psti  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    PstI
    Description:
    PstI 50 000 units
    Catalog Number:
    R0140L
    Price:
    264
    Size:
    50 000 units
    Category:
    Restriction Enzymes
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs psti
    PstI
    PstI 50 000 units
    https://www.bioz.com/result/psti/product/New England Biolabs
    Average 99 stars, based on 67 article reviews
    Price from $9.99 to $1999.99
    psti - by Bioz Stars, 2019-10
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: p53, a Target of Estrogen Receptor (ER) ?, Modulates DNA Damage-induced Growth Suppression in ER-positive Breast Cancer Cells
    Article Snippet: The oligonucleotides were annealed and cloned into pBabe-H1 as described previously ( ). .. To generate pGL2 luciferase reporters under control of the p53 promoter (nucleotides (nt) −1998 to +73 designated p53-P-2kb and nt −593 to +73 designated p53-P-593), genomic DNA fragments were amplified from MCF7 cells with forward primer 5′-AT GGGTACC AAGTGTAGGGCTAGGGCTG-3′ or 5′-TT GGTACC GCTTCAGACCTGTCTCCCTCATTC-3′ and reverse primer 5′-ACT CTCGAG TGGCTCTAGACTTTTGAGAAGCTC-3′. p53 promoter internal deletion mutants were generated by a PstI and PvuII (New England Biolabs) restriction enzyme digest and religation according to the manufacturer's instructions and designated p53-P-PstI and p53-P-PvuII, respectively.

    Article Title: miR-155 targets Caspase-3 mRNA in activated macrophages
    Article Snippet: Sequences of primers for cloning, RT-PCR and qPCR and, sequences of Northern blot probes, as well as antagomirs (all Eurofins Genomics) and mRNA mimics (biomers.net) are listed in the Supplemental Material (Table S1). .. For cloning of Firefly LUCIFERASE (fLUC) reporter constructs 466 bp of the CASP-3 and 464 bp or of the IKKε 3'UTR, each containing the miR-155 binding site were cloned into Pst1 / Xho1 (NEB, #R0140S, #R0146S) in the pBluescript II KS (+)-LUC poly(A), which was described previously in. .. To generate reporter constructs containing 4 bp substitutions in the respective miR-155 target site, site-directed mutagenesis was performed.

    Article Title: Origin of year-long bean (Phaseolus dumosus Macfady, Fabaceae) from reticulated hybridization events between multiple Phaseolus species
    Article Snippet: DNA was isolated from single plants following a proteinase protocol ( ) and DNA quality tested by digestion with HindIII and PstI (New England Biolabs) according to the manufacturer’s instructions. .. DNA was isolated from single plants following a proteinase protocol ( ) and DNA quality tested by digestion with HindIII and PstI (New England Biolabs) according to the manufacturer’s instructions.

    Article Title: Ca2+-Induced Two-Component System CvsSR Regulates the Type III Secretion System and the Extracytoplasmic Function Sigma Factor AlgU in Pseudomonas syringae pv. tomato DC3000
    Article Snippet: Briefly a genomic fragment containing cvsR , PSPTO_3382, and PSPTO_3383 was amplified via PCR. .. The products were gel purified using the Qiagen gel extraction miniprep kit (Qiagen), digested with HindIII (NEB) and PstI (NEB), and cloned into a pUC18miniTn 7 plasmid which had been digested with HindIII and PstI. .. The resulting ligation was transformed into DH5α E. coli cells.

    Article Title: The Response to 2-Aminoacrylate Differs in Escherichia coli and Salmonella enterica, despite Shared Metabolic Components
    Article Snippet: The amplification product was purified, digested with EcoRI and PstI (New England BioLabs), and ligated into predigested pBAD24 ( ) to generate pAB1. .. The ligation mixture was transformed into E. coli DH5α, and chloramphenicol-resistant (Cmr ) colonies were selected.

    Article Title: PDGF mediates TGF?-induced migration during development of the spinous process
    Article Snippet: Probes for PDGFc were synthesized from cDNA, followed by the cloning using pGEM-T Easy Vector System (Promega). .. The templates were linearized by restriction enzymes NcoI or PstI following the manufacture’s protocol (NEB).

    Article Title: Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor
    Article Snippet: Synthetic full-length cry11Aa and cyt1Aa genes (GenBank accession nos. and ) and the different gene fragments were obtained by PCR with specific oligonucleotides designed with oligo 4 (Molecular Biology Insights, Cascade, CO) program (Tables 3 and 4, which are published as on the PNAS web site). .. The PCR products of cry11Aa gene amplification were digested with SacI and PstI restriction enzymes (New England Biolabs) and cloned into plasmid pHybLex/Zeo (Invitrogen). .. The PCR products of cyt1Aa gene were digested with KpnI and SphI and cloned into plasmid pYESTrp2 (Invitrogen).

    Article Title: Super-resolution optical DNA Mapping via DNA methyltransferase-directed click chemistry
    Article Snippet: FokI methyltransferase was a kind gift from Bill Jack, NEB Inc. .. Clones for the M.BsaHI, M.XbaI, M.PvuII and M.PstI enzymes were a kind gift from New England Biolabs Inc. .. Briefly, the methyltransferase genes were inserted into the pTXB1 vector (NEB) (NheI and EcoRI sites).

    Centrifugation:

    Article Title: Characterization of a Brg1 hypomorphic allele demonstrates that genetic and biochemical activity are tightly correlated
    Article Snippet: Crude mononucleosome assemblies were gel-fractionated by 5%-Tris-EDTA [pH 7.6] acrylamide electrophoresis at 4 °C, and then gel purified by diffusion in 10 mM Tris-Cl [pH 7.6], 0.2 mM EDTA, 40 mM NaCl, 0.01% Igepal-CA380, 0.5 mM phenylmethylsulfonyl fluoride at 4 °C for 12–18 h. Mononucleosome assemblies were concentrated by centrifugation, and then stored at 4°C in gel elution buffer supplemented with 15% glycerol, 0.3 mg/mL bovine serum albumin (BSA), 0.1% Igepal-CA380, and 1 mM dithiothreitol. .. Gel-purified mononucleosomes ( < 1 nM) were incubated with either 2 mM ATP or ATPγS and saturating amounts (100 ng) of wild-type or mutant BRG1 proteins in 20 µL reactions containing 12 mM HEPES-KOH [pH 7.9], 2 mM Tris-Cl [pH 7.6], 60 mM KCl, 8 mM NaCl, 4 mM MgCl2, 0.2 mM dithiothreitol, 0.06 mg/mL bovine serum albumin (BSA), 0.02% Igepal-CA380, 3% glycerol, and 0.5 Units/µL PstI enzyme (NEB) for 0.25, 3.5, 10, 30 or 60 min. at 30 °C.

    Amplification:

    Article Title: The NRP1 migraine risk variant shows evidence of association with menstrual migraine
    Article Snippet: For rs12845494 and rs2506142, restriction fragment length polymorphism (RFLP) assays were used. .. This involved amplification of the targeted loci using a standard PCR protocol followed by digestion with the restriction enzymes Pst I (NEB #R0140S) for rs12845494, and Bsm AI (NEB #R0529L) for rs2506142. .. The PCR product for rs12845494 was added to a master mix of Pst I enzyme with NEBuffer 3.1 and incubated at 37 °C for 16 h. For rs2056142, the PCR product was added to a master mix of Bsm AI with SmartCutter® and incubated for an hour at 55 °C.

    Article Title: p53, a Target of Estrogen Receptor (ER) ?, Modulates DNA Damage-induced Growth Suppression in ER-positive Breast Cancer Cells
    Article Snippet: The pBabe-U6-sip53 construct expressing p53 shRNA was described previously ( ). .. To generate pGL2 luciferase reporters under control of the p53 promoter (nucleotides (nt) −1998 to +73 designated p53-P-2kb and nt −593 to +73 designated p53-P-593), genomic DNA fragments were amplified from MCF7 cells with forward primer 5′-AT GGGTACC AAGTGTAGGGCTAGGGCTG-3′ or 5′-TT GGTACC GCTTCAGACCTGTCTCCCTCATTC-3′ and reverse primer 5′-ACT CTCGAG TGGCTCTAGACTTTTGAGAAGCTC-3′. p53 promoter internal deletion mutants were generated by a PstI and PvuII (New England Biolabs) restriction enzyme digest and religation according to the manufacturer's instructions and designated p53-P-PstI and p53-P-PvuII, respectively. .. To generate individual wild-type or mutant estrogen response element (ERE) half-sites cloned upstream of the minimum c- fos promoter in the luciferase reporter OFLuc reporter vector , genomic DNA fragments were amplified from MCF7 cells with the following primer sets: −1828, forward primer 5′-GGGG AAGCTT TGAAAATCTCGGGGGT GGTCA G-3′ and reverse primer 5′-GGGG AGATCT TCGATTTCTCAGTGGTTCCTGGTCAG-3′; −1828M, forward primer 5′-GGGG AAGCTT TGAAAATCTCGGGGGT GTACA G-3′ and reverse primer 5′-GGGG AGATCT TCGATTTCTCAGTGGTTCCTGTACAG; −1611, forward primer 5′-GGGG AAGCTT AGGCCTGGAGAAGTG GGTCT -3′ and reverse primer 5′-GGGG AGATCT TAAGTGGTGATGGCAG-3′; −1611M, forward primer 5′-GGG AAGCTT AGGCCTGGAGAAGTG GTACT CAGGATT-3′ and reverse primer 5′-GGGG AGATCT TAGCTCCGGACTGCTGTACTTCAGTAC-3′; −1248, forward primer 5′-GGGG AAGCTT AGCCACAGGATCTGG GGACA -3′ and reverse primer 5′-GGGG AGATCT CACGCTTCCCCGATGA-3′; and −1224, forward primer 5′-GCGG AAGCTT CAGTTCAGAGTCC-3′ and reverse primer 5′-GGGC AGATCT TAGCTCCGGACTGCTG-3′.

    Article Title: The Two-Component System PhoPR of Clostridium acetobutylicum Is Involved in Phosphate-Dependent Gene Regulation
    Article Snippet: Primers PhoP2-5BamHI-B and PhoP2-3PstI-A (Table ) were used for PCR amplification of phoP . .. After PstI (MBI Fermentas GmbH, St. Leon-Rot, Germany) and BamHI (Invitrogen Life Technologies GmbH, Karlsruhe, Germany) digestion of the amplificates, the * phoR fragment was ligated into PstI- and BamHI-digested, dephosphorylated pMAL-c2X (NEB, Frankfurt/Main, Germany) and the phoP fragment was ligated into the equally treated vector pASK-IBA2 (IBA GmbH, Göttingen, Germany), resulting in plasmids pTF5 and pMM15, respectively.

    Article Title: Site-Directed Mutagenesis and Expression of the Soluble Form of the Family IIIa Cellulose Binding Domain from the Cellulosomal Scaffolding Protein of Clostridium cellulovorans
    Article Snippet: The genomic DNA of C. cellulovorans was prepared as described previously ( ) and used as a template for PCR. .. The amplified gene was inserted into the PstI and EcoRI sites of the vector pMAL p2x (New England Biolabs) to generate pMAL-CbpA-CBD. .. The CbpA-CBD expressed by this vector was fused with the N-terminal MBP.

    Article Title: Origin of year-long bean (Phaseolus dumosus Macfady, Fabaceae) from reticulated hybridization events between multiple Phaseolus species
    Article Snippet: DNA was isolated from single plants following a proteinase protocol ( ) and DNA quality tested by digestion with HindIII and PstI (New England Biolabs) according to the manufacturer’s instructions. .. DNA was isolated from single plants following a proteinase protocol ( ) and DNA quality tested by digestion with HindIII and PstI (New England Biolabs) according to the manufacturer’s instructions.

    Article Title: Ca2+-Induced Two-Component System CvsSR Regulates the Type III Secretion System and the Extracytoplasmic Function Sigma Factor AlgU in Pseudomonas syringae pv. tomato DC3000
    Article Snippet: Briefly a genomic fragment containing cvsR , PSPTO_3382, and PSPTO_3383 was amplified via PCR. .. The products were gel purified using the Qiagen gel extraction miniprep kit (Qiagen), digested with HindIII (NEB) and PstI (NEB), and cloned into a pUC18miniTn 7 plasmid which had been digested with HindIII and PstI.

    Article Title: The Response to 2-Aminoacrylate Differs in Escherichia coli and Salmonella enterica, despite Shared Metabolic Components
    Article Snippet: The ilvA219 allele, encoding the feedback-resistant variant IlvAL447F , was amplified from S. enterica by PCR with Q5 high-fidelity DNA polymerase (New England BioLabs) using primers AB1 and AB2 ( ). .. The amplification product was purified, digested with EcoRI and PstI (New England BioLabs), and ligated into predigested pBAD24 ( ) to generate pAB1. .. The cat gene, encoding chloramphenicol acetyltransferase, including the promoter, was amplified from pSU18 ( ) by PCR using Q5 high-fidelity DNA polymerase (New England BioLabs) and primers AB3 and AB4.

    Article Title: Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor
    Article Snippet: Synthetic full-length cry11Aa and cyt1Aa genes (GenBank accession nos. and ) and the different gene fragments were obtained by PCR with specific oligonucleotides designed with oligo 4 (Molecular Biology Insights, Cascade, CO) program (Tables 3 and 4, which are published as on the PNAS web site). .. The PCR products of cry11Aa gene amplification were digested with SacI and PstI restriction enzymes (New England Biolabs) and cloned into plasmid pHybLex/Zeo (Invitrogen). .. The PCR products of cyt1Aa gene were digested with KpnI and SphI and cloned into plasmid pYESTrp2 (Invitrogen).

    Article Title: The Presence of the Internalin Gene in Natural Atypically Hemolytic Listeria innocua Strains Suggests Descent from L. monocytogenes
    Article Snippet: For amplification of the DNA flanking regions of the inlA gene, MspI, NheI, and PstI digestion, ligation, and inverse PCR were performed. .. Between 250 and 500 ng of genomic DNA was digested overnight with 5 U of MspI, NheI, or PstI (NEB) (20-μl reaction mixture volume) and heat inactivated at 85°C for 1 h. T4 DNA ligase (2 U) (NEB) and its corresponding buffer were added to the digest mixture to bring the volume to 25 μl.

    Mass Spectrometry:

    Article Title: The NRP1 migraine risk variant shows evidence of association with menstrual migraine
    Article Snippet: Detection of primer extension products was performed by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry. .. This involved amplification of the targeted loci using a standard PCR protocol followed by digestion with the restriction enzymes Pst I (NEB #R0140S) for rs12845494, and Bsm AI (NEB #R0529L) for rs2506142.

    Synthesized:

    Article Title: PDGF mediates TGF?-induced migration during development of the spinous process
    Article Snippet: Probes for PDGFc were synthesized from cDNA, followed by the cloning using pGEM-T Easy Vector System (Promega). .. The templates were linearized by restriction enzymes NcoI or PstI following the manufacture’s protocol (NEB).

    Article Title: Role for DNA Polymerase ? in the Processing ofN2-N2-Guanine Interstrand Cross-links
    Article Snippet: To obtain double-stranded pMS2 vectors, the 36-mer strand of the cross-link or the scaffold oligodeoxynucleotide in control DNA was extended using 5 units of T4 DNA polymerase (New England Biolabs) and 1 m m dNTPs at 37 °C for 1 h. A newly synthesized strand was concomitantly sealed using 5 units of T4 DNA ligase (New England Biolabs). .. The creation of double-stranded pMS2 was verified by PstI (New England Biolabs) digestion.

    Construct:

    Article Title: A phylogenetic framework of the legume genus Aeschynomene for comparative genetic analysis of the Nod-dependent and Nod-independent symbioses
    Article Snippet: A GBS library was constructed based on a protocol described [ ]. .. For each sample, a total of 150 ng of genomic DNA was digested using the two-enzyme system, PstI (rare cutter) and Mse (common cutter) (New England Biolabs, Hitchin, UK), by incubating at 37 °C for 2 h. The ligation reaction was performed using the T4 DNA ligase enzyme (New England Biolabs, Hitchin, UK) at 22 °C for 30 min and the ligase was inactivated at 65 °C for 30 min. Ligated samples were pooled and PCR-amplified using the Illumina Primer 1 (barcoded adapter with PstI overhang) and Illumina Primer 2 (common Y-adapter).

    Article Title: p53, a Target of Estrogen Receptor (ER) ?, Modulates DNA Damage-induced Growth Suppression in ER-positive Breast Cancer Cells
    Article Snippet: The pBabe-U6-sip53 construct expressing p53 shRNA was described previously ( ). .. To generate pGL2 luciferase reporters under control of the p53 promoter (nucleotides (nt) −1998 to +73 designated p53-P-2kb and nt −593 to +73 designated p53-P-593), genomic DNA fragments were amplified from MCF7 cells with forward primer 5′-AT GGGTACC AAGTGTAGGGCTAGGGCTG-3′ or 5′-TT GGTACC GCTTCAGACCTGTCTCCCTCATTC-3′ and reverse primer 5′-ACT CTCGAG TGGCTCTAGACTTTTGAGAAGCTC-3′. p53 promoter internal deletion mutants were generated by a PstI and PvuII (New England Biolabs) restriction enzyme digest and religation according to the manufacturer's instructions and designated p53-P-PstI and p53-P-PvuII, respectively.

    Article Title: miR-155 targets Caspase-3 mRNA in activated macrophages
    Article Snippet: Sequences of primers for cloning, RT-PCR and qPCR and, sequences of Northern blot probes, as well as antagomirs (all Eurofins Genomics) and mRNA mimics (biomers.net) are listed in the Supplemental Material (Table S1). .. For cloning of Firefly LUCIFERASE (fLUC) reporter constructs 466 bp of the CASP-3 and 464 bp or of the IKKε 3'UTR, each containing the miR-155 binding site were cloned into Pst1 / Xho1 (NEB, #R0140S, #R0146S) in the pBluescript II KS (+)-LUC poly(A), which was described previously in. .. To generate reporter constructs containing 4 bp substitutions in the respective miR-155 target site, site-directed mutagenesis was performed.

    Article Title: The Response to 2-Aminoacrylate Differs in Escherichia coli and Salmonella enterica, despite Shared Metabolic Components
    Article Snippet: Paragraph title: Construction of a chromosomal construct for inducing 2AA formation. ... The amplification product was purified, digested with EcoRI and PstI (New England BioLabs), and ligated into predigested pBAD24 ( ) to generate pAB1.

    Electrophoresis:

    Article Title: Characterization of a Brg1 hypomorphic allele demonstrates that genetic and biochemical activity are tightly correlated
    Article Snippet: Crude mononucleosome assemblies were gel-fractionated by 5%-Tris-EDTA [pH 7.6] acrylamide electrophoresis at 4 °C, and then gel purified by diffusion in 10 mM Tris-Cl [pH 7.6], 0.2 mM EDTA, 40 mM NaCl, 0.01% Igepal-CA380, 0.5 mM phenylmethylsulfonyl fluoride at 4 °C for 12–18 h. Mononucleosome assemblies were concentrated by centrifugation, and then stored at 4°C in gel elution buffer supplemented with 15% glycerol, 0.3 mg/mL bovine serum albumin (BSA), 0.1% Igepal-CA380, and 1 mM dithiothreitol. .. Gel-purified mononucleosomes ( < 1 nM) were incubated with either 2 mM ATP or ATPγS and saturating amounts (100 ng) of wild-type or mutant BRG1 proteins in 20 µL reactions containing 12 mM HEPES-KOH [pH 7.9], 2 mM Tris-Cl [pH 7.6], 60 mM KCl, 8 mM NaCl, 4 mM MgCl2, 0.2 mM dithiothreitol, 0.06 mg/mL bovine serum albumin (BSA), 0.02% Igepal-CA380, 3% glycerol, and 0.5 Units/µL PstI enzyme (NEB) for 0.25, 3.5, 10, 30 or 60 min. at 30 °C.

    Article Title: Correlation of Phenotype with the Genotype of Egg-Contaminating Salmonella enterica Serovar Enteritidis
    Article Snippet: The restriction enzymes used to compare the PT13A strains were SphI (5 U) and PstI (20 U) (New England Biolabs, Beverly, Mass.). .. Southern blot hybridization of the digoxigenin-labeled probe to digested DNA was performed by using standard procedures ( - ).

    Incubation:

    Article Title: Characterization of a Brg1 hypomorphic allele demonstrates that genetic and biochemical activity are tightly correlated
    Article Snippet: Mononucleosomes were incubated at 37 °C for 1–2 h prior to use. .. Gel-purified mononucleosomes ( < 1 nM) were incubated with either 2 mM ATP or ATPγS and saturating amounts (100 ng) of wild-type or mutant BRG1 proteins in 20 µL reactions containing 12 mM HEPES-KOH [pH 7.9], 2 mM Tris-Cl [pH 7.6], 60 mM KCl, 8 mM NaCl, 4 mM MgCl2, 0.2 mM dithiothreitol, 0.06 mg/mL bovine serum albumin (BSA), 0.02% Igepal-CA380, 3% glycerol, and 0.5 Units/µL PstI enzyme (NEB) for 0.25, 3.5, 10, 30 or 60 min. at 30 °C. .. Reactions were quenched by the addition of 1.6 volumes of 20 mM Tris-Cl [pH 7.6], 70 mM EDTA, 2% SDS, 0.2 mg/mL xylene cynanole, 0.2 mg/mL bromophenol blue, 0.2 mg/mL proteinase K, and 10% glycerol, followed by a 1 h incubation at 37 °C.

    Article Title: Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor
    Article Snippet: The membranes were incubated with anti-Cry11Aa or anti-Cyt1Aa polyclonal antibodies (1:10,000) and then with a secondary goat anti-rabbit-HRP antibody (Sigma) (1:5,000). .. The PCR products of cry11Aa gene amplification were digested with SacI and PstI restriction enzymes (New England Biolabs) and cloned into plasmid pHybLex/Zeo (Invitrogen).

    Article Title: XLF-Cernunnos promotes DNA ligase IV-XRCC4 re-adenylation following ligation
    Article Snippet: The complexes were incubated in the presence of purified XLF or 0.1 µg/ml of BSA and α-32 P-ATP (2 µCi, 66 nM final concentration) (GE Healthcare, Buckinghamshire, UK). .. For ligations, a 445-bp DNA fragment was produced from Bluescript plasmid (Stratagene) by digestion with PstI and AflIII (New England Biolabs).

    Diffusion-based Assay:

    Article Title: Characterization of a Brg1 hypomorphic allele demonstrates that genetic and biochemical activity are tightly correlated
    Article Snippet: Crude mononucleosome assemblies were gel-fractionated by 5%-Tris-EDTA [pH 7.6] acrylamide electrophoresis at 4 °C, and then gel purified by diffusion in 10 mM Tris-Cl [pH 7.6], 0.2 mM EDTA, 40 mM NaCl, 0.01% Igepal-CA380, 0.5 mM phenylmethylsulfonyl fluoride at 4 °C for 12–18 h. Mononucleosome assemblies were concentrated by centrifugation, and then stored at 4°C in gel elution buffer supplemented with 15% glycerol, 0.3 mg/mL bovine serum albumin (BSA), 0.1% Igepal-CA380, and 1 mM dithiothreitol. .. Gel-purified mononucleosomes ( < 1 nM) were incubated with either 2 mM ATP or ATPγS and saturating amounts (100 ng) of wild-type or mutant BRG1 proteins in 20 µL reactions containing 12 mM HEPES-KOH [pH 7.9], 2 mM Tris-Cl [pH 7.6], 60 mM KCl, 8 mM NaCl, 4 mM MgCl2, 0.2 mM dithiothreitol, 0.06 mg/mL bovine serum albumin (BSA), 0.02% Igepal-CA380, 3% glycerol, and 0.5 Units/µL PstI enzyme (NEB) for 0.25, 3.5, 10, 30 or 60 min. at 30 °C.

    Expressing:

    Article Title: p53, a Target of Estrogen Receptor (ER) ?, Modulates DNA Damage-induced Growth Suppression in ER-positive Breast Cancer Cells
    Article Snippet: The pBabe-U6-sip53 construct expressing p53 shRNA was described previously ( ). .. To generate pGL2 luciferase reporters under control of the p53 promoter (nucleotides (nt) −1998 to +73 designated p53-P-2kb and nt −593 to +73 designated p53-P-593), genomic DNA fragments were amplified from MCF7 cells with forward primer 5′-AT GGGTACC AAGTGTAGGGCTAGGGCTG-3′ or 5′-TT GGTACC GCTTCAGACCTGTCTCCCTCATTC-3′ and reverse primer 5′-ACT CTCGAG TGGCTCTAGACTTTTGAGAAGCTC-3′. p53 promoter internal deletion mutants were generated by a PstI and PvuII (New England Biolabs) restriction enzyme digest and religation according to the manufacturer's instructions and designated p53-P-PstI and p53-P-PvuII, respectively.

    Article Title: The Two-Component System PhoPR of Clostridium acetobutylicum Is Involved in Phosphate-Dependent Gene Regulation
    Article Snippet: Paragraph title: Construction of plasmids expressing PhoP N-terminally fused to a streptavidin tag (PhoP Strep- Tag) or truncated PhoR C-terminally fused to maltose binding protein (MBP-*PhoR). ... After PstI (MBI Fermentas GmbH, St. Leon-Rot, Germany) and BamHI (Invitrogen Life Technologies GmbH, Karlsruhe, Germany) digestion of the amplificates, the * phoR fragment was ligated into PstI- and BamHI-digested, dephosphorylated pMAL-c2X (NEB, Frankfurt/Main, Germany) and the phoP fragment was ligated into the equally treated vector pASK-IBA2 (IBA GmbH, Göttingen, Germany), resulting in plasmids pTF5 and pMM15, respectively.

    Article Title: Site-Directed Mutagenesis and Expression of the Soluble Form of the Family IIIa Cellulose Binding Domain from the Cellulosomal Scaffolding Protein of Clostridium cellulovorans
    Article Snippet: Paragraph title: Soluble expression of CbpA-CBD fused with MBP by Escherichia coli . ... The amplified gene was inserted into the PstI and EcoRI sites of the vector pMAL p2x (New England Biolabs) to generate pMAL-CbpA-CBD.

    Modification:

    Article Title: Role for DNA Polymerase ? in the Processing ofN2-N2-Guanine Interstrand Cross-links
    Article Snippet: To create a single-stranded pMS2 containing site-specific interstrand cross-link, the procedure was modified as follows. .. The creation of double-stranded pMS2 was verified by PstI (New England Biolabs) digestion.

    Transformation Assay:

    Article Title: Site-Directed Mutagenesis and Expression of the Soluble Form of the Family IIIa Cellulose Binding Domain from the Cellulosomal Scaffolding Protein of Clostridium cellulovorans
    Article Snippet: The amplified gene was inserted into the PstI and EcoRI sites of the vector pMAL p2x (New England Biolabs) to generate pMAL-CbpA-CBD. .. The CbpA-CBD expressed by this vector was fused with the N-terminal MBP.

    Article Title: Ca2+-Induced Two-Component System CvsSR Regulates the Type III Secretion System and the Extracytoplasmic Function Sigma Factor AlgU in Pseudomonas syringae pv. tomato DC3000
    Article Snippet: The products were gel purified using the Qiagen gel extraction miniprep kit (Qiagen), digested with HindIII (NEB) and PstI (NEB), and cloned into a pUC18miniTn 7 plasmid which had been digested with HindIII and PstI. .. The resulting ligation was transformed into DH5α E. coli cells.

    Article Title: The Response to 2-Aminoacrylate Differs in Escherichia coli and Salmonella enterica, despite Shared Metabolic Components
    Article Snippet: The amplification product was purified, digested with EcoRI and PstI (New England BioLabs), and ligated into predigested pBAD24 ( ) to generate pAB1. .. The amplification product was purified, digested with EcoRI and PstI (New England BioLabs), and ligated into predigested pBAD24 ( ) to generate pAB1.

    Article Title: Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor
    Article Snippet: The PCR products of cry11Aa gene amplification were digested with SacI and PstI restriction enzymes (New England Biolabs) and cloned into plasmid pHybLex/Zeo (Invitrogen). .. The PCR products of cry11Aa gene amplification were digested with SacI and PstI restriction enzymes (New England Biolabs) and cloned into plasmid pHybLex/Zeo (Invitrogen).

    Article Title: Super-resolution optical DNA Mapping via DNA methyltransferase-directed click chemistry
    Article Snippet: Clones for the M.BsaHI, M.XbaI, M.PvuII and M.PstI enzymes were a kind gift from New England Biolabs Inc. .. Briefly, the methyltransferase genes were inserted into the pTXB1 vector (NEB) (NheI and EcoRI sites).

    Hybridization:

    Article Title: Correlation of Phenotype with the Genotype of Egg-Contaminating Salmonella enterica Serovar Enteritidis
    Article Snippet: The restriction enzymes used to compare the PT13A strains were SphI (5 U) and PstI (20 U) (New England Biolabs, Beverly, Mass.). .. The restriction enzymes used to compare the PT13A strains were SphI (5 U) and PstI (20 U) (New England Biolabs, Beverly, Mass.).

    Electroporation:

    Article Title: Mutant Alleles of lptD Increase the Permeability of Pseudomonas aeruginosa and Define Determinants of Intrinsic Resistance to Antibiotics
    Article Snippet: Phusion high-fidelity polymerase and restriction enzymes PstI and BamHI were from New England BioLabs (Ipswitch, MA). .. Phusion high-fidelity polymerase and restriction enzymes PstI and BamHI were from New England BioLabs (Ipswitch, MA).

    Article Title: Ca2+-Induced Two-Component System CvsSR Regulates the Type III Secretion System and the Extracytoplasmic Function Sigma Factor AlgU in Pseudomonas syringae pv. tomato DC3000
    Article Snippet: The products were gel purified using the Qiagen gel extraction miniprep kit (Qiagen), digested with HindIII (NEB) and PstI (NEB), and cloned into a pUC18miniTn 7 plasmid which had been digested with HindIII and PstI. .. The resulting ligation was transformed into DH5α E. coli cells.

    Bla VIM Assay:

    Article Title: Molecular Evolution of Metallo-?-Lactamase-Producing Pseudomonas aeruginosa in a Nosocomial Setting of High-Level Endemicity
    Article Snippet: The authenticity of the sequence was confirmed by direct sequencing of the PCR product obtained in an independent amplification reaction. .. Approximately 1.5 μg of genomic DNA, either undigested or restricted with 50 U of enzymes, which did not cut inside the integrons (PstI [New England Biolabs] for bla VIM - 1 -positive isolates and either MseI or EcoRI [New England Biolabs] for bla VIM - 2 -positive isolates), was subjected to Southern blot analysis. .. DNA fragments were separated on a 0.8% agarose gel at 1.3 V/cm for 20 h at 4°C, capillary blotted onto nylon membranes (Hybond-N+ ; Amersham International), and hybridized with the digoxigenin-labeled bla VIM -specific probe as described above.

    Inverse PCR:

    Article Title: The Presence of the Internalin Gene in Natural Atypically Hemolytic Listeria innocua Strains Suggests Descent from L. monocytogenes
    Article Snippet: Paragraph title: Inverse PCR for inlA flanking regions. ... Between 250 and 500 ng of genomic DNA was digested overnight with 5 U of MspI, NheI, or PstI (NEB) (20-μl reaction mixture volume) and heat inactivated at 85°C for 1 h. T4 DNA ligase (2 U) (NEB) and its corresponding buffer were added to the digest mixture to bring the volume to 25 μl.

    Southern Blot:

    Article Title: Correlation of Phenotype with the Genotype of Egg-Contaminating Salmonella enterica Serovar Enteritidis
    Article Snippet: The restriction enzymes used to compare the PT13A strains were SphI (5 U) and PstI (20 U) (New England Biolabs, Beverly, Mass.). .. The restriction enzymes used to compare the PT13A strains were SphI (5 U) and PstI (20 U) (New England Biolabs, Beverly, Mass.).

    Article Title: Molecular Evolution of Metallo-?-Lactamase-Producing Pseudomonas aeruginosa in a Nosocomial Setting of High-Level Endemicity
    Article Snippet: The authenticity of the sequence was confirmed by direct sequencing of the PCR product obtained in an independent amplification reaction. .. Approximately 1.5 μg of genomic DNA, either undigested or restricted with 50 U of enzymes, which did not cut inside the integrons (PstI [New England Biolabs] for bla VIM - 1 -positive isolates and either MseI or EcoRI [New England Biolabs] for bla VIM - 2 -positive isolates), was subjected to Southern blot analysis. .. DNA fragments were separated on a 0.8% agarose gel at 1.3 V/cm for 20 h at 4°C, capillary blotted onto nylon membranes (Hybond-N+ ; Amersham International), and hybridized with the digoxigenin-labeled bla VIM -specific probe as described above.

    Ligation:

    Article Title: A phylogenetic framework of the legume genus Aeschynomene for comparative genetic analysis of the Nod-dependent and Nod-independent symbioses
    Article Snippet: A GBS library was constructed based on a protocol described [ ]. .. For each sample, a total of 150 ng of genomic DNA was digested using the two-enzyme system, PstI (rare cutter) and Mse (common cutter) (New England Biolabs, Hitchin, UK), by incubating at 37 °C for 2 h. The ligation reaction was performed using the T4 DNA ligase enzyme (New England Biolabs, Hitchin, UK) at 22 °C for 30 min and the ligase was inactivated at 65 °C for 30 min. Ligated samples were pooled and PCR-amplified using the Illumina Primer 1 (barcoded adapter with PstI overhang) and Illumina Primer 2 (common Y-adapter). .. The library was sequenced on an Illumina HiSeq 3000 (1 × 150 pb) (at the Get-PlaGe platform in Toulouse, France).

    Article Title: The Response to 2-Aminoacrylate Differs in Escherichia coli and Salmonella enterica, despite Shared Metabolic Components
    Article Snippet: The amplification product was purified, digested with EcoRI and PstI (New England BioLabs), and ligated into predigested pBAD24 ( ) to generate pAB1. .. The amplification product was purified, digested with EcoRI and PstI (New England BioLabs), and ligated into predigested pBAD24 ( ) to generate pAB1.

    Article Title: The Presence of the Internalin Gene in Natural Atypically Hemolytic Listeria innocua Strains Suggests Descent from L. monocytogenes
    Article Snippet: For amplification of the DNA flanking regions of the inlA gene, MspI, NheI, and PstI digestion, ligation, and inverse PCR were performed. .. Between 250 and 500 ng of genomic DNA was digested overnight with 5 U of MspI, NheI, or PstI (NEB) (20-μl reaction mixture volume) and heat inactivated at 85°C for 1 h. T4 DNA ligase (2 U) (NEB) and its corresponding buffer were added to the digest mixture to bring the volume to 25 μl.

    Article Title: XLF-Cernunnos promotes DNA ligase IV-XRCC4 re-adenylation following ligation
    Article Snippet: Paragraph title: Adenylation and ligation ... For ligations, a 445-bp DNA fragment was produced from Bluescript plasmid (Stratagene) by digestion with PstI and AflIII (New England Biolabs).

    Generated:

    Article Title: p53, a Target of Estrogen Receptor (ER) ?, Modulates DNA Damage-induced Growth Suppression in ER-positive Breast Cancer Cells
    Article Snippet: The pBabe-U6-sip53 construct expressing p53 shRNA was described previously ( ). .. To generate pGL2 luciferase reporters under control of the p53 promoter (nucleotides (nt) −1998 to +73 designated p53-P-2kb and nt −593 to +73 designated p53-P-593), genomic DNA fragments were amplified from MCF7 cells with forward primer 5′-AT GGGTACC AAGTGTAGGGCTAGGGCTG-3′ or 5′-TT GGTACC GCTTCAGACCTGTCTCCCTCATTC-3′ and reverse primer 5′-ACT CTCGAG TGGCTCTAGACTTTTGAGAAGCTC-3′. p53 promoter internal deletion mutants were generated by a PstI and PvuII (New England Biolabs) restriction enzyme digest and religation according to the manufacturer's instructions and designated p53-P-PstI and p53-P-PvuII, respectively. .. To generate individual wild-type or mutant estrogen response element (ERE) half-sites cloned upstream of the minimum c- fos promoter in the luciferase reporter OFLuc reporter vector , genomic DNA fragments were amplified from MCF7 cells with the following primer sets: −1828, forward primer 5′-GGGG AAGCTT TGAAAATCTCGGGGGT GGTCA G-3′ and reverse primer 5′-GGGG AGATCT TCGATTTCTCAGTGGTTCCTGGTCAG-3′; −1828M, forward primer 5′-GGGG AAGCTT TGAAAATCTCGGGGGT GTACA G-3′ and reverse primer 5′-GGGG AGATCT TCGATTTCTCAGTGGTTCCTGTACAG; −1611, forward primer 5′-GGGG AAGCTT AGGCCTGGAGAAGTG GGTCT -3′ and reverse primer 5′-GGGG AGATCT TAAGTGGTGATGGCAG-3′; −1611M, forward primer 5′-GGG AAGCTT AGGCCTGGAGAAGTG GTACT CAGGATT-3′ and reverse primer 5′-GGGG AGATCT TAGCTCCGGACTGCTGTACTTCAGTAC-3′; −1248, forward primer 5′-GGGG AAGCTT AGCCACAGGATCTGG GGACA -3′ and reverse primer 5′-GGGG AGATCT CACGCTTCCCCGATGA-3′; and −1224, forward primer 5′-GCGG AAGCTT CAGTTCAGAGTCC-3′ and reverse primer 5′-GGGC AGATCT TAGCTCCGGACTGCTG-3′.

    DNA Sequencing:

    Article Title: Mutant Alleles of lptD Increase the Permeability of Pseudomonas aeruginosa and Define Determinants of Intrinsic Resistance to Antibiotics
    Article Snippet: Phusion high-fidelity polymerase and restriction enzymes PstI and BamHI were from New England BioLabs (Ipswitch, MA). .. Electroporation was performed on a Gene Pulser II electroporator with Gene Pulser cuvettes (Bio-Rad, Hercules, CA).

    Y2H Assay:

    Article Title: Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor
    Article Snippet: The PCR products of cry11Aa gene amplification were digested with SacI and PstI restriction enzymes (New England Biolabs) and cloned into plasmid pHybLex/Zeo (Invitrogen). .. The PCR products of cyt1Aa gene were digested with KpnI and SphI and cloned into plasmid pYESTrp2 (Invitrogen).

    Sequencing:

    Article Title: A phylogenetic framework of the legume genus Aeschynomene for comparative genetic analysis of the Nod-dependent and Nod-independent symbioses
    Article Snippet: For each sample, a total of 150 ng of genomic DNA was digested using the two-enzyme system, PstI (rare cutter) and Mse (common cutter) (New England Biolabs, Hitchin, UK), by incubating at 37 °C for 2 h. The ligation reaction was performed using the T4 DNA ligase enzyme (New England Biolabs, Hitchin, UK) at 22 °C for 30 min and the ligase was inactivated at 65 °C for 30 min. Ligated samples were pooled and PCR-amplified using the Illumina Primer 1 (barcoded adapter with PstI overhang) and Illumina Primer 2 (common Y-adapter). .. For each sample, a total of 150 ng of genomic DNA was digested using the two-enzyme system, PstI (rare cutter) and Mse (common cutter) (New England Biolabs, Hitchin, UK), by incubating at 37 °C for 2 h. The ligation reaction was performed using the T4 DNA ligase enzyme (New England Biolabs, Hitchin, UK) at 22 °C for 30 min and the ligase was inactivated at 65 °C for 30 min. Ligated samples were pooled and PCR-amplified using the Illumina Primer 1 (barcoded adapter with PstI overhang) and Illumina Primer 2 (common Y-adapter).

    Article Title: Site-Directed Mutagenesis and Expression of the Soluble Form of the Family IIIa Cellulose Binding Domain from the Cellulosomal Scaffolding Protein of Clostridium cellulovorans
    Article Snippet: The CbpA-CBD gene was amplified by PCR with the primers CbpA-CBD N (from amino acid number 7 of the CbpA-CBD sequence) (Fig. ), which had a PstI site at its 5′ end, and primer CbpA-CBD C (from amino acid number 163) (Fig. ), which had an EcoRI site at its 5′ end. .. The amplified gene was inserted into the PstI and EcoRI sites of the vector pMAL p2x (New England Biolabs) to generate pMAL-CbpA-CBD.

    Article Title: Ca2+-Induced Two-Component System CvsSR Regulates the Type III Secretion System and the Extracytoplasmic Function Sigma Factor AlgU in Pseudomonas syringae pv. tomato DC3000
    Article Snippet: The products were gel purified using the Qiagen gel extraction miniprep kit (Qiagen), digested with HindIII (NEB) and PstI (NEB), and cloned into a pUC18miniTn 7 plasmid which had been digested with HindIII and PstI. .. The Δ cvsR P. syringae pv. tomato DC3000 strain was transformed through electroporation with pUC18miniTn 7 :: cvsR -3383 and the helper plasmid pTNS2.

    Article Title: The Presence of the Internalin Gene in Natural Atypically Hemolytic Listeria innocua Strains Suggests Descent from L. monocytogenes
    Article Snippet: Between 250 and 500 ng of genomic DNA was digested overnight with 5 U of MspI, NheI, or PstI (NEB) (20-μl reaction mixture volume) and heat inactivated at 85°C for 1 h. T4 DNA ligase (2 U) (NEB) and its corresponding buffer were added to the digest mixture to bring the volume to 25 μl. .. The ligation product was used as the template for an inverse PCR with inlA- specific primers.

    Sonication:

    Article Title: Characterization of a Brg1 hypomorphic allele demonstrates that genetic and biochemical activity are tightly correlated
    Article Snippet: Mononucleosomes were assembled according to the “salt-jump” method , in the presence of core histones from HeLa cells (Active Motif) and sonicated calf-thymus carrier DNA. .. Gel-purified mononucleosomes ( < 1 nM) were incubated with either 2 mM ATP or ATPγS and saturating amounts (100 ng) of wild-type or mutant BRG1 proteins in 20 µL reactions containing 12 mM HEPES-KOH [pH 7.9], 2 mM Tris-Cl [pH 7.6], 60 mM KCl, 8 mM NaCl, 4 mM MgCl2, 0.2 mM dithiothreitol, 0.06 mg/mL bovine serum albumin (BSA), 0.02% Igepal-CA380, 3% glycerol, and 0.5 Units/µL PstI enzyme (NEB) for 0.25, 3.5, 10, 30 or 60 min. at 30 °C.

    Binding Assay:

    Article Title: The Two-Component System PhoPR of Clostridium acetobutylicum Is Involved in Phosphate-Dependent Gene Regulation
    Article Snippet: Paragraph title: Construction of plasmids expressing PhoP N-terminally fused to a streptavidin tag (PhoP Strep- Tag) or truncated PhoR C-terminally fused to maltose binding protein (MBP-*PhoR). ... After PstI (MBI Fermentas GmbH, St. Leon-Rot, Germany) and BamHI (Invitrogen Life Technologies GmbH, Karlsruhe, Germany) digestion of the amplificates, the * phoR fragment was ligated into PstI- and BamHI-digested, dephosphorylated pMAL-c2X (NEB, Frankfurt/Main, Germany) and the phoP fragment was ligated into the equally treated vector pASK-IBA2 (IBA GmbH, Göttingen, Germany), resulting in plasmids pTF5 and pMM15, respectively.

    Article Title: miR-155 targets Caspase-3 mRNA in activated macrophages
    Article Snippet: Sequences of primers for cloning, RT-PCR and qPCR and, sequences of Northern blot probes, as well as antagomirs (all Eurofins Genomics) and mRNA mimics (biomers.net) are listed in the Supplemental Material (Table S1). .. For cloning of Firefly LUCIFERASE (fLUC) reporter constructs 466 bp of the CASP-3 and 464 bp or of the IKKε 3'UTR, each containing the miR-155 binding site were cloned into Pst1 / Xho1 (NEB, #R0140S, #R0146S) in the pBluescript II KS (+)-LUC poly(A), which was described previously in. .. To generate reporter constructs containing 4 bp substitutions in the respective miR-155 target site, site-directed mutagenesis was performed.

    Mutagenesis:

    Article Title: p53, a Target of Estrogen Receptor (ER) ?, Modulates DNA Damage-induced Growth Suppression in ER-positive Breast Cancer Cells
    Article Snippet: To generate pGL2 luciferase reporters under control of the p53 promoter (nucleotides (nt) −1998 to +73 designated p53-P-2kb and nt −593 to +73 designated p53-P-593), genomic DNA fragments were amplified from MCF7 cells with forward primer 5′-AT GGGTACC AAGTGTAGGGCTAGGGCTG-3′ or 5′-TT GGTACC GCTTCAGACCTGTCTCCCTCATTC-3′ and reverse primer 5′-ACT CTCGAG TGGCTCTAGACTTTTGAGAAGCTC-3′. p53 promoter internal deletion mutants were generated by a PstI and PvuII (New England Biolabs) restriction enzyme digest and religation according to the manufacturer's instructions and designated p53-P-PstI and p53-P-PvuII, respectively. .. To generate pGL2 luciferase reporters under control of the p53 promoter (nucleotides (nt) −1998 to +73 designated p53-P-2kb and nt −593 to +73 designated p53-P-593), genomic DNA fragments were amplified from MCF7 cells with forward primer 5′-AT GGGTACC AAGTGTAGGGCTAGGGCTG-3′ or 5′-TT GGTACC GCTTCAGACCTGTCTCCCTCATTC-3′ and reverse primer 5′-ACT CTCGAG TGGCTCTAGACTTTTGAGAAGCTC-3′. p53 promoter internal deletion mutants were generated by a PstI and PvuII (New England Biolabs) restriction enzyme digest and religation according to the manufacturer's instructions and designated p53-P-PstI and p53-P-PvuII, respectively.

    Article Title: Characterization of a Brg1 hypomorphic allele demonstrates that genetic and biochemical activity are tightly correlated
    Article Snippet: Mononucleosomes were incubated at 37 °C for 1–2 h prior to use. .. Gel-purified mononucleosomes ( < 1 nM) were incubated with either 2 mM ATP or ATPγS and saturating amounts (100 ng) of wild-type or mutant BRG1 proteins in 20 µL reactions containing 12 mM HEPES-KOH [pH 7.9], 2 mM Tris-Cl [pH 7.6], 60 mM KCl, 8 mM NaCl, 4 mM MgCl2, 0.2 mM dithiothreitol, 0.06 mg/mL bovine serum albumin (BSA), 0.02% Igepal-CA380, 3% glycerol, and 0.5 Units/µL PstI enzyme (NEB) for 0.25, 3.5, 10, 30 or 60 min. at 30 °C. .. Reactions were quenched by the addition of 1.6 volumes of 20 mM Tris-Cl [pH 7.6], 70 mM EDTA, 2% SDS, 0.2 mg/mL xylene cynanole, 0.2 mg/mL bromophenol blue, 0.2 mg/mL proteinase K, and 10% glycerol, followed by a 1 h incubation at 37 °C.

    Isolation:

    Article Title: Origin of year-long bean (Phaseolus dumosus Macfady, Fabaceae) from reticulated hybridization events between multiple Phaseolus species
    Article Snippet: Genomic DNA was isolated for inclusion in the Phaseolus DArT array ( ). .. DNA was isolated from single plants following a proteinase protocol ( ) and DNA quality tested by digestion with HindIII and PstI (New England Biolabs) according to the manufacturer’s instructions. .. Digested and non-digested DNA was run on 1 % w/v agarose electrophoresis gels and visualized under UV using a Syngene Gel Genius Bio Imaging System.

    Article Title: The Response to 2-Aminoacrylate Differs in Escherichia coli and Salmonella enterica, despite Shared Metabolic Components
    Article Snippet: The amplification product was purified, digested with EcoRI and PstI (New England BioLabs), and ligated into predigested pBAD24 ( ) to generate pAB1. .. The ligation mixture was transformed into E. coli DH5α, and chloramphenicol-resistant (Cmr ) colonies were selected.

    Article Title: Correlation of Phenotype with the Genotype of Egg-Contaminating Salmonella enterica Serovar Enteritidis
    Article Snippet: We used a two-enzyme restriction method that isolated the E. coli rrnB gene probe (accession number ) as a 7.5-kb BamHI digestion fragment from pkk3535 ( , ). .. The restriction enzymes used to compare the PT13A strains were SphI (5 U) and PstI (20 U) (New England Biolabs, Beverly, Mass.).

    Article Title: The Presence of the Internalin Gene in Natural Atypically Hemolytic Listeria innocua Strains Suggests Descent from L. monocytogenes
    Article Snippet: Listeria cells were harvested from 24-h cultures (5 ml), and genomic DNA was isolated using a DNeasy kit (QIAGEN) according to the manufacturer's recommendations. .. Between 250 and 500 ng of genomic DNA was digested overnight with 5 U of MspI, NheI, or PstI (NEB) (20-μl reaction mixture volume) and heat inactivated at 85°C for 1 h. T4 DNA ligase (2 U) (NEB) and its corresponding buffer were added to the digest mixture to bring the volume to 25 μl.

    Luciferase:

    Article Title: p53, a Target of Estrogen Receptor (ER) ?, Modulates DNA Damage-induced Growth Suppression in ER-positive Breast Cancer Cells
    Article Snippet: The pBabe-U6-sip53 construct expressing p53 shRNA was described previously ( ). .. To generate pGL2 luciferase reporters under control of the p53 promoter (nucleotides (nt) −1998 to +73 designated p53-P-2kb and nt −593 to +73 designated p53-P-593), genomic DNA fragments were amplified from MCF7 cells with forward primer 5′-AT GGGTACC AAGTGTAGGGCTAGGGCTG-3′ or 5′-TT GGTACC GCTTCAGACCTGTCTCCCTCATTC-3′ and reverse primer 5′-ACT CTCGAG TGGCTCTAGACTTTTGAGAAGCTC-3′. p53 promoter internal deletion mutants were generated by a PstI and PvuII (New England Biolabs) restriction enzyme digest and religation according to the manufacturer's instructions and designated p53-P-PstI and p53-P-PvuII, respectively. .. To generate individual wild-type or mutant estrogen response element (ERE) half-sites cloned upstream of the minimum c- fos promoter in the luciferase reporter OFLuc reporter vector , genomic DNA fragments were amplified from MCF7 cells with the following primer sets: −1828, forward primer 5′-GGGG AAGCTT TGAAAATCTCGGGGGT GGTCA G-3′ and reverse primer 5′-GGGG AGATCT TCGATTTCTCAGTGGTTCCTGGTCAG-3′; −1828M, forward primer 5′-GGGG AAGCTT TGAAAATCTCGGGGGT GTACA G-3′ and reverse primer 5′-GGGG AGATCT TCGATTTCTCAGTGGTTCCTGTACAG; −1611, forward primer 5′-GGGG AAGCTT AGGCCTGGAGAAGTG GGTCT -3′ and reverse primer 5′-GGGG AGATCT TAAGTGGTGATGGCAG-3′; −1611M, forward primer 5′-GGG AAGCTT AGGCCTGGAGAAGTG GTACT CAGGATT-3′ and reverse primer 5′-GGGG AGATCT TAGCTCCGGACTGCTGTACTTCAGTAC-3′; −1248, forward primer 5′-GGGG AAGCTT AGCCACAGGATCTGG GGACA -3′ and reverse primer 5′-GGGG AGATCT CACGCTTCCCCGATGA-3′; and −1224, forward primer 5′-GCGG AAGCTT CAGTTCAGAGTCC-3′ and reverse primer 5′-GGGC AGATCT TAGCTCCGGACTGCTG-3′.

    Article Title: miR-155 targets Caspase-3 mRNA in activated macrophages
    Article Snippet: Sequences of primers for cloning, RT-PCR and qPCR and, sequences of Northern blot probes, as well as antagomirs (all Eurofins Genomics) and mRNA mimics (biomers.net) are listed in the Supplemental Material (Table S1). .. For cloning of Firefly LUCIFERASE (fLUC) reporter constructs 466 bp of the CASP-3 and 464 bp or of the IKKε 3'UTR, each containing the miR-155 binding site were cloned into Pst1 / Xho1 (NEB, #R0140S, #R0146S) in the pBluescript II KS (+)-LUC poly(A), which was described previously in. .. To generate reporter constructs containing 4 bp substitutions in the respective miR-155 target site, site-directed mutagenesis was performed.

    Size-exclusion Chromatography:

    Article Title: FOXP3 Allelic Variants and Haplotype Structures Are Associated with Aggressive Breast Cancer Subtypes
    Article Snippet: The cycling protocol, used to both FOXP3 polymorphisms, was a denaturation at 94°C for 5 min, 35 cycles of 45 sec at 94°C, 45 sec at 59°C to g.10403A > G or 65°C to g.8048A > C, 45 sec at 72°C, and 10 min of final elongation at 72°C. .. PCR products (5 μ L) of g.10403A > G, with 249 bp, were digested overnight at 55°C with 1 unit/reaction of BsmBI restriction endonuclease (New England Biolabs, Beverly, USA), generating two fragments of 132 bp and 117 bp corresponding to allele G. The PCR products (6 μ L) of g.8048A > C, with 155 bp, were digested overnight at 37°C with 2 units/reaction of PstI restriction endonuclease (New England Biolabs, Beverly, USA), generating two fragments of 80 bp and 75 bp that correspond to allele C. All PCR and digested products were analyzed on polyacrylamide gel (10%), stained with silver nitrate.

    Labeling:

    Article Title: Characterization of a Brg1 hypomorphic allele demonstrates that genetic and biochemical activity are tightly correlated
    Article Snippet: Chromatin remodeling assays were performed as previously described., A mononuclesome positioning DNA fragment from the pTPT plasmid was internally labeled with dCTP [α32 P] by PCR using the following primers: (F) ACGCGTCGGT GTTAGAGC and (R) GAATTCTCTA GACAGTGTC CCA. .. Gel-purified mononucleosomes ( < 1 nM) were incubated with either 2 mM ATP or ATPγS and saturating amounts (100 ng) of wild-type or mutant BRG1 proteins in 20 µL reactions containing 12 mM HEPES-KOH [pH 7.9], 2 mM Tris-Cl [pH 7.6], 60 mM KCl, 8 mM NaCl, 4 mM MgCl2, 0.2 mM dithiothreitol, 0.06 mg/mL bovine serum albumin (BSA), 0.02% Igepal-CA380, 3% glycerol, and 0.5 Units/µL PstI enzyme (NEB) for 0.25, 3.5, 10, 30 or 60 min. at 30 °C.

    Purification:

    Article Title: Characterization of a Brg1 hypomorphic allele demonstrates that genetic and biochemical activity are tightly correlated
    Article Snippet: Crude mononucleosome assemblies were gel-fractionated by 5%-Tris-EDTA [pH 7.6] acrylamide electrophoresis at 4 °C, and then gel purified by diffusion in 10 mM Tris-Cl [pH 7.6], 0.2 mM EDTA, 40 mM NaCl, 0.01% Igepal-CA380, 0.5 mM phenylmethylsulfonyl fluoride at 4 °C for 12–18 h. Mononucleosome assemblies were concentrated by centrifugation, and then stored at 4°C in gel elution buffer supplemented with 15% glycerol, 0.3 mg/mL bovine serum albumin (BSA), 0.1% Igepal-CA380, and 1 mM dithiothreitol. .. Gel-purified mononucleosomes ( < 1 nM) were incubated with either 2 mM ATP or ATPγS and saturating amounts (100 ng) of wild-type or mutant BRG1 proteins in 20 µL reactions containing 12 mM HEPES-KOH [pH 7.9], 2 mM Tris-Cl [pH 7.6], 60 mM KCl, 8 mM NaCl, 4 mM MgCl2, 0.2 mM dithiothreitol, 0.06 mg/mL bovine serum albumin (BSA), 0.02% Igepal-CA380, 3% glycerol, and 0.5 Units/µL PstI enzyme (NEB) for 0.25, 3.5, 10, 30 or 60 min. at 30 °C.

    Article Title: Mutant Alleles of lptD Increase the Permeability of Pseudomonas aeruginosa and Define Determinants of Intrinsic Resistance to Antibiotics
    Article Snippet: All DNA was purified using either the QIAprep spin miniprep kit, DNeasy blood and tissue kit, QIAquick gel extraction kit, or QIAquick PCR purification kit (Qiagen, Valencia, CA). .. Phusion high-fidelity polymerase and restriction enzymes PstI and BamHI were from New England BioLabs (Ipswitch, MA).

    Article Title: Ca2+-Induced Two-Component System CvsSR Regulates the Type III Secretion System and the Extracytoplasmic Function Sigma Factor AlgU in Pseudomonas syringae pv. tomato DC3000
    Article Snippet: Briefly a genomic fragment containing cvsR , PSPTO_3382, and PSPTO_3383 was amplified via PCR. .. The products were gel purified using the Qiagen gel extraction miniprep kit (Qiagen), digested with HindIII (NEB) and PstI (NEB), and cloned into a pUC18miniTn 7 plasmid which had been digested with HindIII and PstI. .. The resulting ligation was transformed into DH5α E. coli cells.

    Article Title: The Response to 2-Aminoacrylate Differs in Escherichia coli and Salmonella enterica, despite Shared Metabolic Components
    Article Snippet: The ilvA219 allele, encoding the feedback-resistant variant IlvAL447F , was amplified from S. enterica by PCR with Q5 high-fidelity DNA polymerase (New England BioLabs) using primers AB1 and AB2 ( ). .. The amplification product was purified, digested with EcoRI and PstI (New England BioLabs), and ligated into predigested pBAD24 ( ) to generate pAB1. .. The cat gene, encoding chloramphenicol acetyltransferase, including the promoter, was amplified from pSU18 ( ) by PCR using Q5 high-fidelity DNA polymerase (New England BioLabs) and primers AB3 and AB4.

    Article Title: Super-resolution optical DNA Mapping via DNA methyltransferase-directed click chemistry
    Article Snippet: Clones for the M.BsaHI, M.XbaI, M.PvuII and M.PstI enzymes were a kind gift from New England Biolabs Inc. .. Clones for the M.BsaHI, M.XbaI, M.PvuII and M.PstI enzymes were a kind gift from New England Biolabs Inc.

    Article Title: XLF-Cernunnos promotes DNA ligase IV-XRCC4 re-adenylation following ligation
    Article Snippet: The complexes were incubated in the presence of purified XLF or 0.1 µg/ml of BSA and α-32 P-ATP (2 µCi, 66 nM final concentration) (GE Healthcare, Buckinghamshire, UK). .. For ligations, a 445-bp DNA fragment was produced from Bluescript plasmid (Stratagene) by digestion with PstI and AflIII (New England Biolabs).

    Polymerase Chain Reaction:

    Article Title: FOXP3 Allelic Variants and Haplotype Structures Are Associated with Aggressive Breast Cancer Subtypes
    Article Snippet: The cycling protocol, used to both FOXP3 polymorphisms, was a denaturation at 94°C for 5 min, 35 cycles of 45 sec at 94°C, 45 sec at 59°C to g.10403A > G or 65°C to g.8048A > C, 45 sec at 72°C, and 10 min of final elongation at 72°C. .. PCR products (5 μ L) of g.10403A > G, with 249 bp, were digested overnight at 55°C with 1 unit/reaction of BsmBI restriction endonuclease (New England Biolabs, Beverly, USA), generating two fragments of 132 bp and 117 bp corresponding to allele G. The PCR products (6 μ L) of g.8048A > C, with 155 bp, were digested overnight at 37°C with 2 units/reaction of PstI restriction endonuclease (New England Biolabs, Beverly, USA), generating two fragments of 80 bp and 75 bp that correspond to allele C. All PCR and digested products were analyzed on polyacrylamide gel (10%), stained with silver nitrate. .. FOXP3 haplotypes were determined based on the genotypes of all study participants using PHASE software version 2.1.1 [ , ].

    Article Title: The NRP1 migraine risk variant shows evidence of association with menstrual migraine
    Article Snippet: For rs12845494 and rs2506142, restriction fragment length polymorphism (RFLP) assays were used. .. This involved amplification of the targeted loci using a standard PCR protocol followed by digestion with the restriction enzymes Pst I (NEB #R0140S) for rs12845494, and Bsm AI (NEB #R0529L) for rs2506142. .. The PCR product for rs12845494 was added to a master mix of Pst I enzyme with NEBuffer 3.1 and incubated at 37 °C for 16 h. For rs2056142, the PCR product was added to a master mix of Bsm AI with SmartCutter® and incubated for an hour at 55 °C.

    Article Title: A phylogenetic framework of the legume genus Aeschynomene for comparative genetic analysis of the Nod-dependent and Nod-independent symbioses
    Article Snippet: A GBS library was constructed based on a protocol described [ ]. .. For each sample, a total of 150 ng of genomic DNA was digested using the two-enzyme system, PstI (rare cutter) and Mse (common cutter) (New England Biolabs, Hitchin, UK), by incubating at 37 °C for 2 h. The ligation reaction was performed using the T4 DNA ligase enzyme (New England Biolabs, Hitchin, UK) at 22 °C for 30 min and the ligase was inactivated at 65 °C for 30 min. Ligated samples were pooled and PCR-amplified using the Illumina Primer 1 (barcoded adapter with PstI overhang) and Illumina Primer 2 (common Y-adapter). .. The library was sequenced on an Illumina HiSeq 3000 (1 × 150 pb) (at the Get-PlaGe platform in Toulouse, France).

    Article Title: The Two-Component System PhoPR of Clostridium acetobutylicum Is Involved in Phosphate-Dependent Gene Regulation
    Article Snippet: Primers PhoP2-5BamHI-B and PhoP2-3PstI-A (Table ) were used for PCR amplification of phoP . .. After PstI (MBI Fermentas GmbH, St. Leon-Rot, Germany) and BamHI (Invitrogen Life Technologies GmbH, Karlsruhe, Germany) digestion of the amplificates, the * phoR fragment was ligated into PstI- and BamHI-digested, dephosphorylated pMAL-c2X (NEB, Frankfurt/Main, Germany) and the phoP fragment was ligated into the equally treated vector pASK-IBA2 (IBA GmbH, Göttingen, Germany), resulting in plasmids pTF5 and pMM15, respectively.

    Article Title: Characterization of a Brg1 hypomorphic allele demonstrates that genetic and biochemical activity are tightly correlated
    Article Snippet: Chromatin remodeling assays were performed as previously described., A mononuclesome positioning DNA fragment from the pTPT plasmid was internally labeled with dCTP [α32 P] by PCR using the following primers: (F) ACGCGTCGGT GTTAGAGC and (R) GAATTCTCTA GACAGTGTC CCA. .. Gel-purified mononucleosomes ( < 1 nM) were incubated with either 2 mM ATP or ATPγS and saturating amounts (100 ng) of wild-type or mutant BRG1 proteins in 20 µL reactions containing 12 mM HEPES-KOH [pH 7.9], 2 mM Tris-Cl [pH 7.6], 60 mM KCl, 8 mM NaCl, 4 mM MgCl2, 0.2 mM dithiothreitol, 0.06 mg/mL bovine serum albumin (BSA), 0.02% Igepal-CA380, 3% glycerol, and 0.5 Units/µL PstI enzyme (NEB) for 0.25, 3.5, 10, 30 or 60 min. at 30 °C.

    Article Title: Site-Directed Mutagenesis and Expression of the Soluble Form of the Family IIIa Cellulose Binding Domain from the Cellulosomal Scaffolding Protein of Clostridium cellulovorans
    Article Snippet: The genomic DNA of C. cellulovorans was prepared as described previously ( ) and used as a template for PCR. .. The amplified gene was inserted into the PstI and EcoRI sites of the vector pMAL p2x (New England Biolabs) to generate pMAL-CbpA-CBD.

    Article Title: Mutant Alleles of lptD Increase the Permeability of Pseudomonas aeruginosa and Define Determinants of Intrinsic Resistance to Antibiotics
    Article Snippet: All DNA was purified using either the QIAprep spin miniprep kit, DNeasy blood and tissue kit, QIAquick gel extraction kit, or QIAquick PCR purification kit (Qiagen, Valencia, CA). .. Phusion high-fidelity polymerase and restriction enzymes PstI and BamHI were from New England BioLabs (Ipswitch, MA).

    Article Title: Ca2+-Induced Two-Component System CvsSR Regulates the Type III Secretion System and the Extracytoplasmic Function Sigma Factor AlgU in Pseudomonas syringae pv. tomato DC3000
    Article Snippet: Briefly a genomic fragment containing cvsR , PSPTO_3382, and PSPTO_3383 was amplified via PCR. .. The products were gel purified using the Qiagen gel extraction miniprep kit (Qiagen), digested with HindIII (NEB) and PstI (NEB), and cloned into a pUC18miniTn 7 plasmid which had been digested with HindIII and PstI.

    Article Title: The Response to 2-Aminoacrylate Differs in Escherichia coli and Salmonella enterica, despite Shared Metabolic Components
    Article Snippet: The ilvA219 allele, encoding the feedback-resistant variant IlvAL447F , was amplified from S. enterica by PCR with Q5 high-fidelity DNA polymerase (New England BioLabs) using primers AB1 and AB2 ( ). .. The amplification product was purified, digested with EcoRI and PstI (New England BioLabs), and ligated into predigested pBAD24 ( ) to generate pAB1.

    Article Title: Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor
    Article Snippet: Synthetic full-length cry11Aa and cyt1Aa genes (GenBank accession nos. and ) and the different gene fragments were obtained by PCR with specific oligonucleotides designed with oligo 4 (Molecular Biology Insights, Cascade, CO) program (Tables 3 and 4, which are published as on the PNAS web site). .. The PCR products of cry11Aa gene amplification were digested with SacI and PstI restriction enzymes (New England Biolabs) and cloned into plasmid pHybLex/Zeo (Invitrogen). .. The PCR products of cyt1Aa gene were digested with KpnI and SphI and cloned into plasmid pYESTrp2 (Invitrogen).

    Article Title: The Presence of the Internalin Gene in Natural Atypically Hemolytic Listeria innocua Strains Suggests Descent from L. monocytogenes
    Article Snippet: Between 250 and 500 ng of genomic DNA was digested overnight with 5 U of MspI, NheI, or PstI (NEB) (20-μl reaction mixture volume) and heat inactivated at 85°C for 1 h. T4 DNA ligase (2 U) (NEB) and its corresponding buffer were added to the digest mixture to bring the volume to 25 μl. .. The ligation product was used as the template for an inverse PCR with inlA- specific primers.

    shRNA:

    Article Title: p53, a Target of Estrogen Receptor (ER) ?, Modulates DNA Damage-induced Growth Suppression in ER-positive Breast Cancer Cells
    Article Snippet: The pBabe-U6-sip53 construct expressing p53 shRNA was described previously ( ). .. To generate pGL2 luciferase reporters under control of the p53 promoter (nucleotides (nt) −1998 to +73 designated p53-P-2kb and nt −593 to +73 designated p53-P-593), genomic DNA fragments were amplified from MCF7 cells with forward primer 5′-AT GGGTACC AAGTGTAGGGCTAGGGCTG-3′ or 5′-TT GGTACC GCTTCAGACCTGTCTCCCTCATTC-3′ and reverse primer 5′-ACT CTCGAG TGGCTCTAGACTTTTGAGAAGCTC-3′. p53 promoter internal deletion mutants were generated by a PstI and PvuII (New England Biolabs) restriction enzyme digest and religation according to the manufacturer's instructions and designated p53-P-PstI and p53-P-PvuII, respectively.

    Staining:

    Article Title: FOXP3 Allelic Variants and Haplotype Structures Are Associated with Aggressive Breast Cancer Subtypes
    Article Snippet: The cycling protocol, used to both FOXP3 polymorphisms, was a denaturation at 94°C for 5 min, 35 cycles of 45 sec at 94°C, 45 sec at 59°C to g.10403A > G or 65°C to g.8048A > C, 45 sec at 72°C, and 10 min of final elongation at 72°C. .. PCR products (5 μ L) of g.10403A > G, with 249 bp, were digested overnight at 55°C with 1 unit/reaction of BsmBI restriction endonuclease (New England Biolabs, Beverly, USA), generating two fragments of 132 bp and 117 bp corresponding to allele G. The PCR products (6 μ L) of g.8048A > C, with 155 bp, were digested overnight at 37°C with 2 units/reaction of PstI restriction endonuclease (New England Biolabs, Beverly, USA), generating two fragments of 80 bp and 75 bp that correspond to allele C. All PCR and digested products were analyzed on polyacrylamide gel (10%), stained with silver nitrate. .. FOXP3 haplotypes were determined based on the genotypes of all study participants using PHASE software version 2.1.1 [ , ].

    T-Test:

    Article Title: Characterization of a Brg1 hypomorphic allele demonstrates that genetic and biochemical activity are tightly correlated
    Article Snippet: Gel-purified mononucleosomes ( < 1 nM) were incubated with either 2 mM ATP or ATPγS and saturating amounts (100 ng) of wild-type or mutant BRG1 proteins in 20 µL reactions containing 12 mM HEPES-KOH [pH 7.9], 2 mM Tris-Cl [pH 7.6], 60 mM KCl, 8 mM NaCl, 4 mM MgCl2, 0.2 mM dithiothreitol, 0.06 mg/mL bovine serum albumin (BSA), 0.02% Igepal-CA380, 3% glycerol, and 0.5 Units/µL PstI enzyme (NEB) for 0.25, 3.5, 10, 30 or 60 min. at 30 °C. .. Gel-purified mononucleosomes ( < 1 nM) were incubated with either 2 mM ATP or ATPγS and saturating amounts (100 ng) of wild-type or mutant BRG1 proteins in 20 µL reactions containing 12 mM HEPES-KOH [pH 7.9], 2 mM Tris-Cl [pH 7.6], 60 mM KCl, 8 mM NaCl, 4 mM MgCl2, 0.2 mM dithiothreitol, 0.06 mg/mL bovine serum albumin (BSA), 0.02% Igepal-CA380, 3% glycerol, and 0.5 Units/µL PstI enzyme (NEB) for 0.25, 3.5, 10, 30 or 60 min. at 30 °C.

    In Situ Hybridization:

    Article Title: PDGF mediates TGF?-induced migration during development of the spinous process
    Article Snippet: Paragraph title: In situ hybridization ... The templates were linearized by restriction enzymes NcoI or PstI following the manufacture’s protocol (NEB).

    Plasmid Preparation:

    Article Title: p53, a Target of Estrogen Receptor (ER) ?, Modulates DNA Damage-induced Growth Suppression in ER-positive Breast Cancer Cells
    Article Snippet: The resulting vector was designated pBabe-H1-siERα. .. To generate pGL2 luciferase reporters under control of the p53 promoter (nucleotides (nt) −1998 to +73 designated p53-P-2kb and nt −593 to +73 designated p53-P-593), genomic DNA fragments were amplified from MCF7 cells with forward primer 5′-AT GGGTACC AAGTGTAGGGCTAGGGCTG-3′ or 5′-TT GGTACC GCTTCAGACCTGTCTCCCTCATTC-3′ and reverse primer 5′-ACT CTCGAG TGGCTCTAGACTTTTGAGAAGCTC-3′. p53 promoter internal deletion mutants were generated by a PstI and PvuII (New England Biolabs) restriction enzyme digest and religation according to the manufacturer's instructions and designated p53-P-PstI and p53-P-PvuII, respectively.

    Article Title: The Two-Component System PhoPR of Clostridium acetobutylicum Is Involved in Phosphate-Dependent Gene Regulation
    Article Snippet: PCRs were carried out with Pwo DNA polymerase (PeqLab Biotechnologie GmbH, Erlangen, Germany) and chromosomal DNA of C. acetobutylicum ATCC 824 as the template. .. After PstI (MBI Fermentas GmbH, St. Leon-Rot, Germany) and BamHI (Invitrogen Life Technologies GmbH, Karlsruhe, Germany) digestion of the amplificates, the * phoR fragment was ligated into PstI- and BamHI-digested, dephosphorylated pMAL-c2X (NEB, Frankfurt/Main, Germany) and the phoP fragment was ligated into the equally treated vector pASK-IBA2 (IBA GmbH, Göttingen, Germany), resulting in plasmids pTF5 and pMM15, respectively. .. A preculture of E. coli BL21CodonPlus(DE3)-RIL (pTF5) was grown in LB medium enriched with 2% (wt/vol) glucose overnight at 37°C with shaking and then inoculated into 200 ml of the same medium at a ratio of 1:100.

    Article Title: Characterization of a Brg1 hypomorphic allele demonstrates that genetic and biochemical activity are tightly correlated
    Article Snippet: Chromatin remodeling assays were performed as previously described., A mononuclesome positioning DNA fragment from the pTPT plasmid was internally labeled with dCTP [α32 P] by PCR using the following primers: (F) ACGCGTCGGT GTTAGAGC and (R) GAATTCTCTA GACAGTGTC CCA. .. Gel-purified mononucleosomes ( < 1 nM) were incubated with either 2 mM ATP or ATPγS and saturating amounts (100 ng) of wild-type or mutant BRG1 proteins in 20 µL reactions containing 12 mM HEPES-KOH [pH 7.9], 2 mM Tris-Cl [pH 7.6], 60 mM KCl, 8 mM NaCl, 4 mM MgCl2, 0.2 mM dithiothreitol, 0.06 mg/mL bovine serum albumin (BSA), 0.02% Igepal-CA380, 3% glycerol, and 0.5 Units/µL PstI enzyme (NEB) for 0.25, 3.5, 10, 30 or 60 min. at 30 °C.

    Article Title: Site-Directed Mutagenesis and Expression of the Soluble Form of the Family IIIa Cellulose Binding Domain from the Cellulosomal Scaffolding Protein of Clostridium cellulovorans
    Article Snippet: The genomic DNA of C. cellulovorans was prepared as described previously ( ) and used as a template for PCR. .. The amplified gene was inserted into the PstI and EcoRI sites of the vector pMAL p2x (New England Biolabs) to generate pMAL-CbpA-CBD. .. The CbpA-CBD expressed by this vector was fused with the N-terminal MBP.

    Article Title: miR-155 targets Caspase-3 mRNA in activated macrophages
    Article Snippet: Paragraph title: Plasmid construction ... For cloning of Firefly LUCIFERASE (fLUC) reporter constructs 466 bp of the CASP-3 and 464 bp or of the IKKε 3'UTR, each containing the miR-155 binding site were cloned into Pst1 / Xho1 (NEB, #R0140S, #R0146S) in the pBluescript II KS (+)-LUC poly(A), which was described previously in.

    Article Title: Ca2+-Induced Two-Component System CvsSR Regulates the Type III Secretion System and the Extracytoplasmic Function Sigma Factor AlgU in Pseudomonas syringae pv. tomato DC3000
    Article Snippet: Briefly a genomic fragment containing cvsR , PSPTO_3382, and PSPTO_3383 was amplified via PCR. .. The products were gel purified using the Qiagen gel extraction miniprep kit (Qiagen), digested with HindIII (NEB) and PstI (NEB), and cloned into a pUC18miniTn 7 plasmid which had been digested with HindIII and PstI. .. The resulting ligation was transformed into DH5α E. coli cells.

    Article Title: The Response to 2-Aminoacrylate Differs in Escherichia coli and Salmonella enterica, despite Shared Metabolic Components
    Article Snippet: The amplification product was purified, digested with EcoRI and PstI (New England BioLabs), and ligated into predigested pBAD24 ( ) to generate pAB1. .. The ligation mixture was transformed into E. coli DH5α, and chloramphenicol-resistant (Cmr ) colonies were selected.

    Article Title: PDGF mediates TGF?-induced migration during development of the spinous process
    Article Snippet: Probes for PDGFc were synthesized from cDNA, followed by the cloning using pGEM-T Easy Vector System (Promega). .. The templates were linearized by restriction enzymes NcoI or PstI following the manufacture’s protocol (NEB).

    Article Title: Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor
    Article Snippet: Synthetic full-length cry11Aa and cyt1Aa genes (GenBank accession nos. and ) and the different gene fragments were obtained by PCR with specific oligonucleotides designed with oligo 4 (Molecular Biology Insights, Cascade, CO) program (Tables 3 and 4, which are published as on the PNAS web site). .. The PCR products of cry11Aa gene amplification were digested with SacI and PstI restriction enzymes (New England Biolabs) and cloned into plasmid pHybLex/Zeo (Invitrogen). .. The PCR products of cyt1Aa gene were digested with KpnI and SphI and cloned into plasmid pYESTrp2 (Invitrogen).

    Article Title: Role for DNA Polymerase ? in the Processing ofN2-N2-Guanine Interstrand Cross-links
    Article Snippet: A circular single-stranded pMS2 vector (∼15 pmol) was digested with 40 units of EcoRV (New England Biolabs) for 3 h at 37°C to generate a linear DNA. .. The creation of double-stranded pMS2 was verified by PstI (New England Biolabs) digestion.

    Article Title: XLF-Cernunnos promotes DNA ligase IV-XRCC4 re-adenylation following ligation
    Article Snippet: The complexes were incubated in the presence of purified XLF or 0.1 µg/ml of BSA and α-32 P-ATP (2 µCi, 66 nM final concentration) (GE Healthcare, Buckinghamshire, UK). .. For ligations, a 445-bp DNA fragment was produced from Bluescript plasmid (Stratagene) by digestion with PstI and AflIII (New England Biolabs). .. For the reactions, the indicated amount of protein complexes were incubated for the indicated times in 20 µl of ligation reaction (50 mM triethanolamine, pH 7.5, 2 mM Mg(OAc)2 , 2 mM dithiothreitol, 0.1 mg/ml bovine serum albumin, 9% polyethylene glycol) with the labelled substrate and in the presence or absence of 2 mM ATP or AMPCPP.

    Software:

    Article Title: The NRP1 migraine risk variant shows evidence of association with menstrual migraine
    Article Snippet: SpectroTYPER software was used to automatically import and analyze the genotyping data with genotypes called based on the calculated mass of the extension products. .. This involved amplification of the targeted loci using a standard PCR protocol followed by digestion with the restriction enzymes Pst I (NEB #R0140S) for rs12845494, and Bsm AI (NEB #R0529L) for rs2506142.

    Recombinant:

    Article Title: Site-Directed Mutagenesis and Expression of the Soluble Form of the Family IIIa Cellulose Binding Domain from the Cellulosomal Scaffolding Protein of Clostridium cellulovorans
    Article Snippet: The amplified gene was inserted into the PstI and EcoRI sites of the vector pMAL p2x (New England Biolabs) to generate pMAL-CbpA-CBD. .. Then, E. coli TOP10 (Invitrogen) was transformed with the pMAL-CbpA-CBD.

    Article Title: Role for DNA Polymerase ? in the Processing ofN2-N2-Guanine Interstrand Cross-links
    Article Snippet: The creation of double-stranded pMS2 was verified by PstI (New England Biolabs) digestion. .. The creation of double-stranded pMS2 was verified by PstI (New England Biolabs) digestion.

    Spectrophotometry:

    Article Title: Origin of year-long bean (Phaseolus dumosus Macfady, Fabaceae) from reticulated hybridization events between multiple Phaseolus species
    Article Snippet: DNA was isolated from single plants following a proteinase protocol ( ) and DNA quality tested by digestion with HindIII and PstI (New England Biolabs) according to the manufacturer’s instructions. .. Digested and non-digested DNA was run on 1 % w/v agarose electrophoresis gels and visualized under UV using a Syngene Gel Genius Bio Imaging System.

    Produced:

    Article Title: XLF-Cernunnos promotes DNA ligase IV-XRCC4 re-adenylation following ligation
    Article Snippet: The complexes were incubated in the presence of purified XLF or 0.1 µg/ml of BSA and α-32 P-ATP (2 µCi, 66 nM final concentration) (GE Healthcare, Buckinghamshire, UK). .. For ligations, a 445-bp DNA fragment was produced from Bluescript plasmid (Stratagene) by digestion with PstI and AflIII (New England Biolabs). .. For the reactions, the indicated amount of protein complexes were incubated for the indicated times in 20 µl of ligation reaction (50 mM triethanolamine, pH 7.5, 2 mM Mg(OAc)2 , 2 mM dithiothreitol, 0.1 mg/ml bovine serum albumin, 9% polyethylene glycol) with the labelled substrate and in the presence or absence of 2 mM ATP or AMPCPP.

    Concentration Assay:

    Article Title: XLF-Cernunnos promotes DNA ligase IV-XRCC4 re-adenylation following ligation
    Article Snippet: The complexes were incubated in the presence of purified XLF or 0.1 µg/ml of BSA and α-32 P-ATP (2 µCi, 66 nM final concentration) (GE Healthcare, Buckinghamshire, UK). .. For ligations, a 445-bp DNA fragment was produced from Bluescript plasmid (Stratagene) by digestion with PstI and AflIII (New England Biolabs).

    Strep-tag:

    Article Title: The Two-Component System PhoPR of Clostridium acetobutylicum Is Involved in Phosphate-Dependent Gene Regulation
    Article Snippet: Paragraph title: Construction of plasmids expressing PhoP N-terminally fused to a streptavidin tag (PhoP Strep- Tag) or truncated PhoR C-terminally fused to maltose binding protein (MBP-*PhoR). ... After PstI (MBI Fermentas GmbH, St. Leon-Rot, Germany) and BamHI (Invitrogen Life Technologies GmbH, Karlsruhe, Germany) digestion of the amplificates, the * phoR fragment was ligated into PstI- and BamHI-digested, dephosphorylated pMAL-c2X (NEB, Frankfurt/Main, Germany) and the phoP fragment was ligated into the equally treated vector pASK-IBA2 (IBA GmbH, Göttingen, Germany), resulting in plasmids pTF5 and pMM15, respectively.

    Gel Extraction:

    Article Title: Mutant Alleles of lptD Increase the Permeability of Pseudomonas aeruginosa and Define Determinants of Intrinsic Resistance to Antibiotics
    Article Snippet: All DNA was purified using either the QIAprep spin miniprep kit, DNeasy blood and tissue kit, QIAquick gel extraction kit, or QIAquick PCR purification kit (Qiagen, Valencia, CA). .. Phusion high-fidelity polymerase and restriction enzymes PstI and BamHI were from New England BioLabs (Ipswitch, MA).

    Article Title: Ca2+-Induced Two-Component System CvsSR Regulates the Type III Secretion System and the Extracytoplasmic Function Sigma Factor AlgU in Pseudomonas syringae pv. tomato DC3000
    Article Snippet: Briefly a genomic fragment containing cvsR , PSPTO_3382, and PSPTO_3383 was amplified via PCR. .. The products were gel purified using the Qiagen gel extraction miniprep kit (Qiagen), digested with HindIII (NEB) and PstI (NEB), and cloned into a pUC18miniTn 7 plasmid which had been digested with HindIII and PstI. .. The resulting ligation was transformed into DH5α E. coli cells.

    Variant Assay:

    Article Title: The Response to 2-Aminoacrylate Differs in Escherichia coli and Salmonella enterica, despite Shared Metabolic Components
    Article Snippet: The ilvA219 allele, encoding the feedback-resistant variant IlvAL447F , was amplified from S. enterica by PCR with Q5 high-fidelity DNA polymerase (New England BioLabs) using primers AB1 and AB2 ( ). .. The amplification product was purified, digested with EcoRI and PstI (New England BioLabs), and ligated into predigested pBAD24 ( ) to generate pAB1.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs psti restriction enzyme
    Psti Restriction Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 72 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti restriction enzyme/product/New England Biolabs
    Average 99 stars, based on 72 article reviews
    Price from $9.99 to $1999.99
    psti restriction enzyme - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results