII, NdeI, NarI, BglI or PvuII (all NEB).

    Centrifugation:

    Article Title: The Transcriptional Enhancer of the Pea Plastocyanin Gene Associates with the Nuclear Matrix and Regulates Gene Expression through Histone Acetylation
    Article Snippet: Nuclear matrices were collected by centrifugation, and both the supernatant and pellet fractions were treated with proteinase K at 1 mg/mL in 1% SDS at 65°C for 1 h. DNA was extracted from the pellet and supernatant fractions by phenol/chloroform extraction and ethanol precipitation. .. After six washes with buffer D (20 mM Tris-HCl, pH 8.0, 70 mM NaCl, 20 mM KCl, 10 mM MgCl2 , 0.125 mM spermidine, 0.05 mM spermine, and 0.1% digitonin), the matrices were suspended in 500 μL of buffer D, and 200 units of PvuII, MfeI, and SacI (New England Biolabs, Beverly, MA) were added.

    Article Title: Negative Regulation of the Androgen Receptor Gene Through a Primate-Specific Androgen Response Element Present in the 5′ UTR
    Article Snippet: .. Chromatin and plasmid were digested with 400 units each PvuII (NEB) and NheI (Roche) for 15 min at 37 °C; followed by lysis and the removal of insoluble debris by centrifugation. .. The supernatant was diluted in ChIP buffer and precleared using Protein G and Protein A Dynabeads (Life Technologies).

    Amplification:

    Article Title: Somatic GNAS Mutation Causes Widespread and Diffuse Pituitary Disease in Acromegalic Patients with McCune-Albright Syndrome
    Article Snippet: .. After amplification, the PCR product was incubated with Nla III or Pvu II (New England Biolabs, Inc., Beverly, MA) at 37 C. The full digest volume was loaded on a 2% Tris-borate EDTA agarose gel prestained with ethidium bromide, and bands were visualized by UV transillumination and photodocumented. .. Electron microscopy The tissues were submitted in 2.5% glutaraldehyde (4 C) and postfixed in 0.5% phosphate-buffered osmium tetroxide.

    Article Title: Seasonal variation of bacterial endophytes in urban trees
    Article Snippet: Paragraph title: Enzymatic digestion, DGGE, PCR amplification, and T-RFLP analysis ... Using the previously extracted DNA from A. negundo, U. parvifolia , and U. pumila from Summer 2012, DNA from each sample was digested with the Pvu II and Msc I (NEB Canada).

    Article Title: Defining characteristics of Tn5 Transposase non-specific DNA binding
    Article Snippet: First, the EZ::Tn < KAN-2 > transposon (Epicentre) was PCR amplified to add EcoRI restriction sites at each end. .. To create linear fragments of differing sizes containing a single Tnp recognition ES, pWSR6103 was digested with PflMI and either XmnI, AatII, NdeI, NarI, BglI or PvuII (all NEB).

    DNA Ligation:

    Article Title: Alternative divalent cations (Zn2+, Co2+, and Mn2+) are not mutagenic at conditions optimal for HIV-1 reverse transcriptase activity
    Article Snippet: Materials Calf intestinal alkaline phosphatase (CIP), T3 RNA polymerase, “High Fidelity” (PvuII and EcoRI) and other restriction enzymes, T4 polynt kinase (PNK), and MuLV RT were from New England Biolabs. .. Rapid DNA ligation kit, RNasin (RNase inhibitor), and the phiX174 HinfI digest DNA ladder was from Promega.

    Terminal Restriction Fragment Length Polymorphism:

    Article Title: Seasonal variation of bacterial endophytes in urban trees
    Article Snippet: Paragraph title: Enzymatic digestion, DGGE, PCR amplification, and T-RFLP analysis ... Using the previously extracted DNA from A. negundo, U. parvifolia , and U. pumila from Summer 2012, DNA from each sample was digested with the Pvu II and Msc I (NEB Canada).

    Real-time Polymerase Chain Reaction:

    Article Title: Practical utilization of recombinant AAV vector reference standards: focus on vector genomes titration by free ITR qPCR
    Article Snippet: For the SV40 polyA qPCR assay, a linearized pTR-UF11 plasmid (ATCC, MBA- 331) was used to generate a standard curve. .. For the preparation of the linearized plasmids, psub201 was digested with either HindIII or PvuII (New England BioLabs, Ipswich, MA) under the conditions determined by the manufacturer.

    Incubation:

    Article Title: Cleavage of a model DNA replication fork by a methyl-specific endonuclease
    Article Snippet: The pME63 was linearized with PvuII (New England Biolabs) [see (iii) below]. .. The resulting short-DNA strands were dissociated by incubation at 78°C for 10 min and 37°C for 10 min in the presence of the complementary single-strand oligonucleotide gap1-cis-C [for (vi) below] or gap1 [for (iv) below] as described before ( ).

    Article Title: Somatic GNAS Mutation Causes Widespread and Diffuse Pituitary Disease in Acromegalic Patients with McCune-Albright Syndrome
    Article Snippet: .. After amplification, the PCR product was incubated with Nla III or Pvu II (New England Biolabs, Inc., Beverly, MA) at 37 C. The full digest volume was loaded on a 2% Tris-borate EDTA agarose gel prestained with ethidium bromide, and bands were visualized by UV transillumination and photodocumented. .. Electron microscopy The tissues were submitted in 2.5% glutaraldehyde (4 C) and postfixed in 0.5% phosphate-buffered osmium tetroxide.

    Article Title: Updated molecular epidemiology of carbapenem-non-susceptible Escherichia coli in Taiwan: first identification of KPC-2 or NDM-1-producing E. coli in Taiwan
    Article Snippet: The recipients and bla NDM-1 -carrrying donor samples were separately inoculated into brain-heart infusion broth and incubated at 37°C for 4 h. The samples were then mixed at a ratio of 10:1 (Donor:Recipient, by volume) for overnight incubation at 37°C. .. The plasmids were extracted from these transconjugants using the standard alkaline lysis method, and fingerprints of the plasmids were generated by digestion with Hinc II or Pvu II (New England Biolabs, Beverly, MA).

    Article Title: The Transcriptional Enhancer of the Pea Plastocyanin Gene Associates with the Nuclear Matrix and Regulates Gene Expression through Histone Acetylation
    Article Snippet: After six washes with buffer D (20 mM Tris-HCl, pH 8.0, 70 mM NaCl, 20 mM KCl, 10 mM MgCl2 , 0.125 mM spermidine, 0.05 mM spermine, and 0.1% digitonin), the matrices were suspended in 500 μL of buffer D, and 200 units of PvuII, MfeI, and SacI (New England Biolabs, Beverly, MA) were added. .. After 2 h, 200 units more of each enzyme was added, and the digestion mixture was incubated at 37°C for another 2 h. A 200-μL aliquot was removed as a total DNA sample.

    Article Title: Negative Regulation of the Androgen Receptor Gene Through a Primate-Specific Androgen Response Element Present in the 5′ UTR
    Article Snippet: Chromatin and plasmid were digested with 400 units each PvuII (NEB) and NheI (Roche) for 15 min at 37 °C; followed by lysis and the removal of insoluble debris by centrifugation. .. Samples of cleared lysates were retained as input (IP), and the remainder was incubated with either anti-hAR antibody (PG21, 06-680 Millipore) or IgG.

    Mass Spectrometry:

    Article Title: Genomic Sequencing of High-Efficiency Transducing Streptococcal Bacteriophage A25: Consequences of Escape from Lysogeny
    Article Snippet: One microgram of purified A25 DNA was digested with excess restriction endonuclease PvuII (20 units; New England BioLabs Inc., Ipswich, MA) to ensure complete digestion. .. For band separation, the following conditions of pulsed-field electrophoresis were used: forward pulse, 66 ms; reverse pulse, 22 ms; 3/h ramp with 150 V, using a 0.8% agarose gel in 0.5× Tris-borate-EDTA (TBE) for 5 h. The gel was stained for 1 h in ethidium bromide prior to imaging.

    Modification:

    Article Title: Cleavage of a model DNA replication fork by a methyl-specific endonuclease
    Article Snippet: To eliminate potential unmethylated plasmid molecules, the plasmid preparations were treated with BstUI (New England Biolabs), which recognizes the same sequence as M.FnuDII but cannot cleave DNAs modified by M.FnuDII [see (i), (ii) below]. .. The pME63 was linearized with PvuII (New England Biolabs) [see (iii) below].

    Article Title: Seasonal variation of bacterial endophytes in urban trees
    Article Snippet: Using the previously extracted DNA from A. negundo, U. parvifolia , and U. pumila from Summer 2012, DNA from each sample was digested with the Pvu II and Msc I (NEB Canada). .. The gel-purified products were used as templates for the following PCR reaction using primers341F-GC (5′- CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCTACGGGAGGCAGCAG-3′) and MOD783R (equimolar concentrations of primer 783RA and primer 783RC- a modification of primers by Sakai et al., ).

    Conjugation Assay:

    Article Title: Updated molecular epidemiology of carbapenem-non-susceptible Escherichia coli in Taiwan: first identification of KPC-2 or NDM-1-producing E. coli in Taiwan
    Article Snippet: Transfer of bla NDM-1 and plasmid DNA analysis Plasmid conjugation was performed using E. coli J53 AzR as the recipient strain. .. The plasmids were extracted from these transconjugants using the standard alkaline lysis method, and fingerprints of the plasmids were generated by digestion with Hinc II or Pvu II (New England Biolabs, Beverly, MA).

    Transfection:

    Article Title: Negative Regulation of the Androgen Receptor Gene Through a Primate-Specific Androgen Response Element Present in the 5′ UTR
    Article Snippet: In brief, LNCaP cells were transfected with either phAR1.6Luc or phAR1.6Luc-AREm and later treated with either 10 nM DHT or vehicle for 4 h. Cells were fixed in 1 % formaldehyde for 10 min at 37 °C, and nuclei were prepared. .. Chromatin and plasmid were digested with 400 units each PvuII (NEB) and NheI (Roche) for 15 min at 37 °C; followed by lysis and the removal of insoluble debris by centrifugation.

    Denaturing Gradient Gel Electrophoresis:

    Article Title: Seasonal variation of bacterial endophytes in urban trees
    Article Snippet: Paragraph title: Enzymatic digestion, DGGE, PCR amplification, and T-RFLP analysis ... Using the previously extracted DNA from A. negundo, U. parvifolia , and U. pumila from Summer 2012, DNA from each sample was digested with the Pvu II and Msc I (NEB Canada).

    Generated:

    Article Title: Updated molecular epidemiology of carbapenem-non-susceptible Escherichia coli in Taiwan: first identification of KPC-2 or NDM-1-producing E. coli in Taiwan
    Article Snippet: .. The plasmids were extracted from these transconjugants using the standard alkaline lysis method, and fingerprints of the plasmids were generated by digestion with Hinc II or Pvu II (New England Biolabs, Beverly, MA). .. Pulsed-field gel electrophoresis (PFGE) Total DNA was prepared, and PFGE was performed as described [ ].

    Imaging:

    Article Title: Genomic Sequencing of High-Efficiency Transducing Streptococcal Bacteriophage A25: Consequences of Escape from Lysogeny
    Article Snippet: One microgram of purified A25 DNA was digested with excess restriction endonuclease PvuII (20 units; New England BioLabs Inc., Ipswich, MA) to ensure complete digestion. .. For band separation, the following conditions of pulsed-field electrophoresis were used: forward pulse, 66 ms; reverse pulse, 22 ms; 3/h ramp with 150 V, using a 0.8% agarose gel in 0.5× Tris-borate-EDTA (TBE) for 5 h. The gel was stained for 1 h in ethidium bromide prior to imaging.

    Polymerase Chain Reaction:

    Article Title: Somatic GNAS Mutation Causes Widespread and Diffuse Pituitary Disease in Acromegalic Patients with McCune-Albright Syndrome
    Article Snippet: .. After amplification, the PCR product was incubated with Nla III or Pvu II (New England Biolabs, Inc., Beverly, MA) at 37 C. The full digest volume was loaded on a 2% Tris-borate EDTA agarose gel prestained with ethidium bromide, and bands were visualized by UV transillumination and photodocumented. .. Electron microscopy The tissues were submitted in 2.5% glutaraldehyde (4 C) and postfixed in 0.5% phosphate-buffered osmium tetroxide.

    Article Title: Seasonal variation of bacterial endophytes in urban trees
    Article Snippet: Paragraph title: Enzymatic digestion, DGGE, PCR amplification, and T-RFLP analysis ... Using the previously extracted DNA from A. negundo, U. parvifolia , and U. pumila from Summer 2012, DNA from each sample was digested with the Pvu II and Msc I (NEB Canada).

    Article Title: Sequence and Structural Elements at the 3? Terminus of Bovine Viral Diarrhea Virus Genomic RNA: Functional Role during RNA Replication
    Article Snippet: PCR products were gel purified, digested with Pst I- Aat II (position 12241 of BVDV CP7) (primers 1 to 8 and 10) or Pst I- Sma I (primers 9*, 11*, and 12 to 15), and cloned between the corresponding restriction sites of subclone pPS. .. All mutations were confirmed by dideoxy sequencing. pΔPvu is a pBluescript KS derivative which was originated from pPS: pPS was cut with Kpn I (pBluescript MCS) and Pvu II (position 12070 of BVDV CP7) and both sites were blunted with T4 DNA polymerase (NEB) and religated.

    Article Title: Defining characteristics of Tn5 Transposase non-specific DNA binding
    Article Snippet: First, the EZ::Tn < KAN-2 > transposon (Epicentre) was PCR amplified to add EcoRI restriction sites at each end. .. To create linear fragments of differing sizes containing a single Tnp recognition ES, pWSR6103 was digested with PflMI and either XmnI, AatII, NdeI, NarI, BglI or PvuII (all NEB).

    Article Title: Practical utilization of recombinant AAV vector reference standards: focus on vector genomes titration by free ITR qPCR
    Article Snippet: For the preparation of the linearized plasmids, psub201 was digested with either HindIII or PvuII (New England BioLabs, Ipswich, MA) under the conditions determined by the manufacturer. .. The linearized plasmid DNAs were then purified using a plasmid purification kit (QIAquick PCR purification kit, Qiagen, Hilden, Germany) and the concentration of each linearized plasmid was determined using a nanophotometer (Implen, München, Germany).

    Binding Assay:

    Article Title: Seasonal variation of bacterial endophytes in urban trees
    Article Snippet: Based on the fact that chloroplast 16S rRNA sequences have a Pvu II restriction site downstream of the binding site of 27F primer and a Msc I restriction site upstream of the binding site of 1492R primer, predigesting genomic DNA with those restriction enzymes should inhibit the amplification of plastid products from 27F to 1492R, allowing only the amplification of bacterial 16S rRNA and its subsequent analysis by molecular methods. .. Using the previously extracted DNA from A. negundo, U. parvifolia , and U. pumila from Summer 2012, DNA from each sample was digested with the Pvu II and Msc I (NEB Canada).

    Immunofluorescence:

    Article Title: Nuclear myosin/actin-motored contact between homologous chromosomes is initiated by ATM kinase and homology-directed repair proteins at double-strand DNA breaks to suppress chromosome rearrangements
    Article Snippet: For each experiment 2×106 of HTori-3 cells were electroporated with 25U of PvuII restriction enzyme (New England Bio Labs, Ipswick, MA, USA) at 50 mC charge (400 V and 125 mF) using Gene Pulser Xcell Electroporator (Bio-Rad) as previously described [ ]. .. DSB induction was monitored by γH2AX immunofluorescence staining at 4 h post-electroporation.

    Cleavage Assay:

    Article Title: Cleavage of a model DNA replication fork by a methyl-specific endonuclease
    Article Snippet: Forked DNA with methylation The substrates for the cleavage assay were prepared by annealing two DNA fragments with complementary single-strand regions as previously reported ( ) with some modifications (see below). .. The pME63 was linearized with PvuII (New England Biolabs) [see (iii) below].

    In Vivo:

    Article Title: Cleavage of a model DNA replication fork by a methyl-specific endonuclease
    Article Snippet: The two starting plasmids, pME63 and pMap63, were methylated in vivo by propagating in bacterial cells (DH5alpha_Mcr) carrying a plasmid (pKI2) producing M.FnuDII. .. The pME63 was linearized with PvuII (New England Biolabs) [see (iii) below].

    Methylation:

    Article Title: Cleavage of a model DNA replication fork by a methyl-specific endonuclease
    Article Snippet: The two starting plasmids, pME63 and pMap63, were methylated in vivo by propagating in bacterial cells (DH5alpha_Mcr) carrying a plasmid (pKI2) producing M.FnuDII. .. The pME63 was linearized with PvuII (New England Biolabs) [see (iii) below].

    Mutagenesis:

    Article Title: Somatic GNAS Mutation Causes Widespread and Diffuse Pituitary Disease in Acromegalic Patients with McCune-Albright Syndrome
    Article Snippet: Paragraph title: Microdissection and mutation analysis ... After amplification, the PCR product was incubated with Nla III or Pvu II (New England Biolabs, Inc., Beverly, MA) at 37 C. The full digest volume was loaded on a 2% Tris-borate EDTA agarose gel prestained with ethidium bromide, and bands were visualized by UV transillumination and photodocumented.

    Isolation:

    Article Title: The Transcriptional Enhancer of the Pea Plastocyanin Gene Associates with the Nuclear Matrix and Regulates Gene Expression through Histone Acetylation
    Article Snippet: Nuclei were isolated from 10 g of tobacco leaf tissues as described previously and suspended in 10 mL of NSB. .. After six washes with buffer D (20 mM Tris-HCl, pH 8.0, 70 mM NaCl, 20 mM KCl, 10 mM MgCl2 , 0.125 mM spermidine, 0.05 mM spermine, and 0.1% digitonin), the matrices were suspended in 500 μL of buffer D, and 200 units of PvuII, MfeI, and SacI (New England Biolabs, Beverly, MA) were added.

    Article Title: Practical utilization of recombinant AAV vector reference standards: focus on vector genomes titration by free ITR qPCR
    Article Snippet: The concentration of the isolated plasmid DNA was determined by A260 using a nanophotometer (Implen, München, Germany). .. For the preparation of the linearized plasmids, psub201 was digested with either HindIII or PvuII (New England BioLabs, Ipswich, MA) under the conditions determined by the manufacturer.

    Labeling:

    Article Title: Cleavage of a model DNA replication fork by a methyl-specific endonuclease
    Article Snippet: The pME63 was linearized with PvuII (New England Biolabs) [see (iii) below]. .. The 5′-ends of intermediate (iv) were labeled with [γ-32 P]ATP (Perkin Elmer) and T4 polynucleotide kinase (TaKaRa) (v), followed by cleavage with BspHI (New England Biolabs) and recovery of the left half for removal of one of the end labels (vii).

    Purification:

    Article Title: Seasonal variation of bacterial endophytes in urban trees
    Article Snippet: Using the previously extracted DNA from A. negundo, U. parvifolia , and U. pumila from Summer 2012, DNA from each sample was digested with the Pvu II and Msc I (NEB Canada). .. The PCR products were visualized in 1.5% agarose gels and bands of 1500 bp in size were excised and gel purified with QIAEX II Gel Extraction Kits (Qiagen, Canada).

    Article Title: Sequence and Structural Elements at the 3? Terminus of Bovine Viral Diarrhea Virus Genomic RNA: Functional Role during RNA Replication
    Article Snippet: PCR products were gel purified, digested with Pst I- Aat II (position 12241 of BVDV CP7) (primers 1 to 8 and 10) or Pst I- Sma I (primers 9*, 11*, and 12 to 15), and cloned between the corresponding restriction sites of subclone pPS. .. All mutations were confirmed by dideoxy sequencing. pΔPvu is a pBluescript KS derivative which was originated from pPS: pPS was cut with Kpn I (pBluescript MCS) and Pvu II (position 12070 of BVDV CP7) and both sites were blunted with T4 DNA polymerase (NEB) and religated.

    Article Title: Practical utilization of recombinant AAV vector reference standards: focus on vector genomes titration by free ITR qPCR
    Article Snippet: For the preparation of the linearized plasmids, psub201 was digested with either HindIII or PvuII (New England BioLabs, Ipswich, MA) under the conditions determined by the manufacturer. .. The linearized plasmid DNAs were then purified using a plasmid purification kit (QIAquick PCR purification kit, Qiagen, Hilden, Germany) and the concentration of each linearized plasmid was determined using a nanophotometer (Implen, München, Germany).

    Article Title: Genomic Sequencing of High-Efficiency Transducing Streptococcal Bacteriophage A25: Consequences of Escape from Lysogeny
    Article Snippet: .. One microgram of purified A25 DNA was digested with excess restriction endonuclease PvuII (20 units; New England BioLabs Inc., Ipswich, MA) to ensure complete digestion. ..

    Sequencing:

    Article Title: Cleavage of a model DNA replication fork by a methyl-specific endonuclease
    Article Snippet: To eliminate potential unmethylated plasmid molecules, the plasmid preparations were treated with BstUI (New England Biolabs), which recognizes the same sequence as M.FnuDII but cannot cleave DNAs modified by M.FnuDII [see (i), (ii) below]. .. The pME63 was linearized with PvuII (New England Biolabs) [see (iii) below].

    Article Title: Sequence and Structural Elements at the 3? Terminus of Bovine Viral Diarrhea Virus Genomic RNA: Functional Role during RNA Replication
    Article Snippet: .. All mutations were confirmed by dideoxy sequencing. pΔPvu is a pBluescript KS derivative which was originated from pPS: pPS was cut with Kpn I (pBluescript MCS) and Pvu II (position 12070 of BVDV CP7) and both sites were blunted with T4 DNA polymerase (NEB) and religated. .. To generate in vitro transcripts for determination of the RNA secondary structure by enzymatic probing, pΔPvu was linearized with Sma I (Fig. ) (see below).

    Article Title: Defining characteristics of Tn5 Transposase non-specific DNA binding
    Article Snippet: One Tnp recognition end sequence (ES) was then removed from this plasmid by digesting pWSR6092 with XhoI (Promega) and XmaI (NEB) and filling in the sticky ends of the 4096 bp fragment using Klenow fragment (Promega) and dNTPs (Pharmacia). .. To create linear fragments of differing sizes containing a single Tnp recognition ES, pWSR6103 was digested with PflMI and either XmnI, AatII, NdeI, NarI, BglI or PvuII (all NEB).

    Construct:

    Article Title: Sequence and Structural Elements at the 3? Terminus of Bovine Viral Diarrhea Virus Genomic RNA: Functional Role during RNA Replication
    Article Snippet: Finally, either the Cla I- Aat II (mutations 1 to 8 and 10) or the Cla I- Sma I (mutations 9 and 11 to 15) fragment of the respective pCAS construct was introduced into the pA/BVDV/D9 plasmid cut with the corresponding enzymes. .. All mutations were confirmed by dideoxy sequencing. pΔPvu is a pBluescript KS derivative which was originated from pPS: pPS was cut with Kpn I (pBluescript MCS) and Pvu II (position 12070 of BVDV CP7) and both sites were blunted with T4 DNA polymerase (NEB) and religated.

    Lysis:

    Article Title: Negative Regulation of the Androgen Receptor Gene Through a Primate-Specific Androgen Response Element Present in the 5′ UTR
    Article Snippet: .. Chromatin and plasmid were digested with 400 units each PvuII (NEB) and NheI (Roche) for 15 min at 37 °C; followed by lysis and the removal of insoluble debris by centrifugation. .. The supernatant was diluted in ChIP buffer and precleared using Protein G and Protein A Dynabeads (Life Technologies).

    Chromatin Immunoprecipitation:

    Article Title: Negative Regulation of the Androgen Receptor Gene Through a Primate-Specific Androgen Response Element Present in the 5′ UTR
    Article Snippet: Paragraph title: Chromatin Immunoprecipitation Assay ... Chromatin and plasmid were digested with 400 units each PvuII (NEB) and NheI (Roche) for 15 min at 37 °C; followed by lysis and the removal of insoluble debris by centrifugation.

    Plasmid Preparation:

    Article Title: Cleavage of a model DNA replication fork by a methyl-specific endonuclease
    Article Snippet: To eliminate potential unmethylated plasmid molecules, the plasmid preparations were treated with BstUI (New England Biolabs), which recognizes the same sequence as M.FnuDII but cannot cleave DNAs modified by M.FnuDII [see (i), (ii) below]. .. The pME63 was linearized with PvuII (New England Biolabs) [see (iii) below].

    Article Title: Updated molecular epidemiology of carbapenem-non-susceptible Escherichia coli in Taiwan: first identification of KPC-2 or NDM-1-producing E. coli in Taiwan
    Article Snippet: Paragraph title: Transfer of bla NDM-1 and plasmid DNA analysis ... The plasmids were extracted from these transconjugants using the standard alkaline lysis method, and fingerprints of the plasmids were generated by digestion with Hinc II or Pvu II (New England Biolabs, Beverly, MA).

    Article Title: Sequence and Structural Elements at the 3? Terminus of Bovine Viral Diarrhea Virus Genomic RNA: Functional Role during RNA Replication
    Article Snippet: Finally, either the Cla I- Aat II (mutations 1 to 8 and 10) or the Cla I- Sma I (mutations 9 and 11 to 15) fragment of the respective pCAS construct was introduced into the pA/BVDV/D9 plasmid cut with the corresponding enzymes. .. All mutations were confirmed by dideoxy sequencing. pΔPvu is a pBluescript KS derivative which was originated from pPS: pPS was cut with Kpn I (pBluescript MCS) and Pvu II (position 12070 of BVDV CP7) and both sites were blunted with T4 DNA polymerase (NEB) and religated.

    Article Title: Defining characteristics of Tn5 Transposase non-specific DNA binding
    Article Snippet: One Tnp recognition end sequence (ES) was then removed from this plasmid by digesting pWSR6092 with XhoI (Promega) and XmaI (NEB) and filling in the sticky ends of the 4096 bp fragment using Klenow fragment (Promega) and dNTPs (Pharmacia). .. To create linear fragments of differing sizes containing a single Tnp recognition ES, pWSR6103 was digested with PflMI and either XmnI, AatII, NdeI, NarI, BglI or PvuII (all NEB).

    Article Title: Practical utilization of recombinant AAV vector reference standards: focus on vector genomes titration by free ITR qPCR
    Article Snippet: The concentration of the isolated plasmid DNA was determined by A260 using a nanophotometer (Implen, München, Germany). .. For the preparation of the linearized plasmids, psub201 was digested with either HindIII or PvuII (New England BioLabs, Ipswich, MA) under the conditions determined by the manufacturer.

    Article Title: Negative Regulation of the Androgen Receptor Gene Through a Primate-Specific Androgen Response Element Present in the 5′ UTR
    Article Snippet: .. Chromatin and plasmid were digested with 400 units each PvuII (NEB) and NheI (Roche) for 15 min at 37 °C; followed by lysis and the removal of insoluble debris by centrifugation. .. The supernatant was diluted in ChIP buffer and precleared using Protein G and Protein A Dynabeads (Life Technologies).

    Electrophoresis:

    Article Title: Genomic Sequencing of High-Efficiency Transducing Streptococcal Bacteriophage A25: Consequences of Escape from Lysogeny
    Article Snippet: One microgram of purified A25 DNA was digested with excess restriction endonuclease PvuII (20 units; New England BioLabs Inc., Ipswich, MA) to ensure complete digestion. .. For band separation, the following conditions of pulsed-field electrophoresis were used: forward pulse, 66 ms; reverse pulse, 22 ms; 3/h ramp with 150 V, using a 0.8% agarose gel in 0.5× Tris-borate-EDTA (TBE) for 5 h. The gel was stained for 1 h in ethidium bromide prior to imaging.

    Recombinant:

    Article Title: Sequence and Structural Elements at the 3? Terminus of Bovine Viral Diarrhea Virus Genomic RNA: Functional Role during RNA Replication
    Article Snippet: Paragraph title: Construction of recombinant plasmids. ... All mutations were confirmed by dideoxy sequencing. pΔPvu is a pBluescript KS derivative which was originated from pPS: pPS was cut with Kpn I (pBluescript MCS) and Pvu II (position 12070 of BVDV CP7) and both sites were blunted with T4 DNA polymerase (NEB) and religated.

    Agarose Gel Electrophoresis:

    Article Title: Somatic GNAS Mutation Causes Widespread and Diffuse Pituitary Disease in Acromegalic Patients with McCune-Albright Syndrome
    Article Snippet: .. After amplification, the PCR product was incubated with Nla III or Pvu II (New England Biolabs, Inc., Beverly, MA) at 37 C. The full digest volume was loaded on a 2% Tris-borate EDTA agarose gel prestained with ethidium bromide, and bands were visualized by UV transillumination and photodocumented. .. Electron microscopy The tissues were submitted in 2.5% glutaraldehyde (4 C) and postfixed in 0.5% phosphate-buffered osmium tetroxide.

    Article Title: The Transcriptional Enhancer of the Pea Plastocyanin Gene Associates with the Nuclear Matrix and Regulates Gene Expression through Histone Acetylation
    Article Snippet: The DNA was separated on a 1% agarose gel, which was fixed in 7% trichloroacetic acid for 30 min, dried, and autoradiographed. .. After six washes with buffer D (20 mM Tris-HCl, pH 8.0, 70 mM NaCl, 20 mM KCl, 10 mM MgCl2 , 0.125 mM spermidine, 0.05 mM spermine, and 0.1% digitonin), the matrices were suspended in 500 μL of buffer D, and 200 units of PvuII, MfeI, and SacI (New England Biolabs, Beverly, MA) were added.

    Article Title: Defining characteristics of Tn5 Transposase non-specific DNA binding
    Article Snippet: To create linear fragments of differing sizes containing a single Tnp recognition ES, pWSR6103 was digested with PflMI and either XmnI, AatII, NdeI, NarI, BglI or PvuII (all NEB). .. The restriction enzymes were removed from the reaction using a PCR cleanup kit (Qiagen) and the DNA was quantitated both spectroscopically and by agarose gel electrophoresis.

    Article Title: Practical utilization of recombinant AAV vector reference standards: focus on vector genomes titration by free ITR qPCR
    Article Snippet: For the preparation of the linearized plasmids, psub201 was digested with either HindIII or PvuII (New England BioLabs, Ipswich, MA) under the conditions determined by the manufacturer. .. One hundred ng of each supercoiled and linearized plasmids were analyzed on a 1% native agarose gel alongside a 2-log DNA ladder and supercoiled ladder (New England BioLabs Cat N3200S and N0472S, Ipswich, MA) to confirm complete digestion and purity, and to confirm concentration.

    Article Title: Genomic Sequencing of High-Efficiency Transducing Streptococcal Bacteriophage A25: Consequences of Escape from Lysogeny
    Article Snippet: One microgram of purified A25 DNA was digested with excess restriction endonuclease PvuII (20 units; New England BioLabs Inc., Ipswich, MA) to ensure complete digestion. .. For band separation, the following conditions of pulsed-field electrophoresis were used: forward pulse, 66 ms; reverse pulse, 22 ms; 3/h ramp with 150 V, using a 0.8% agarose gel in 0.5× Tris-borate-EDTA (TBE) for 5 h. The gel was stained for 1 h in ethidium bromide prior to imaging.

    In Vitro:

    Article Title: Sequence and Structural Elements at the 3? Terminus of Bovine Viral Diarrhea Virus Genomic RNA: Functional Role during RNA Replication
    Article Snippet: All mutations were confirmed by dideoxy sequencing. pΔPvu is a pBluescript KS derivative which was originated from pPS: pPS was cut with Kpn I (pBluescript MCS) and Pvu II (position 12070 of BVDV CP7) and both sites were blunted with T4 DNA polymerase (NEB) and religated. .. To generate in vitro transcripts for determination of the RNA secondary structure by enzymatic probing, pΔPvu was linearized with Sma I (Fig. ) (see below).

    Article Title: Defining characteristics of Tn5 Transposase non-specific DNA binding
    Article Snippet: Paragraph title: Single-end substrate in vitro reactions ... To create linear fragments of differing sizes containing a single Tnp recognition ES, pWSR6103 was digested with PflMI and either XmnI, AatII, NdeI, NarI, BglI or PvuII (all NEB).

    Staining:

    Article Title: Nuclear myosin/actin-motored contact between homologous chromosomes is initiated by ATM kinase and homology-directed repair proteins at double-strand DNA breaks to suppress chromosome rearrangements
    Article Snippet: For each experiment 2×106 of HTori-3 cells were electroporated with 25U of PvuII restriction enzyme (New England Bio Labs, Ipswick, MA, USA) at 50 mC charge (400 V and 125 mF) using Gene Pulser Xcell Electroporator (Bio-Rad) as previously described [ ]. .. DSB induction was monitored by γH2AX immunofluorescence staining at 4 h post-electroporation.

    Article Title: Genomic Sequencing of High-Efficiency Transducing Streptococcal Bacteriophage A25: Consequences of Escape from Lysogeny
    Article Snippet: One microgram of purified A25 DNA was digested with excess restriction endonuclease PvuII (20 units; New England BioLabs Inc., Ipswich, MA) to ensure complete digestion. .. For band separation, the following conditions of pulsed-field electrophoresis were used: forward pulse, 66 ms; reverse pulse, 22 ms; 3/h ramp with 150 V, using a 0.8% agarose gel in 0.5× Tris-borate-EDTA (TBE) for 5 h. The gel was stained for 1 h in ethidium bromide prior to imaging.

    Ethanol Precipitation:

    Article Title: The Transcriptional Enhancer of the Pea Plastocyanin Gene Associates with the Nuclear Matrix and Regulates Gene Expression through Histone Acetylation
    Article Snippet: Nuclear matrices were collected by centrifugation, and both the supernatant and pellet fractions were treated with proteinase K at 1 mg/mL in 1% SDS at 65°C for 1 h. DNA was extracted from the pellet and supernatant fractions by phenol/chloroform extraction and ethanol precipitation. .. After six washes with buffer D (20 mM Tris-HCl, pH 8.0, 70 mM NaCl, 20 mM KCl, 10 mM MgCl2 , 0.125 mM spermidine, 0.05 mM spermine, and 0.1% digitonin), the matrices were suspended in 500 μL of buffer D, and 200 units of PvuII, MfeI, and SacI (New England Biolabs, Beverly, MA) were added.

    Laser Capture Microdissection:

    Article Title: Somatic GNAS Mutation Causes Widespread and Diffuse Pituitary Disease in Acromegalic Patients with McCune-Albright Syndrome
    Article Snippet: Paragraph title: Microdissection and mutation analysis ... After amplification, the PCR product was incubated with Nla III or Pvu II (New England Biolabs, Inc., Beverly, MA) at 37 C. The full digest volume was loaded on a 2% Tris-borate EDTA agarose gel prestained with ethidium bromide, and bands were visualized by UV transillumination and photodocumented.

    DNA Methylation Assay:

    Article Title: Cleavage of a model DNA replication fork by a methyl-specific endonuclease
    Article Snippet: Paragraph title: Forked DNA with methylation ... The pME63 was linearized with PvuII (New England Biolabs) [see (iii) below].

    Concentration Assay:

    Article Title: Practical utilization of recombinant AAV vector reference standards: focus on vector genomes titration by free ITR qPCR
    Article Snippet: The concentration of the isolated plasmid DNA was determined by A260 using a nanophotometer (Implen, München, Germany). .. For the preparation of the linearized plasmids, psub201 was digested with either HindIII or PvuII (New England BioLabs, Ipswich, MA) under the conditions determined by the manufacturer.

    Alkaline Lysis:

    Article Title: Updated molecular epidemiology of carbapenem-non-susceptible Escherichia coli in Taiwan: first identification of KPC-2 or NDM-1-producing E. coli in Taiwan
    Article Snippet: .. The plasmids were extracted from these transconjugants using the standard alkaline lysis method, and fingerprints of the plasmids were generated by digestion with Hinc II or Pvu II (New England Biolabs, Beverly, MA). .. Pulsed-field gel electrophoresis (PFGE) Total DNA was prepared, and PFGE was performed as described [ ].

    Gel Extraction:

    Article Title: Seasonal variation of bacterial endophytes in urban trees
    Article Snippet: Using the previously extracted DNA from A. negundo, U. parvifolia , and U. pumila from Summer 2012, DNA from each sample was digested with the Pvu II and Msc I (NEB Canada). .. The PCR products were visualized in 1.5% agarose gels and bands of 1500 bp in size were excised and gel purified with QIAEX II Gel Extraction Kits (Qiagen, Canada).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs pvuii restriction enzyme
    ATM activity and F-actin polymerization are required for chromosomal stability after induction of DSBs <t>HTori-3</t> cells were treated for 4 h with ATM kinase inhibitor KU55933 or DNA-PK inhibitor NU7441 immediately after electroporation with <t>PvuII</t> restriction endonuclease. (A) Graph showing the effect of ATM and DNA-PK inhibition on the formation of RET/PTC rearrangements in HTori-3 cells with and without PvuII-induced DNA DSBs. (B) Graph showing that F-actin polymerization deficiency after introduction of G13R-mutated actin increased the frequency of RET/PTC rearrangements in HTori-3 cells treated with PvuII endonuclease. Data are presented as means with 95%CI; * , P
    Pvuii Restriction Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pvuii restriction enzyme/product/New England Biolabs
    Average 90 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    pvuii restriction enzyme - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    Image Search Results


    ATM activity and F-actin polymerization are required for chromosomal stability after induction of DSBs HTori-3 cells were treated for 4 h with ATM kinase inhibitor KU55933 or DNA-PK inhibitor NU7441 immediately after electroporation with PvuII restriction endonuclease. (A) Graph showing the effect of ATM and DNA-PK inhibition on the formation of RET/PTC rearrangements in HTori-3 cells with and without PvuII-induced DNA DSBs. (B) Graph showing that F-actin polymerization deficiency after introduction of G13R-mutated actin increased the frequency of RET/PTC rearrangements in HTori-3 cells treated with PvuII endonuclease. Data are presented as means with 95%CI; * , P

    Journal: Oncotarget

    Article Title: Nuclear myosin/actin-motored contact between homologous chromosomes is initiated by ATM kinase and homology-directed repair proteins at double-strand DNA breaks to suppress chromosome rearrangements

    doi: 10.18632/oncotarget.24434

    Figure Lengend Snippet: ATM activity and F-actin polymerization are required for chromosomal stability after induction of DSBs HTori-3 cells were treated for 4 h with ATM kinase inhibitor KU55933 or DNA-PK inhibitor NU7441 immediately after electroporation with PvuII restriction endonuclease. (A) Graph showing the effect of ATM and DNA-PK inhibition on the formation of RET/PTC rearrangements in HTori-3 cells with and without PvuII-induced DNA DSBs. (B) Graph showing that F-actin polymerization deficiency after introduction of G13R-mutated actin increased the frequency of RET/PTC rearrangements in HTori-3 cells treated with PvuII endonuclease. Data are presented as means with 95%CI; * , P

    Article Snippet: For each experiment 2×106 of HTori-3 cells were electroporated with 25U of PvuII restriction enzyme (New England Bio Labs, Ipswick, MA, USA) at 50 mC charge (400 V and 125 mF) using Gene Pulser Xcell Electroporator (Bio-Rad) as previously described [ ].

    Techniques: Activity Assay, Electroporation, Inhibition

    (A) Phage A25 is predicted to use pac -type DNA packaging. Phylogenetic tree construction of the terminase large subunit following Clustal alignment to bacteriophages with known packaging mechanisms and infecting Gram-positive bacteria predicts that A25 employs pac -type DNA packaging. The shaded region indicates the location of A25 within the group. A25 was found to group with pac -type packaging bacteriophages and was phylogenetically separate from cos -type packaging bacteriophages. (B) The presence of submolar digest fragments confirms pac -type packaging mechanism in A25. A frequent consequence of pac ). A25 genomic DNA was digested with PvuII, and the fragments were separated by reversed-field gel electrophoresis. The digestion products predicted by the genome sequence are indicated by the arrows on the right. Asterisks indicate the presence of submolar digestion fragments; these regions are associated with the region of the genome that would be expected to contain the pac sequence. Molecular weight markers in kilobases are shown on the left.

    Journal: Journal of Bacteriology

    Article Title: Genomic Sequencing of High-Efficiency Transducing Streptococcal Bacteriophage A25: Consequences of Escape from Lysogeny

    doi: 10.1128/JB.00358-18

    Figure Lengend Snippet: (A) Phage A25 is predicted to use pac -type DNA packaging. Phylogenetic tree construction of the terminase large subunit following Clustal alignment to bacteriophages with known packaging mechanisms and infecting Gram-positive bacteria predicts that A25 employs pac -type DNA packaging. The shaded region indicates the location of A25 within the group. A25 was found to group with pac -type packaging bacteriophages and was phylogenetically separate from cos -type packaging bacteriophages. (B) The presence of submolar digest fragments confirms pac -type packaging mechanism in A25. A frequent consequence of pac ). A25 genomic DNA was digested with PvuII, and the fragments were separated by reversed-field gel electrophoresis. The digestion products predicted by the genome sequence are indicated by the arrows on the right. Asterisks indicate the presence of submolar digestion fragments; these regions are associated with the region of the genome that would be expected to contain the pac sequence. Molecular weight markers in kilobases are shown on the left.

    Article Snippet: One microgram of purified A25 DNA was digested with excess restriction endonuclease PvuII (20 units; New England BioLabs Inc., Ipswich, MA) to ensure complete digestion.

    Techniques: Nucleic Acid Electrophoresis, Sequencing, Molecular Weight

    Mitochondrial DNA maintenance in mutant RNASEH1 fibroblasts. (A) Southern blot of total DNA digested with Pvu II from control (C1 and C2) and patient (P) fibroblasts grown in either glucose- or galactose-containing medium. A radioactive probe against mtDNA was used to detect both linearized mtDNA (empty arrowhead) and 7S DNA (filled arrowhead and bracket), while a probe against 18S rDNA was used as loading control. (B) Relative mitochondrial DNA copy number in control (C1 and C2) and patient (P) fibroblasts grown in either glucose- or galactose-containing medium, calculated as the linearized mtDNA/18S rDNA signal ratio. Data are shown as mean ± SD, n = 4, ***p

    Journal: Frontiers in Genetics

    Article Title: RNase H1 Regulates Mitochondrial Transcription and Translation via the Degradation of 7S RNA

    doi: 10.3389/fgene.2019.01393

    Figure Lengend Snippet: Mitochondrial DNA maintenance in mutant RNASEH1 fibroblasts. (A) Southern blot of total DNA digested with Pvu II from control (C1 and C2) and patient (P) fibroblasts grown in either glucose- or galactose-containing medium. A radioactive probe against mtDNA was used to detect both linearized mtDNA (empty arrowhead) and 7S DNA (filled arrowhead and bracket), while a probe against 18S rDNA was used as loading control. (B) Relative mitochondrial DNA copy number in control (C1 and C2) and patient (P) fibroblasts grown in either glucose- or galactose-containing medium, calculated as the linearized mtDNA/18S rDNA signal ratio. Data are shown as mean ± SD, n = 4, ***p

    Article Snippet: Total DNA (5 μg) was digested with Pvu II (NEB), and the fragments were resolved in 1% agarose gels.

    Techniques: Mutagenesis, Southern Blot

    ATM activity and F-actin polymerization are required for chromosomal stability after induction of DSBs HTori-3 cells were treated for 4 h with ATM kinase inhibitor KU55933 or DNA-PK inhibitor NU7441 immediately after electroporation with PvuII restriction endonuclease. (A) Graph showing the effect of ATM and DNA-PK inhibition on the formation of RET/PTC rearrangements in HTori-3 cells with and without PvuII-induced DNA DSBs. (B) Graph showing that F-actin polymerization deficiency after introduction of G13R-mutated actin increased the frequency of RET/PTC rearrangements in HTori-3 cells treated with PvuII endonuclease. Data are presented as means with 95%CI; * , P

    Journal: Oncotarget

    Article Title: Nuclear myosin/actin-motored contact between homologous chromosomes is initiated by ATM kinase and homology-directed repair proteins at double-strand DNA breaks to suppress chromosome rearrangements

    doi: 10.18632/oncotarget.24434

    Figure Lengend Snippet: ATM activity and F-actin polymerization are required for chromosomal stability after induction of DSBs HTori-3 cells were treated for 4 h with ATM kinase inhibitor KU55933 or DNA-PK inhibitor NU7441 immediately after electroporation with PvuII restriction endonuclease. (A) Graph showing the effect of ATM and DNA-PK inhibition on the formation of RET/PTC rearrangements in HTori-3 cells with and without PvuII-induced DNA DSBs. (B) Graph showing that F-actin polymerization deficiency after introduction of G13R-mutated actin increased the frequency of RET/PTC rearrangements in HTori-3 cells treated with PvuII endonuclease. Data are presented as means with 95%CI; * , P

    Article Snippet: For each experiment 2×106 of HTori-3 cells were electroporated with 25U of PvuII restriction enzyme (New England Bio Labs, Ipswick, MA, USA) at 50 mC charge (400 V and 125 mF) using Gene Pulser Xcell Electroporator (Bio-Rad) as previously described [ ].

    Techniques: Activity Assay, Electroporation, Inhibition