pcr  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    ScaI HF
    Description:
    ScaI HF 5 000 units
    Catalog Number:
    r3122l
    Price:
    269
    Size:
    5 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs pcr
    ScaI HF
    ScaI HF 5 000 units
    https://www.bioz.com/result/pcr/product/New England Biolabs
    Average 99 stars, based on 12249 article reviews
    Price from $9.99 to $1999.99
    pcr - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: ZO-1 and ZO-2 Are Required for Extra-Embryonic Endoderm Integrity, Primitive Ectoderm Survival and Normal Cavitation in Embryoid Bodies Derived from Mouse Embryonic Stem Cells
    Article Snippet: .. Southern blot analysis Genomic DNA was extracted from G418-resistant ESC clones and completely restriction digested with ScaI-HF (New England BioLabs). .. For the ZO-1 locus, a 554 bp ZO-1 probe, corresponding to the 5′ arm of the targeted allele, was used to detect the 10 kb and 14.8 kb bands from the WT and mutant alleles respectively.

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: Two TOPO clone DNA mixtures were prepared: (i) the four mutant clones were combined at the appropriate ratios to obtain a 10-fold dilution curve and (ii) the mutant mixture described in (i) was diluted into the wild-type background to render a 10−2 total mutant frequency. .. Both mixtures were subjected to double enzymatic digestion using AfeI (New England BioLabs) and ScaI-HF (New England BioLabs) and run on a 1.5% UltraPure Low-Melting Point Agarose (Invitrogen) electrophoresis gel with 1× SYBR Safe (Life Technologies, Grand Island, NY, USA) to separate the TP53 exon 5 insert from the TOPO vector backbone.

    Amplification:

    Article Title: ZO-1 and ZO-2 Are Required for Extra-Embryonic Endoderm Integrity, Primitive Ectoderm Survival and Normal Cavitation in Embryoid Bodies Derived from Mouse Embryonic Stem Cells
    Article Snippet: Southern blot analysis Genomic DNA was extracted from G418-resistant ESC clones and completely restriction digested with ScaI-HF (New England BioLabs). .. These probes were generated from PCR amplification of WT control genomic DNA using the specific primers listed in .

    Construct:

    Article Title: The unstructured linker arms of MutL enable GATC site incision beyond roadblocks during initiation of DNA mismatch repair
    Article Snippet: Paragraph title: DNA constructs for ensemble incision assay ... DNA substrates were linearized by ScaI-HF (New England Biolabs) for 30 min at 37°C followed by heat inactivation for 20 min at 70°C.

    Electrophoresis:

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: .. Both mixtures were subjected to double enzymatic digestion using AfeI (New England BioLabs) and ScaI-HF (New England BioLabs) and run on a 1.5% UltraPure Low-Melting Point Agarose (Invitrogen) electrophoresis gel with 1× SYBR Safe (Life Technologies, Grand Island, NY, USA) to separate the TP53 exon 5 insert from the TOPO vector backbone. .. The appropriate bands corresponding to the TP53 exon 5 insert were excised from the gel and purified using the Zymoclean Gel DNA Recovery kit (Zymo Research) and DNA was quantified via spectrophotometry.

    Incubation:

    Article Title: Ubiquitin Utilizes an Acidic Surface Patch to Alter Chromatin Structure
    Article Snippet: After the addition of MgCl2 , the samples were incubated on ice for 10 min, centrifuged at 17,000×g for 10 min, and the pellet and supernatant were separated. .. Briefly, the equivalent of 1 pmole nucleosomes were digested in 3.75 µL total volume containing 10 U of ScaI-HF (New England BioLabs), 100 mM KCl, 10 mM Tris pH 7.5, 0.5 mM MgCl2 , 1 mM DTT.

    Luciferase:

    Article Title: Biocompatible artificial DNA linker that is read through by DNA polymerases and is functional in Escherichia coli
    Article Snippet: The PCR products were digested with ScaI HF and PvuI restriction endonucleases (NEB, Cat. No. R3122 and R0150) according to the manufacturer’s protocol and was purified using QIAquick PCR purification kit (QIAGEN, Cat. No. 28106). .. The Luciferase T7 control plasmid (Promega, Cat. No. L4821) was also digested with ScaI HF and PvuI, and treated with thermosensitive alkaline phosphatase (Promega, Cat. No. M9910) to remove the 5′-phosphate groups from the linearized plasmid DNA, thus preventing recircularization during ligation.

    Derivative Assay:

    Article Title: The unstructured linker arms of MutL enable GATC site incision beyond roadblocks during initiation of DNA mismatch repair
    Article Snippet: DNA constructs for ensemble incision assay DNA substrates containing a single G/T mismatch or the corresponding A/T Watson Crick base pair were generated by primer extension using a primer containing an Alexa Fluor® 647 (Alexa647 ) fluorophore (IBA GmbH, Göttingen, Germany) on single stranded DNA derived from phagemid GATC2 ( ) produced in E. coli JM109 (to create hemimethylated substrate) or JM110 (to create unmethylated substrate). .. DNA substrates were linearized by ScaI-HF (New England Biolabs) for 30 min at 37°C followed by heat inactivation for 20 min at 70°C.

    Southern Blot:

    Article Title: ZO-1 and ZO-2 Are Required for Extra-Embryonic Endoderm Integrity, Primitive Ectoderm Survival and Normal Cavitation in Embryoid Bodies Derived from Mouse Embryonic Stem Cells
    Article Snippet: .. Southern blot analysis Genomic DNA was extracted from G418-resistant ESC clones and completely restriction digested with ScaI-HF (New England BioLabs). .. For the ZO-1 locus, a 554 bp ZO-1 probe, corresponding to the 5′ arm of the targeted allele, was used to detect the 10 kb and 14.8 kb bands from the WT and mutant alleles respectively.

    Ligation:

    Article Title: Diseases caused by different mutations in the two alleles of a gene are treated in mice by Cas-9-induced allelic exchange.
    Article Snippet: Circularization PCR Liver total DNA (5 micrograms) was digested with SphI-HF (NEB, Cat. No. R3182L) and ScaI-HF (NEB, Cat. No. R3122L) for one hour. .. Ligation product was purified using the QIAquick PCR Purification Kit (Qiagen, Cat. No. 28106), and subjected to PCR with primers DW888 and DW889 ( ) using KOD Hot Start Master Mix (EMD Millipore, Cat. No. 71842-4).

    Article Title: Biocompatible artificial DNA linker that is read through by DNA polymerases and is functional in Escherichia coli
    Article Snippet: The PCR products were digested with ScaI HF and PvuI restriction endonucleases (NEB, Cat. No. R3122 and R0150) according to the manufacturer’s protocol and was purified using QIAquick PCR purification kit (QIAGEN, Cat. No. 28106). .. The Luciferase T7 control plasmid (Promega, Cat. No. L4821) was also digested with ScaI HF and PvuI, and treated with thermosensitive alkaline phosphatase (Promega, Cat. No. M9910) to remove the 5′-phosphate groups from the linearized plasmid DNA, thus preventing recircularization during ligation.

    Generated:

    Article Title: ZO-1 and ZO-2 Are Required for Extra-Embryonic Endoderm Integrity, Primitive Ectoderm Survival and Normal Cavitation in Embryoid Bodies Derived from Mouse Embryonic Stem Cells
    Article Snippet: Southern blot analysis Genomic DNA was extracted from G418-resistant ESC clones and completely restriction digested with ScaI-HF (New England BioLabs). .. These probes were generated from PCR amplification of WT control genomic DNA using the specific primers listed in .

    Article Title: The unstructured linker arms of MutL enable GATC site incision beyond roadblocks during initiation of DNA mismatch repair
    Article Snippet: DNA constructs for ensemble incision assay DNA substrates containing a single G/T mismatch or the corresponding A/T Watson Crick base pair were generated by primer extension using a primer containing an Alexa Fluor® 647 (Alexa647 ) fluorophore (IBA GmbH, Göttingen, Germany) on single stranded DNA derived from phagemid GATC2 ( ) produced in E. coli JM109 (to create hemimethylated substrate) or JM110 (to create unmethylated substrate). .. DNA substrates were linearized by ScaI-HF (New England Biolabs) for 30 min at 37°C followed by heat inactivation for 20 min at 70°C.

    other:

    Article Title: The unstructured linker arms of MutL enable GATC site incision beyond roadblocks during initiation of DNA mismatch repair
    Article Snippet: The fragment indicative for nicking at GATC site 1 was created by digesting GT#1b ( ) for 30 min at 37°C with ScaI-HF followed by 30 min at 60°C with BstYI.

    Article Title: The unstructured linker arms of MutL enable GATC site incision beyond roadblocks during initiation of DNA mismatch repair
    Article Snippet: The fragment indicative for nicking at GATC site 2 was created by digesting GT#2647 using ScaI-HF and BamHI for 30 min at at 37°C.

    Recombination Assay:

    Article Title: Mutants of Cre recombinase with improved accuracy
    Article Snippet: Paragraph title: Bacterial recombination assay ... The purified plasmids were digested for 20 min at 37 °C in 60 μL reactions containing all of the collected DNA and 20 U of both ScaI-HF and NcoI-HF (both from New England Biolabs) in NEBuffer 4 (1 mM DTT, 50 mM potassium acetate, 20 mM tris-acetate, 10 mM magnesium acetate, pH 7.9).

    Sequencing:

    Article Title: Ubiquitin Utilizes an Acidic Surface Patch to Alter Chromatin Structure
    Article Snippet: Since the 601 repeats in the 12mer DNA sequence are separated by ScaI restriction enzyme sites, the full occupancy of the 601 sites and the nucleosome positioning could be assessed by ScaI digestion. .. Briefly, the equivalent of 1 pmole nucleosomes were digested in 3.75 µL total volume containing 10 U of ScaI-HF (New England BioLabs), 100 mM KCl, 10 mM Tris pH 7.5, 0.5 mM MgCl2 , 1 mM DTT.

    Injection:

    Article Title: Highly Efficient, Rapid and Co-CRISPR-Independent Genome Editing in Caenorhabditis elegans
    Article Snippet: PCR and restriction enzyme genotyping Red fluorescent F1 progeny (n = 24 total), from successfully injected P0s, were singled to 35 mM NGM dishes and allowed to lay F2 eggs for 2 d. After egg-laying, individual F1s were placed in 7 μl of PCR lysis buffer (50 mM KCl, 10 mM Tris-HCl pH = 8.3, 2.5 mM MgCl2 , 0.45% NP-40, 0.45% Tween-20) containing 1 mg/ml proteinase K in PCR strip tubes. .. The purified and concentrated PCR products were digested with ScaI-HF (NEB) for 1–2 hr and then loaded and separated on a 1.5% agarose gel.

    Mutagenesis:

    Article Title: ZO-1 and ZO-2 Are Required for Extra-Embryonic Endoderm Integrity, Primitive Ectoderm Survival and Normal Cavitation in Embryoid Bodies Derived from Mouse Embryonic Stem Cells
    Article Snippet: Southern blot analysis Genomic DNA was extracted from G418-resistant ESC clones and completely restriction digested with ScaI-HF (New England BioLabs). .. For the ZO-1 locus, a 554 bp ZO-1 probe, corresponding to the 5′ arm of the targeted allele, was used to detect the 10 kb and 14.8 kb bands from the WT and mutant alleles respectively.

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: Two TOPO clone DNA mixtures were prepared: (i) the four mutant clones were combined at the appropriate ratios to obtain a 10-fold dilution curve and (ii) the mutant mixture described in (i) was diluted into the wild-type background to render a 10−2 total mutant frequency. .. Both mixtures were subjected to double enzymatic digestion using AfeI (New England BioLabs) and ScaI-HF (New England BioLabs) and run on a 1.5% UltraPure Low-Melting Point Agarose (Invitrogen) electrophoresis gel with 1× SYBR Safe (Life Technologies, Grand Island, NY, USA) to separate the TP53 exon 5 insert from the TOPO vector backbone.

    Labeling:

    Article Title: The unstructured linker arms of MutL enable GATC site incision beyond roadblocks during initiation of DNA mismatch repair
    Article Snippet: Primer GT14 [5′P-CCAGACGTCTGTC-g-ACGTTGGGAAGCTT*GAGTATTCTATAGTGTCACCT 3′], where ‘g’ indicates the guanidine forming the mismatch and ‘T*’ is the Alexa647 -labeled nucleotide, was used to construct GT#2647 substrate (two GATC sites 31 bp 5′ and 1042 bp 3′ of the mismatch). .. DNA substrates were linearized by ScaI-HF (New England Biolabs) for 30 min at 37°C followed by heat inactivation for 20 min at 70°C.

    Purification:

    Article Title: Diseases caused by different mutations in the two alleles of a gene are treated in mice by Cas-9-induced allelic exchange.
    Article Snippet: Circularization PCR Liver total DNA (5 micrograms) was digested with SphI-HF (NEB, Cat. No. R3182L) and ScaI-HF (NEB, Cat. No. R3122L) for one hour. .. The resulting DNA fragments were resolved on 0.8% agarose gel, and the DNA from the 3.0-4.0 kbp region was excised from the gel and purified using the QIAquick Gel Extraction Kit (Qiagen, Cat. No. 28706).

    Article Title: Highly Efficient, Rapid and Co-CRISPR-Independent Genome Editing in Caenorhabditis elegans
    Article Snippet: .. The purified and concentrated PCR products were digested with ScaI-HF (NEB) for 1–2 hr and then loaded and separated on a 1.5% agarose gel. .. Molecular biology The transient fluorescent marker plasmid pCFJ90 (a gift from C. Frojkær-Jensen) contains the C. elegans myo-2 promoter, a worm-optimized mCherry fluorophore, and an unc-54 transcriptional terminator sequence that is specifically expressed in pharyngeal muscle.

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: The DNA from the overnight LB cultures was purified using the QIAquick Spin Miniprep Kit (Qiagen). .. Both mixtures were subjected to double enzymatic digestion using AfeI (New England BioLabs) and ScaI-HF (New England BioLabs) and run on a 1.5% UltraPure Low-Melting Point Agarose (Invitrogen) electrophoresis gel with 1× SYBR Safe (Life Technologies, Grand Island, NY, USA) to separate the TP53 exon 5 insert from the TOPO vector backbone.

    Article Title: The unstructured linker arms of MutL enable GATC site incision beyond roadblocks during initiation of DNA mismatch repair
    Article Snippet: Closed circular DNA was purified from gel using the Wizard® SV Gel and PCR Clean-Up System (Promega, Madison, USA). .. DNA substrates were linearized by ScaI-HF (New England Biolabs) for 30 min at 37°C followed by heat inactivation for 20 min at 70°C.

    Article Title: Ubiquitin Utilizes an Acidic Surface Patch to Alter Chromatin Structure
    Article Snippet: After assembly, MMTV nucleosomes and free MMTV DNA were purified from the 12mer nucleosome arrays using selective MgCl2 precipitation (2–3 mM for WT and Ub-H2A arrays, 4–5 mM for Ub-H2B arrays). .. Briefly, the equivalent of 1 pmole nucleosomes were digested in 3.75 µL total volume containing 10 U of ScaI-HF (New England BioLabs), 100 mM KCl, 10 mM Tris pH 7.5, 0.5 mM MgCl2 , 1 mM DTT.

    Article Title: Mutants of Cre recombinase with improved accuracy
    Article Snippet: .. The purified plasmids were digested for 20 min at 37 °C in 60 μL reactions containing all of the collected DNA and 20 U of both ScaI-HF and NcoI-HF (both from New England Biolabs) in NEBuffer 4 (1 mM DTT, 50 mM potassium acetate, 20 mM tris-acetate, 10 mM magnesium acetate, pH 7.9). .. The digests quantified on 1% agarose gels following purification using the QIAprep Spin Miniprep kit.

    Article Title: Biocompatible artificial DNA linker that is read through by DNA polymerases and is functional in Escherichia coli
    Article Snippet: .. The PCR products were digested with ScaI HF and PvuI restriction endonucleases (NEB, Cat. No. R3122 and R0150) according to the manufacturer’s protocol and was purified using QIAquick PCR purification kit (QIAGEN, Cat. No. 28106). .. The Luciferase T7 control plasmid (Promega, Cat. No. L4821) was also digested with ScaI HF and PvuI, and treated with thermosensitive alkaline phosphatase (Promega, Cat. No. M9910) to remove the 5′-phosphate groups from the linearized plasmid DNA, thus preventing recircularization during ligation.

    Polymerase Chain Reaction:

    Article Title: ZO-1 and ZO-2 Are Required for Extra-Embryonic Endoderm Integrity, Primitive Ectoderm Survival and Normal Cavitation in Embryoid Bodies Derived from Mouse Embryonic Stem Cells
    Article Snippet: Southern blot analysis Genomic DNA was extracted from G418-resistant ESC clones and completely restriction digested with ScaI-HF (New England BioLabs). .. These probes were generated from PCR amplification of WT control genomic DNA using the specific primers listed in .

    Article Title: Diseases caused by different mutations in the two alleles of a gene are treated in mice by Cas-9-induced allelic exchange.
    Article Snippet: .. Circularization PCR Liver total DNA (5 micrograms) was digested with SphI-HF (NEB, Cat. No. R3182L) and ScaI-HF (NEB, Cat. No. R3122L) for one hour. .. The resulting DNA fragments were resolved on 0.8% agarose gel, and the DNA from the 3.0-4.0 kbp region was excised from the gel and purified using the QIAquick Gel Extraction Kit (Qiagen, Cat. No. 28706).

    Article Title: Highly Efficient, Rapid and Co-CRISPR-Independent Genome Editing in Caenorhabditis elegans
    Article Snippet: .. The purified and concentrated PCR products were digested with ScaI-HF (NEB) for 1–2 hr and then loaded and separated on a 1.5% agarose gel. .. Molecular biology The transient fluorescent marker plasmid pCFJ90 (a gift from C. Frojkær-Jensen) contains the C. elegans myo-2 promoter, a worm-optimized mCherry fluorophore, and an unc-54 transcriptional terminator sequence that is specifically expressed in pharyngeal muscle.

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: One contained wild-type SKOV-3 TP53 exon 5 DNA (named WT), one contained CaOV3 TP53 exon 5 DNA (406 C > T, named MUT1) and three additional clones (MUT2, MUT3 and MUT4) containing distinct TP53 exon 5 mutations (455 C > T, 394 A > G and 431 A > G, respectively), likely introduced by PCR errors. .. Both mixtures were subjected to double enzymatic digestion using AfeI (New England BioLabs) and ScaI-HF (New England BioLabs) and run on a 1.5% UltraPure Low-Melting Point Agarose (Invitrogen) electrophoresis gel with 1× SYBR Safe (Life Technologies, Grand Island, NY, USA) to separate the TP53 exon 5 insert from the TOPO vector backbone.

    Article Title: The unstructured linker arms of MutL enable GATC site incision beyond roadblocks during initiation of DNA mismatch repair
    Article Snippet: Closed circular DNA was purified from gel using the Wizard® SV Gel and PCR Clean-Up System (Promega, Madison, USA). .. DNA substrates were linearized by ScaI-HF (New England Biolabs) for 30 min at 37°C followed by heat inactivation for 20 min at 70°C.

    Article Title: Biocompatible artificial DNA linker that is read through by DNA polymerases and is functional in Escherichia coli
    Article Snippet: .. The PCR products were digested with ScaI HF and PvuI restriction endonucleases (NEB, Cat. No. R3122 and R0150) according to the manufacturer’s protocol and was purified using QIAquick PCR purification kit (QIAGEN, Cat. No. 28106). .. The Luciferase T7 control plasmid (Promega, Cat. No. L4821) was also digested with ScaI HF and PvuI, and treated with thermosensitive alkaline phosphatase (Promega, Cat. No. M9910) to remove the 5′-phosphate groups from the linearized plasmid DNA, thus preventing recircularization during ligation.

    Staining:

    Article Title: Ubiquitin Utilizes an Acidic Surface Patch to Alter Chromatin Structure
    Article Snippet: The reconstituted arrays were analyzed on native 1% agarose/2% polyacrylamide (APAGE) gels stained with Sybr Gold nucleic acid gel stain (Life Technologies). .. Briefly, the equivalent of 1 pmole nucleosomes were digested in 3.75 µL total volume containing 10 U of ScaI-HF (New England BioLabs), 100 mM KCl, 10 mM Tris pH 7.5, 0.5 mM MgCl2 , 1 mM DTT.

    Plasmid Preparation:

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: .. Both mixtures were subjected to double enzymatic digestion using AfeI (New England BioLabs) and ScaI-HF (New England BioLabs) and run on a 1.5% UltraPure Low-Melting Point Agarose (Invitrogen) electrophoresis gel with 1× SYBR Safe (Life Technologies, Grand Island, NY, USA) to separate the TP53 exon 5 insert from the TOPO vector backbone. .. The appropriate bands corresponding to the TP53 exon 5 insert were excised from the gel and purified using the Zymoclean Gel DNA Recovery kit (Zymo Research) and DNA was quantified via spectrophotometry.

    Article Title: Biocompatible artificial DNA linker that is read through by DNA polymerases and is functional in Escherichia coli
    Article Snippet: Paragraph title: Restriction digestion of PCR product and vector. ... The PCR products were digested with ScaI HF and PvuI restriction endonucleases (NEB, Cat. No. R3122 and R0150) according to the manufacturer’s protocol and was purified using QIAquick PCR purification kit (QIAGEN, Cat. No. 28106).

    Agarose Gel Electrophoresis:

    Article Title: Diseases caused by different mutations in the two alleles of a gene are treated in mice by Cas-9-induced allelic exchange.
    Article Snippet: Circularization PCR Liver total DNA (5 micrograms) was digested with SphI-HF (NEB, Cat. No. R3182L) and ScaI-HF (NEB, Cat. No. R3122L) for one hour. .. The resulting DNA fragments were resolved on 0.8% agarose gel, and the DNA from the 3.0-4.0 kbp region was excised from the gel and purified using the QIAquick Gel Extraction Kit (Qiagen, Cat. No. 28706).

    Article Title: Highly Efficient, Rapid and Co-CRISPR-Independent Genome Editing in Caenorhabditis elegans
    Article Snippet: .. The purified and concentrated PCR products were digested with ScaI-HF (NEB) for 1–2 hr and then loaded and separated on a 1.5% agarose gel. .. Molecular biology The transient fluorescent marker plasmid pCFJ90 (a gift from C. Frojkær-Jensen) contains the C. elegans myo-2 promoter, a worm-optimized mCherry fluorophore, and an unc-54 transcriptional terminator sequence that is specifically expressed in pharyngeal muscle.

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: Both mixtures were subjected to double enzymatic digestion using AfeI (New England BioLabs) and ScaI-HF (New England BioLabs) and run on a 1.5% UltraPure Low-Melting Point Agarose (Invitrogen) electrophoresis gel with 1× SYBR Safe (Life Technologies, Grand Island, NY, USA) to separate the TP53 exon 5 insert from the TOPO vector backbone. .. DNA representing 3.6 million different barcoded CypherSeq vectors (as estimated by bacterial colony counts) containing the N701 Illumina index (hereafter named ‘N701-CypherSeq’) was digested with SmaI (New England BioLabs) and treated with Antarctic phosphatase (New England BioLabs) before electrophoresis on a 1.5% low melting-point agarose gel containing 1× SYBR Safe (Life Technologies).

    Spectrophotometry:

    Article Title: Targeted single molecule mutation detection with massively parallel sequencing
    Article Snippet: Both mixtures were subjected to double enzymatic digestion using AfeI (New England BioLabs) and ScaI-HF (New England BioLabs) and run on a 1.5% UltraPure Low-Melting Point Agarose (Invitrogen) electrophoresis gel with 1× SYBR Safe (Life Technologies, Grand Island, NY, USA) to separate the TP53 exon 5 insert from the TOPO vector backbone. .. The appropriate bands corresponding to the TP53 exon 5 insert were excised from the gel and purified using the Zymoclean Gel DNA Recovery kit (Zymo Research) and DNA was quantified via spectrophotometry.

    Produced:

    Article Title: The unstructured linker arms of MutL enable GATC site incision beyond roadblocks during initiation of DNA mismatch repair
    Article Snippet: DNA constructs for ensemble incision assay DNA substrates containing a single G/T mismatch or the corresponding A/T Watson Crick base pair were generated by primer extension using a primer containing an Alexa Fluor® 647 (Alexa647 ) fluorophore (IBA GmbH, Göttingen, Germany) on single stranded DNA derived from phagemid GATC2 ( ) produced in E. coli JM109 (to create hemimethylated substrate) or JM110 (to create unmethylated substrate). .. DNA substrates were linearized by ScaI-HF (New England Biolabs) for 30 min at 37°C followed by heat inactivation for 20 min at 70°C.

    Stripping Membranes:

    Article Title: Highly Efficient, Rapid and Co-CRISPR-Independent Genome Editing in Caenorhabditis elegans
    Article Snippet: PCR and restriction enzyme genotyping Red fluorescent F1 progeny (n = 24 total), from successfully injected P0s, were singled to 35 mM NGM dishes and allowed to lay F2 eggs for 2 d. After egg-laying, individual F1s were placed in 7 μl of PCR lysis buffer (50 mM KCl, 10 mM Tris-HCl pH = 8.3, 2.5 mM MgCl2 , 0.45% NP-40, 0.45% Tween-20) containing 1 mg/ml proteinase K in PCR strip tubes. .. The purified and concentrated PCR products were digested with ScaI-HF (NEB) for 1–2 hr and then loaded and separated on a 1.5% agarose gel.

    Lysis:

    Article Title: Highly Efficient, Rapid and Co-CRISPR-Independent Genome Editing in Caenorhabditis elegans
    Article Snippet: PCR and restriction enzyme genotyping Red fluorescent F1 progeny (n = 24 total), from successfully injected P0s, were singled to 35 mM NGM dishes and allowed to lay F2 eggs for 2 d. After egg-laying, individual F1s were placed in 7 μl of PCR lysis buffer (50 mM KCl, 10 mM Tris-HCl pH = 8.3, 2.5 mM MgCl2 , 0.45% NP-40, 0.45% Tween-20) containing 1 mg/ml proteinase K in PCR strip tubes. .. The purified and concentrated PCR products were digested with ScaI-HF (NEB) for 1–2 hr and then loaded and separated on a 1.5% agarose gel.

    Marker:

    Article Title: The unstructured linker arms of MutL enable GATC site incision beyond roadblocks during initiation of DNA mismatch repair
    Article Snippet: DNA substrates were linearized by ScaI-HF (New England Biolabs) for 30 min at 37°C followed by heat inactivation for 20 min at 70°C. .. Marker was created as follows: GT#2647 substrate was linearized with ScaI-HF to create the full-length linear fragment.

    Article Title: The unstructured linker arms of MutL enable GATC site incision beyond roadblocks during initiation of DNA mismatch repair
    Article Snippet: .. Marker was created as follows: GT#2647 substrate was linearized with ScaI-HF to create the full-length linear fragment. .. The fragment indicative for nicking at GATC site 1 was created by digesting GT#1b ( ) for 30 min at 37°C with ScaI-HF followed by 30 min at 60°C with BstYI.

    Gel Extraction:

    Article Title: Diseases caused by different mutations in the two alleles of a gene are treated in mice by Cas-9-induced allelic exchange.
    Article Snippet: Circularization PCR Liver total DNA (5 micrograms) was digested with SphI-HF (NEB, Cat. No. R3182L) and ScaI-HF (NEB, Cat. No. R3122L) for one hour. .. The resulting DNA fragments were resolved on 0.8% agarose gel, and the DNA from the 3.0-4.0 kbp region was excised from the gel and purified using the QIAquick Gel Extraction Kit (Qiagen, Cat. No. 28706).

    Article Title: Biocompatible artificial DNA linker that is read through by DNA polymerases and is functional in Escherichia coli
    Article Snippet: The PCR products were digested with ScaI HF and PvuI restriction endonucleases (NEB, Cat. No. R3122 and R0150) according to the manufacturer’s protocol and was purified using QIAquick PCR purification kit (QIAGEN, Cat. No. 28106). .. The linear plasmid was gel-purified using QIAquick gel extraction kit (QIAGEN Cat. No. 28706) to remove the undigested plasmid and the excised fragment.

    Clear Native PAGE:

    Article Title: Multivalency governs HP1α association dynamics with the silent chromatin state
    Article Snippet: .. 0.5–2 pmol of chromatin arrays were digested with ScaI-HF (NEB) in 10 μl for 6 h. Quality of the reconstitution was assessed by native PAGE ( ). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs pvui
    Pvui, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pvui/product/New England Biolabs
    Average 99 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    pvui - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results