bsmi  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
    Name:
    BsmI
    Description:
    BsmI 2 500 units
    Catalog Number:
    r0134l
    Price:
    282
    Category:
    Restriction Enzymes
    Size:
    2 500 units
    		Buy from Supplier

    Structured Review

    New England Biolabs bsmi
    BsmI
    BsmI 2 500 units
    https://www.bioz.com/result/bsmi/product/New England Biolabs
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bsmi - by Bioz Stars, 2021-03
    93/100 stars

    Images

    1) Product Images from "Vitamin D Receptor Gene Polymorphisms and Prognosis of Breast Cancer among African-American and Hispanic Women"

    Article Title: Vitamin D Receptor Gene Polymorphisms and Prognosis of Breast Cancer among African-American and Hispanic Women

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0057967

    Five-year disease free survival (DFS) of breast cancer patients in relation to VDR gene polymorphisms. Kaplan-Meier survival curves were used to compare the 5-year DFS between the VDR gene polymorphisms in (a) VDR-FokI, (b) VDR-BsmI, (c) VDR-ApaI, and (d) VDR-TaqI. The differences between the curves were estimated by log-rank test, where P
    Figure Legend Snippet: Five-year disease free survival (DFS) of breast cancer patients in relation to VDR gene polymorphisms. Kaplan-Meier survival curves were used to compare the 5-year DFS between the VDR gene polymorphisms in (a) VDR-FokI, (b) VDR-BsmI, (c) VDR-ApaI, and (d) VDR-TaqI. The differences between the curves were estimated by log-rank test, where P

    Techniques Used:

    2) Product Images from "Genetic Case-Control Study for Eight Polymorphisms Associated with Rheumatoid Arthritis"

    Article Title: Genetic Case-Control Study for Eight Polymorphisms Associated with Rheumatoid Arthritis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0131960

    Pairwise LD Plot for the VDR SNPs. The ID of each SNP was taken as reference. The rs731236, rs7975232, rs1544410, and rs2228570 correspond to TaqI, ApaI, BsmI, and FokI respectively. (a) D′ values. (b) r 2 values. The plot was generated using the Haploview 4 . 2 program.
    Figure Legend Snippet: Pairwise LD Plot for the VDR SNPs. The ID of each SNP was taken as reference. The rs731236, rs7975232, rs1544410, and rs2228570 correspond to TaqI, ApaI, BsmI, and FokI respectively. (a) D′ values. (b) r 2 values. The plot was generated using the Haploview 4 . 2 program.

    Techniques Used: Generated

    3) Product Images from "Sensitive isothermal detection of nucleic-acid sequence by primer generation-rolling circle amplification"

    Article Title: Sensitive isothermal detection of nucleic-acid sequence by primer generation-rolling circle amplification

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkn1014

    Optimization of reaction conditions for PG–RCA. Threshold time in the presence (open circle) or absence (cross) of 500 zmol sample DNA was compared at various concentrations of each reaction component ( n =2). ( A ) At constant concentrations of Vent (exo-) DNA polymerase (0.4 U), Nb.BsmI (1 U) and circular probe II (7.5 nM), dNTP concentrations were compared among 400 (original), 40, 4 and 0.4 µM. ( B ) At constant concentrations of dNTP (400 µM), Nb.BsmI (1 U) and circular probe II (7.5 nM), Vent (exo-) polymerase concentrations were compared among 0.4 (original), 0.08, 0.04 and 0.02 U. ( C ) At constant concentrations of dNTP (400 µM), Vent (exo-) DNA polymerase (0.4 U) and circular probe II (7.5 nM), Nb.BsmI concentrations were compared among 1 (original), 0.5, 0.25 and 0.125 U. ( D ) At constant concentrations of dNTP (0.4 µM, 1000-fold dilution of the original concentration), Nb.BsmI (1 U) and circular probe II (7.5 nM), Vent (exo-) polymerase concentrations were compared among 0.4, 0.2, 0.1 and 0.05 U.
    Figure Legend Snippet: Optimization of reaction conditions for PG–RCA. Threshold time in the presence (open circle) or absence (cross) of 500 zmol sample DNA was compared at various concentrations of each reaction component ( n =2). ( A ) At constant concentrations of Vent (exo-) DNA polymerase (0.4 U), Nb.BsmI (1 U) and circular probe II (7.5 nM), dNTP concentrations were compared among 400 (original), 40, 4 and 0.4 µM. ( B ) At constant concentrations of dNTP (400 µM), Nb.BsmI (1 U) and circular probe II (7.5 nM), Vent (exo-) polymerase concentrations were compared among 0.4 (original), 0.08, 0.04 and 0.02 U. ( C ) At constant concentrations of dNTP (400 µM), Vent (exo-) DNA polymerase (0.4 U) and circular probe II (7.5 nM), Nb.BsmI concentrations were compared among 1 (original), 0.5, 0.25 and 0.125 U. ( D ) At constant concentrations of dNTP (0.4 µM, 1000-fold dilution of the original concentration), Nb.BsmI (1 U) and circular probe II (7.5 nM), Vent (exo-) polymerase concentrations were compared among 0.4, 0.2, 0.1 and 0.05 U.

    Techniques Used: Concentration Assay

    PG–RCA under optimized reaction condition. ( A ) Fluorescent intensity of PG–RCA reaction at the optimized reaction condition (0.4 µM dNTP, 0.05 U Vent (exo-) DNA polymerase, 1 U Nb.BsmI and 7.5 nM circular probe II) was monitored in real time. Sample DNA concentration in each reaction was prepared by 10-fold serial dilution from 5 fmol to 0.5 ymol and their signal amplification curves were indicated by colored lines (dark blue, blue, light blue, purple, dark green, green, brown, orange, yellow, red and gray, respectively) ( n =2). Negative controls are indicated by black lines ( n =2). ( B ) Threshold time ( T T ) was plotted against the sample DNA concentration (S) of the reaction. Solid line indicates linear least squares fitting between 5 fmol and 0.5 zmol sample DNA and its formulation is T T =−19.2 log 10 (S)+75.6 ( R 2 =0.998). Perforated line indicates average T T value of the negative controls. Limit of detection is 84.5 ymol or 50.7 molecules of sample DNA by calculation from the intersection of both lines.
    Figure Legend Snippet: PG–RCA under optimized reaction condition. ( A ) Fluorescent intensity of PG–RCA reaction at the optimized reaction condition (0.4 µM dNTP, 0.05 U Vent (exo-) DNA polymerase, 1 U Nb.BsmI and 7.5 nM circular probe II) was monitored in real time. Sample DNA concentration in each reaction was prepared by 10-fold serial dilution from 5 fmol to 0.5 ymol and their signal amplification curves were indicated by colored lines (dark blue, blue, light blue, purple, dark green, green, brown, orange, yellow, red and gray, respectively) ( n =2). Negative controls are indicated by black lines ( n =2). ( B ) Threshold time ( T T ) was plotted against the sample DNA concentration (S) of the reaction. Solid line indicates linear least squares fitting between 5 fmol and 0.5 zmol sample DNA and its formulation is T T =−19.2 log 10 (S)+75.6 ( R 2 =0.998). Perforated line indicates average T T value of the negative controls. Limit of detection is 84.5 ymol or 50.7 molecules of sample DNA by calculation from the intersection of both lines.

    Techniques Used: Concentration Assay, Serial Dilution, Amplification

    Real-time product analysis of PG–RCA. ( A ) Fluorescent intensity of PG–RCA reaction was monitored in real time. PG–RCA was conducted at 60°C with 400 µM each dNTP, 0.4 U Vent (exo-) DNA polymerase, 1 U Nb.BsmI and 7.5 nM circular probe II as described in Materials and methods section. Sample DNA concentration in each reaction was prepared by 10-fold serial dilution from 500 amol to 0.5 zmol, and their signal amplification curves were indicated by colored lines (blue, light blue, purple, dark green, green, brown and orange, respectively) ( n =3). Negative controls are indicated by black lines ( n =3). ( B ) Threshold time T T (the reaction time when fluorescent intensity of each reaction exceeds a threshold, indicated by a perforated line in Figure 3A) was plotted against the sample DNA concentration (S) of the reaction. Solid line indicates linear least squares fitting between 500 and 0.5 amol sample DNA and its formulation is T T =−8.65 log 10 (S)+28.5 (R 2 =0.997). Perforated line indicates average T T value of the negative controls. Limit of detection is 58.4 zmol or 3.50 × 10 4 molecules of sample DNA by calculation from the intersection of both lines.
    Figure Legend Snippet: Real-time product analysis of PG–RCA. ( A ) Fluorescent intensity of PG–RCA reaction was monitored in real time. PG–RCA was conducted at 60°C with 400 µM each dNTP, 0.4 U Vent (exo-) DNA polymerase, 1 U Nb.BsmI and 7.5 nM circular probe II as described in Materials and methods section. Sample DNA concentration in each reaction was prepared by 10-fold serial dilution from 500 amol to 0.5 zmol, and their signal amplification curves were indicated by colored lines (blue, light blue, purple, dark green, green, brown and orange, respectively) ( n =3). Negative controls are indicated by black lines ( n =3). ( B ) Threshold time T T (the reaction time when fluorescent intensity of each reaction exceeds a threshold, indicated by a perforated line in Figure 3A) was plotted against the sample DNA concentration (S) of the reaction. Solid line indicates linear least squares fitting between 500 and 0.5 amol sample DNA and its formulation is T T =−8.65 log 10 (S)+28.5 (R 2 =0.997). Perforated line indicates average T T value of the negative controls. Limit of detection is 58.4 zmol or 3.50 × 10 4 molecules of sample DNA by calculation from the intersection of both lines.

    Techniques Used: Concentration Assay, Serial Dilution, Amplification

    Endpoint product analysis of PG–RCA. ( A ) Endpoint products in the presence or absence of 500 amol sample DNA were analyzed on 1.0% agarose gel electrophoresis. The reaction was conducted at 60°C for 30, 45, 60, 75, 90, 105 and 120 min and each reaction was analyzed separately. Lane M was loaded with a 100 bp DNA marker (100, 200, 300, 400, 500/517, 600, 700, 800, 900, 1000, 1200 and 1517 bp from the bottom). ( B ) Endpoint products of 90-min reactions with all or partial reaction components were analyzed on 1.0% agarose gel electrophoresis. DNA, POL and NICK indicate sample DNA, Vent (exo-) DNA polymerase and Nb.BsmI, respectively. Lane M is a 100 bp DNA marker. ( C ) Endpoint product of a 120-min PG–RCA reaction was digested with either BsmI or BbvCI and analyzed on 1.5% agarose gel electrophoresis. Lane ‘-’ was loaded with the 120 min reaction product before restriction enzyme digestion. Lane M is a 100 bp DNA marker.
    Figure Legend Snippet: Endpoint product analysis of PG–RCA. ( A ) Endpoint products in the presence or absence of 500 amol sample DNA were analyzed on 1.0% agarose gel electrophoresis. The reaction was conducted at 60°C for 30, 45, 60, 75, 90, 105 and 120 min and each reaction was analyzed separately. Lane M was loaded with a 100 bp DNA marker (100, 200, 300, 400, 500/517, 600, 700, 800, 900, 1000, 1200 and 1517 bp from the bottom). ( B ) Endpoint products of 90-min reactions with all or partial reaction components were analyzed on 1.0% agarose gel electrophoresis. DNA, POL and NICK indicate sample DNA, Vent (exo-) DNA polymerase and Nb.BsmI, respectively. Lane M is a 100 bp DNA marker. ( C ) Endpoint product of a 120-min PG–RCA reaction was digested with either BsmI or BbvCI and analyzed on 1.5% agarose gel electrophoresis. Lane ‘-’ was loaded with the 120 min reaction product before restriction enzyme digestion. Lane M is a 100 bp DNA marker.

    Techniques Used: Agarose Gel Electrophoresis, Marker

    Real-time quantification of hly gene in L. monocytogenes genomic DNA by PG–RCA. ( A ) Circular probe LM for detection of pathogenic L. monocytogenes genomic DNA. The probe targets the complementary strand of virulence gene, hly (GeneBank GeneID 2797098), encoding a cholesterol-dependent cytolysin, listeriolysin O (LLO). Circular probe LM contains three repeats of a 26-base sequence complementary to the gene including a nicking site for Nb.BsmI. Since these repeat sequences have 5-base overlaps each other, the circular probe comprises three repeats of a 21-base sequence (red, blue and green). ( B ) Genomic DNA from L. monocytogenes (0.1–100 pg) was analyzed by real-time PG–RCA with circular probe LM. Threshold time ( T T ) was plotted against the L. monocytogenes genomic DNA concentration (S) of the reaction. Solid line indicates linear least squares fitting between 0.1 and 100 pg L. monocytogenes genomic DNA and its formulation is T T = −19.1 log 10 (S) + 233 ( R 2 =0.964). Perforated line indicates average T T value of the negative controls ( n =2). Limit of detection is 0.163 pg (∼60 molecules) of L. monocytogenes genomic DNA by calculation from the intersection of both lines. ( C ) Genomic DNA (100 pg) from L. monocytogenes , L. innocua , E. coli and S. enterica were analyzed by real-time PG–RCA with circular probe LM and their threshold times were compared with the values for L. monocytogenes (100 pg). ‘No DNA’ indicates the negative controls.
    Figure Legend Snippet: Real-time quantification of hly gene in L. monocytogenes genomic DNA by PG–RCA. ( A ) Circular probe LM for detection of pathogenic L. monocytogenes genomic DNA. The probe targets the complementary strand of virulence gene, hly (GeneBank GeneID 2797098), encoding a cholesterol-dependent cytolysin, listeriolysin O (LLO). Circular probe LM contains three repeats of a 26-base sequence complementary to the gene including a nicking site for Nb.BsmI. Since these repeat sequences have 5-base overlaps each other, the circular probe comprises three repeats of a 21-base sequence (red, blue and green). ( B ) Genomic DNA from L. monocytogenes (0.1–100 pg) was analyzed by real-time PG–RCA with circular probe LM. Threshold time ( T T ) was plotted against the L. monocytogenes genomic DNA concentration (S) of the reaction. Solid line indicates linear least squares fitting between 0.1 and 100 pg L. monocytogenes genomic DNA and its formulation is T T = −19.1 log 10 (S) + 233 ( R 2 =0.964). Perforated line indicates average T T value of the negative controls ( n =2). Limit of detection is 0.163 pg (∼60 molecules) of L. monocytogenes genomic DNA by calculation from the intersection of both lines. ( C ) Genomic DNA (100 pg) from L. monocytogenes , L. innocua , E. coli and S. enterica were analyzed by real-time PG–RCA with circular probe LM and their threshold times were compared with the values for L. monocytogenes (100 pg). ‘No DNA’ indicates the negative controls.

    Techniques Used: Sequencing, Concentration Assay

    4) Product Images from "Association of vitamin D receptor gene BsmI (A > G) and FokI (C > T) polymorphism in gestational diabetes among Saudi Women"

    Article Title: Association of vitamin D receptor gene BsmI (A > G) and FokI (C > T) polymorphism in gestational diabetes among Saudi Women

    Journal: Pakistan Journal of Medical Sciences

    doi: 10.12669/pjms.316.7525

    2% agarose gel electrophoresis of VDR PCR for [A] VDR SNPs BsmI enzyme showing a wild type bb 822bp product [B] VDR SNPs FokI enzyme showing a wild type ff 265bp product. Lane 1: 100bp DNA ladder, Lanes 2-10: PCR product DNA. PCR: polymerase chain reaction; SNPs: single nucleotide polymorphism; VDR: vitamin D receptor.
    Figure Legend Snippet: 2% agarose gel electrophoresis of VDR PCR for [A] VDR SNPs BsmI enzyme showing a wild type bb 822bp product [B] VDR SNPs FokI enzyme showing a wild type ff 265bp product. Lane 1: 100bp DNA ladder, Lanes 2-10: PCR product DNA. PCR: polymerase chain reaction; SNPs: single nucleotide polymorphism; VDR: vitamin D receptor.

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction

    5) Product Images from "Sclera-related gene polymorphisms in high myopia"

    Article Title: Sclera-related gene polymorphisms in high myopia

    Journal: Molecular Vision

    doi:

    The PCR product of FMOD exon 2 codon 79 genetic polymorphism. The PCR product of FMOD exon 2 codon 79 genetic polymorphism was digested with BsmI. The “ G ” allele was 1,033 bp and the “ A ” allele was 751 bp + 282 bp.
    Figure Legend Snippet: The PCR product of FMOD exon 2 codon 79 genetic polymorphism. The PCR product of FMOD exon 2 codon 79 genetic polymorphism was digested with BsmI. The “ G ” allele was 1,033 bp and the “ A ” allele was 751 bp + 282 bp.

    Techniques Used: Polymerase Chain Reaction

    6) Product Images from "Interaction of Vitamin D Receptor with HLA DRB1*0301 in Type 1 Diabetes Patients from North India"

    Article Title: Interaction of Vitamin D Receptor with HLA DRB1*0301 in Type 1 Diabetes Patients from North India

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0008023

    The genotypes for the four SNPs were determined by PCR amplification and restriction digestion of the PCR products with enzymes FokI, BsmI, ApaI , and TaqI . A: Fok1 digestion: SNP C/T in exon 2 was studied by amplifying a 265 bp fragment using primers 5′AGCTGGCCCTGGCACTGACTCTTGCTCT 3′ and 5′ATGGAAACACCTTGCTTCTTCTCCCTC 3′ with 68°C as annealing temperature and digestion by fok1 at 37°C for 3 hours. Presence of restriction site is denoted by ‘f’ while absence of restriction is denoted by ‘F’. Results show FF (CC) i.e., a 265 bp band or Ff (CT) i.e., 265 bp, 196 bp and 69 bp, bands, ff (TT) i.e., 196 bp and 69 bp bands. M is the100 bp ladder. B: Bsm 1 digestion: SNP A/G in Intron 8 was studied by amplifying an 825 bp fragment using primers 5′CAACCAAGACTACAAGTACCGCGTCAGTGA 3′ and 5′AACCAGCGGGAAGAGGTCAAGGG 3′ with 65°C as annealing temperature and digestion by Bsm1 at 65°C for one hour. Presence of restriction site is denoted as ‘b’ and absence of restriction is denoted by ‘B’. The results show BB (AA) i.e., 825 bp band, Bb (AG) i.e., 825 bp, 650 bp and 175 bp and bands and bb (GG) 650 bp and 175 bp bands. M is 25 bp ladder. C: Apa 1 digestion: SNP T/G in Intron 8 was studied by amplifying an 740 bp fragment using primers 5′ CAGAGCATGGACAGGGAGCAAG 3′ and 5′ GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65°C as annealing temperature and digestion by Apa1 at 37°C for one hour. Presence of restriction site is denoted as ‘a; and absence of restriction is denoted by ‘A’. The results show AA (TT) i.e., 740 bp band, Aa (TG) i.e., 740 bp, 520 bp and 220 bp bands and aa (GG) 520 bp and 220 bp bands. M is 100 bp ladder. D: Taq 1 digestion: SNP T/C in exon 9 was studied by amplifying an 740 bp fragment using primers 5′CAGAGCATGGACAGGGAGCAAG 3′ and 5′GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65°C as annealing temperature and digestion by Taq1 at 65°C for one hour. Presence of restriction site is denoted as ‘t’ and absence of restriction is denoted by ‘T’. The results show TT (TT) i.e., 495 bp and 245 bp bands Tt (TC) i.e., 495 bp, 290 bp, 245 bp and 205 bp bands and tt (CC) 290 bp, 245 bp and 205 bp bands. M is 100 bp ladder.
    Figure Legend Snippet: The genotypes for the four SNPs were determined by PCR amplification and restriction digestion of the PCR products with enzymes FokI, BsmI, ApaI , and TaqI . A: Fok1 digestion: SNP C/T in exon 2 was studied by amplifying a 265 bp fragment using primers 5′AGCTGGCCCTGGCACTGACTCTTGCTCT 3′ and 5′ATGGAAACACCTTGCTTCTTCTCCCTC 3′ with 68°C as annealing temperature and digestion by fok1 at 37°C for 3 hours. Presence of restriction site is denoted by ‘f’ while absence of restriction is denoted by ‘F’. Results show FF (CC) i.e., a 265 bp band or Ff (CT) i.e., 265 bp, 196 bp and 69 bp, bands, ff (TT) i.e., 196 bp and 69 bp bands. M is the100 bp ladder. B: Bsm 1 digestion: SNP A/G in Intron 8 was studied by amplifying an 825 bp fragment using primers 5′CAACCAAGACTACAAGTACCGCGTCAGTGA 3′ and 5′AACCAGCGGGAAGAGGTCAAGGG 3′ with 65°C as annealing temperature and digestion by Bsm1 at 65°C for one hour. Presence of restriction site is denoted as ‘b’ and absence of restriction is denoted by ‘B’. The results show BB (AA) i.e., 825 bp band, Bb (AG) i.e., 825 bp, 650 bp and 175 bp and bands and bb (GG) 650 bp and 175 bp bands. M is 25 bp ladder. C: Apa 1 digestion: SNP T/G in Intron 8 was studied by amplifying an 740 bp fragment using primers 5′ CAGAGCATGGACAGGGAGCAAG 3′ and 5′ GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65°C as annealing temperature and digestion by Apa1 at 37°C for one hour. Presence of restriction site is denoted as ‘a; and absence of restriction is denoted by ‘A’. The results show AA (TT) i.e., 740 bp band, Aa (TG) i.e., 740 bp, 520 bp and 220 bp bands and aa (GG) 520 bp and 220 bp bands. M is 100 bp ladder. D: Taq 1 digestion: SNP T/C in exon 9 was studied by amplifying an 740 bp fragment using primers 5′CAGAGCATGGACAGGGAGCAAG 3′ and 5′GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65°C as annealing temperature and digestion by Taq1 at 65°C for one hour. Presence of restriction site is denoted as ‘t’ and absence of restriction is denoted by ‘T’. The results show TT (TT) i.e., 495 bp and 245 bp bands Tt (TC) i.e., 495 bp, 290 bp, 245 bp and 205 bp bands and tt (CC) 290 bp, 245 bp and 205 bp bands. M is 100 bp ladder.

    Techniques Used: Polymerase Chain Reaction, Amplification

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Vitamin D Receptor Gene Polymorphisms and Prognosis of Breast Cancer among African-American and Hispanic Women
    Article Snippet: Annealing temperature for BsmI, ApaI/TaqI and FokI PCR are 63.5°C, 61°C and 59.5°C, respectively. .. Following PCR, aliquots of the amplified PCR products was digested with BsmI, ApaI, TaqI and FokI in accordance with the manufacturer's specifications (New England Biolabs, Beverly, MA, USA). .. The presence (lowercase) or absence (uppercase) of the enzyme recognition site was identified by ethidium bromide staining of fragments separated in a 2% agarose gel.

    Article Title: Interaction of Vitamin D Receptor with HLA DRB1*0301 in Type 1 Diabetes Patients from North India
    Article Snippet: .. Genotypic Analysis of VDR Polymorphisms The genotypes for the four SNPs were determined by PCR amplification and restriction digestion of the PCR products with enzymes FokI, BsmI, ApaI , and TaqI as described earlier , Briefly, 500 ng of DNA was amplified in 5 µl of 10X Thermo Pol reaction buffer supplemented with 2 mM MgSO4 (New England Biolabs), 5 pm of each primers, 0.25 mM of dNTPs, and 1.25 U of Taq DNA Polymerase (New England Biolabs), under standard conditions for 35 cycles in Perkin Elmer 2700 thermocycler. ..

    Article Title: Genetic Case-Control Study for Eight Polymorphisms Associated with Rheumatoid Arthritis
    Article Snippet: .. VDR (ApaI, BsmI, FokI, and TaqI) genotyping The VDR ApaI (rs7975232), the BsmI (rs1544410), the FokI (rs2228570), and the TaqI (rs731236) SNPs were detected by PCR–RFLP according to the manufacturer’s instructions (New England BioLabs, Ipswich, USA). .. DNA digested fragments were separated in 3% agarose gels and visualized by ethidium bromide staining.

    Article Title: Sclera-related gene polymorphisms in high myopia
    Article Snippet: .. The PCR product of the FMOD ( rs7543148 ) genetic polymorphism was digested with BsmI (New England Biolabs). ..

    Amplification:

    Article Title: Vitamin D Receptor Gene Polymorphisms and Prognosis of Breast Cancer among African-American and Hispanic Women
    Article Snippet: Annealing temperature for BsmI, ApaI/TaqI and FokI PCR are 63.5°C, 61°C and 59.5°C, respectively. .. Following PCR, aliquots of the amplified PCR products was digested with BsmI, ApaI, TaqI and FokI in accordance with the manufacturer's specifications (New England Biolabs, Beverly, MA, USA). .. The presence (lowercase) or absence (uppercase) of the enzyme recognition site was identified by ethidium bromide staining of fragments separated in a 2% agarose gel.

    Article Title: Interaction of Vitamin D Receptor with HLA DRB1*0301 in Type 1 Diabetes Patients from North India
    Article Snippet: .. Genotypic Analysis of VDR Polymorphisms The genotypes for the four SNPs were determined by PCR amplification and restriction digestion of the PCR products with enzymes FokI, BsmI, ApaI , and TaqI as described earlier , Briefly, 500 ng of DNA was amplified in 5 µl of 10X Thermo Pol reaction buffer supplemented with 2 mM MgSO4 (New England Biolabs), 5 pm of each primers, 0.25 mM of dNTPs, and 1.25 U of Taq DNA Polymerase (New England Biolabs), under standard conditions for 35 cycles in Perkin Elmer 2700 thermocycler. ..

    other:

    Article Title: Sensitive isothermal detection of nucleic-acid sequence by primer generation-rolling circle amplification
    Article Snippet: Vent (exo-) DNA polymerase, Nb.BsmI, BsmI, BbvCI and exonuclease III were purchased from New England Biolabs.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • bsmi  (New England Biolabs)
    93
    New England Biolabs bsmi
    Five-year disease free survival (DFS) of breast cancer patients in relation to VDR gene polymorphisms. Kaplan-Meier survival curves were used to compare the 5-year DFS between the VDR gene polymorphisms in (a) VDR-FokI, (b) <t>VDR-BsmI,</t> (c) <t>VDR-ApaI,</t> and (d) VDR-TaqI. The differences between the curves were estimated by log-rank test, where P
    Bsmi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsmi/product/New England Biolabs
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bsmi - by Bioz Stars, 2021-03
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    Five-year disease free survival (DFS) of breast cancer patients in relation to VDR gene polymorphisms. Kaplan-Meier survival curves were used to compare the 5-year DFS between the VDR gene polymorphisms in (a) VDR-FokI, (b) VDR-BsmI, (c) VDR-ApaI, and (d) VDR-TaqI. The differences between the curves were estimated by log-rank test, where P

    Journal: PLoS ONE

    Article Title: Vitamin D Receptor Gene Polymorphisms and Prognosis of Breast Cancer among African-American and Hispanic Women

    doi: 10.1371/journal.pone.0057967

    Figure Lengend Snippet: Five-year disease free survival (DFS) of breast cancer patients in relation to VDR gene polymorphisms. Kaplan-Meier survival curves were used to compare the 5-year DFS between the VDR gene polymorphisms in (a) VDR-FokI, (b) VDR-BsmI, (c) VDR-ApaI, and (d) VDR-TaqI. The differences between the curves were estimated by log-rank test, where P

    Article Snippet: Following PCR, aliquots of the amplified PCR products was digested with BsmI, ApaI, TaqI and FokI in accordance with the manufacturer's specifications (New England Biolabs, Beverly, MA, USA).

    Techniques:

    Southern-blot analysis of ZmIPK1A. Genomic DNA was isolated from inbred line 5XH751 and digested with Eco RI, Bam HI, Ban II, Nco I, Nsi I, and Bsm I. The digested maize genomic DNA and λ phage DNA were separated on 0.8% agarose and transferred to Nylon membrane. The blot was probed with 32 P-dCTP labeled ZmIPK1A and λ phage DNA. Black bars indicate the size and positions of the DNA M r markers.

    Journal: Plant Physiology

    Article Title: Inositol 1,3,4,5,6-Pentakisphosphate 2-Kinase from Maize: Molecular and Biochemical Characterization [OA]

    doi: 10.1104/pp.107.095455

    Figure Lengend Snippet: Southern-blot analysis of ZmIPK1A. Genomic DNA was isolated from inbred line 5XH751 and digested with Eco RI, Bam HI, Ban II, Nco I, Nsi I, and Bsm I. The digested maize genomic DNA and λ phage DNA were separated on 0.8% agarose and transferred to Nylon membrane. The blot was probed with 32 P-dCTP labeled ZmIPK1A and λ phage DNA. Black bars indicate the size and positions of the DNA M r markers.

    Article Snippet: Approximately 12 μ g genomic DNA was digested overnight with the following restriction enzymes: Eco RI, Bam HI, Ban II, Nco I, Nsi I, and Bsm I (New England Biolabs).

    Techniques: Southern Blot, Isolation, Labeling

    Pairwise LD Plot for the VDR SNPs. The ID of each SNP was taken as reference. The rs731236, rs7975232, rs1544410, and rs2228570 correspond to TaqI, ApaI, BsmI, and FokI respectively. (a) D′ values. (b) r 2 values. The plot was generated using the Haploview 4 . 2 program.

    Journal: PLoS ONE

    Article Title: Genetic Case-Control Study for Eight Polymorphisms Associated with Rheumatoid Arthritis

    doi: 10.1371/journal.pone.0131960

    Figure Lengend Snippet: Pairwise LD Plot for the VDR SNPs. The ID of each SNP was taken as reference. The rs731236, rs7975232, rs1544410, and rs2228570 correspond to TaqI, ApaI, BsmI, and FokI respectively. (a) D′ values. (b) r 2 values. The plot was generated using the Haploview 4 . 2 program.

    Article Snippet: VDR (ApaI, BsmI, FokI, and TaqI) genotyping The VDR ApaI (rs7975232), the BsmI (rs1544410), the FokI (rs2228570), and the TaqI (rs731236) SNPs were detected by PCR–RFLP according to the manufacturer’s instructions (New England BioLabs, Ipswich, USA).

    Techniques: Generated

    Optimization of reaction conditions for PG–RCA. Threshold time in the presence (open circle) or absence (cross) of 500 zmol sample DNA was compared at various concentrations of each reaction component ( n =2). ( A ) At constant concentrations of Vent (exo-) DNA polymerase (0.4 U), Nb.BsmI (1 U) and circular probe II (7.5 nM), dNTP concentrations were compared among 400 (original), 40, 4 and 0.4 µM. ( B ) At constant concentrations of dNTP (400 µM), Nb.BsmI (1 U) and circular probe II (7.5 nM), Vent (exo-) polymerase concentrations were compared among 0.4 (original), 0.08, 0.04 and 0.02 U. ( C ) At constant concentrations of dNTP (400 µM), Vent (exo-) DNA polymerase (0.4 U) and circular probe II (7.5 nM), Nb.BsmI concentrations were compared among 1 (original), 0.5, 0.25 and 0.125 U. ( D ) At constant concentrations of dNTP (0.4 µM, 1000-fold dilution of the original concentration), Nb.BsmI (1 U) and circular probe II (7.5 nM), Vent (exo-) polymerase concentrations were compared among 0.4, 0.2, 0.1 and 0.05 U.

    Journal: Nucleic Acids Research

    Article Title: Sensitive isothermal detection of nucleic-acid sequence by primer generation-rolling circle amplification

    doi: 10.1093/nar/gkn1014

    Figure Lengend Snippet: Optimization of reaction conditions for PG–RCA. Threshold time in the presence (open circle) or absence (cross) of 500 zmol sample DNA was compared at various concentrations of each reaction component ( n =2). ( A ) At constant concentrations of Vent (exo-) DNA polymerase (0.4 U), Nb.BsmI (1 U) and circular probe II (7.5 nM), dNTP concentrations were compared among 400 (original), 40, 4 and 0.4 µM. ( B ) At constant concentrations of dNTP (400 µM), Nb.BsmI (1 U) and circular probe II (7.5 nM), Vent (exo-) polymerase concentrations were compared among 0.4 (original), 0.08, 0.04 and 0.02 U. ( C ) At constant concentrations of dNTP (400 µM), Vent (exo-) DNA polymerase (0.4 U) and circular probe II (7.5 nM), Nb.BsmI concentrations were compared among 1 (original), 0.5, 0.25 and 0.125 U. ( D ) At constant concentrations of dNTP (0.4 µM, 1000-fold dilution of the original concentration), Nb.BsmI (1 U) and circular probe II (7.5 nM), Vent (exo-) polymerase concentrations were compared among 0.4, 0.2, 0.1 and 0.05 U.

    Article Snippet: Vent (exo-) DNA polymerase, Nb.BsmI, BsmI, BbvCI and exonuclease III were purchased from New England Biolabs.

    Techniques: Concentration Assay

    PG–RCA under optimized reaction condition. ( A ) Fluorescent intensity of PG–RCA reaction at the optimized reaction condition (0.4 µM dNTP, 0.05 U Vent (exo-) DNA polymerase, 1 U Nb.BsmI and 7.5 nM circular probe II) was monitored in real time. Sample DNA concentration in each reaction was prepared by 10-fold serial dilution from 5 fmol to 0.5 ymol and their signal amplification curves were indicated by colored lines (dark blue, blue, light blue, purple, dark green, green, brown, orange, yellow, red and gray, respectively) ( n =2). Negative controls are indicated by black lines ( n =2). ( B ) Threshold time ( T T ) was plotted against the sample DNA concentration (S) of the reaction. Solid line indicates linear least squares fitting between 5 fmol and 0.5 zmol sample DNA and its formulation is T T =−19.2 log 10 (S)+75.6 ( R 2 =0.998). Perforated line indicates average T T value of the negative controls. Limit of detection is 84.5 ymol or 50.7 molecules of sample DNA by calculation from the intersection of both lines.

    Journal: Nucleic Acids Research

    Article Title: Sensitive isothermal detection of nucleic-acid sequence by primer generation-rolling circle amplification

    doi: 10.1093/nar/gkn1014

    Figure Lengend Snippet: PG–RCA under optimized reaction condition. ( A ) Fluorescent intensity of PG–RCA reaction at the optimized reaction condition (0.4 µM dNTP, 0.05 U Vent (exo-) DNA polymerase, 1 U Nb.BsmI and 7.5 nM circular probe II) was monitored in real time. Sample DNA concentration in each reaction was prepared by 10-fold serial dilution from 5 fmol to 0.5 ymol and their signal amplification curves were indicated by colored lines (dark blue, blue, light blue, purple, dark green, green, brown, orange, yellow, red and gray, respectively) ( n =2). Negative controls are indicated by black lines ( n =2). ( B ) Threshold time ( T T ) was plotted against the sample DNA concentration (S) of the reaction. Solid line indicates linear least squares fitting between 5 fmol and 0.5 zmol sample DNA and its formulation is T T =−19.2 log 10 (S)+75.6 ( R 2 =0.998). Perforated line indicates average T T value of the negative controls. Limit of detection is 84.5 ymol or 50.7 molecules of sample DNA by calculation from the intersection of both lines.

    Article Snippet: Vent (exo-) DNA polymerase, Nb.BsmI, BsmI, BbvCI and exonuclease III were purchased from New England Biolabs.

    Techniques: Concentration Assay, Serial Dilution, Amplification

    Real-time product analysis of PG–RCA. ( A ) Fluorescent intensity of PG–RCA reaction was monitored in real time. PG–RCA was conducted at 60°C with 400 µM each dNTP, 0.4 U Vent (exo-) DNA polymerase, 1 U Nb.BsmI and 7.5 nM circular probe II as described in Materials and methods section. Sample DNA concentration in each reaction was prepared by 10-fold serial dilution from 500 amol to 0.5 zmol, and their signal amplification curves were indicated by colored lines (blue, light blue, purple, dark green, green, brown and orange, respectively) ( n =3). Negative controls are indicated by black lines ( n =3). ( B ) Threshold time T T (the reaction time when fluorescent intensity of each reaction exceeds a threshold, indicated by a perforated line in Figure 3A) was plotted against the sample DNA concentration (S) of the reaction. Solid line indicates linear least squares fitting between 500 and 0.5 amol sample DNA and its formulation is T T =−8.65 log 10 (S)+28.5 (R 2 =0.997). Perforated line indicates average T T value of the negative controls. Limit of detection is 58.4 zmol or 3.50 × 10 4 molecules of sample DNA by calculation from the intersection of both lines.

    Journal: Nucleic Acids Research

    Article Title: Sensitive isothermal detection of nucleic-acid sequence by primer generation-rolling circle amplification

    doi: 10.1093/nar/gkn1014

    Figure Lengend Snippet: Real-time product analysis of PG–RCA. ( A ) Fluorescent intensity of PG–RCA reaction was monitored in real time. PG–RCA was conducted at 60°C with 400 µM each dNTP, 0.4 U Vent (exo-) DNA polymerase, 1 U Nb.BsmI and 7.5 nM circular probe II as described in Materials and methods section. Sample DNA concentration in each reaction was prepared by 10-fold serial dilution from 500 amol to 0.5 zmol, and their signal amplification curves were indicated by colored lines (blue, light blue, purple, dark green, green, brown and orange, respectively) ( n =3). Negative controls are indicated by black lines ( n =3). ( B ) Threshold time T T (the reaction time when fluorescent intensity of each reaction exceeds a threshold, indicated by a perforated line in Figure 3A) was plotted against the sample DNA concentration (S) of the reaction. Solid line indicates linear least squares fitting between 500 and 0.5 amol sample DNA and its formulation is T T =−8.65 log 10 (S)+28.5 (R 2 =0.997). Perforated line indicates average T T value of the negative controls. Limit of detection is 58.4 zmol or 3.50 × 10 4 molecules of sample DNA by calculation from the intersection of both lines.

    Article Snippet: Vent (exo-) DNA polymerase, Nb.BsmI, BsmI, BbvCI and exonuclease III were purchased from New England Biolabs.

    Techniques: Concentration Assay, Serial Dilution, Amplification

    Endpoint product analysis of PG–RCA. ( A ) Endpoint products in the presence or absence of 500 amol sample DNA were analyzed on 1.0% agarose gel electrophoresis. The reaction was conducted at 60°C for 30, 45, 60, 75, 90, 105 and 120 min and each reaction was analyzed separately. Lane M was loaded with a 100 bp DNA marker (100, 200, 300, 400, 500/517, 600, 700, 800, 900, 1000, 1200 and 1517 bp from the bottom). ( B ) Endpoint products of 90-min reactions with all or partial reaction components were analyzed on 1.0% agarose gel electrophoresis. DNA, POL and NICK indicate sample DNA, Vent (exo-) DNA polymerase and Nb.BsmI, respectively. Lane M is a 100 bp DNA marker. ( C ) Endpoint product of a 120-min PG–RCA reaction was digested with either BsmI or BbvCI and analyzed on 1.5% agarose gel electrophoresis. Lane ‘-’ was loaded with the 120 min reaction product before restriction enzyme digestion. Lane M is a 100 bp DNA marker.

    Journal: Nucleic Acids Research

    Article Title: Sensitive isothermal detection of nucleic-acid sequence by primer generation-rolling circle amplification

    doi: 10.1093/nar/gkn1014

    Figure Lengend Snippet: Endpoint product analysis of PG–RCA. ( A ) Endpoint products in the presence or absence of 500 amol sample DNA were analyzed on 1.0% agarose gel electrophoresis. The reaction was conducted at 60°C for 30, 45, 60, 75, 90, 105 and 120 min and each reaction was analyzed separately. Lane M was loaded with a 100 bp DNA marker (100, 200, 300, 400, 500/517, 600, 700, 800, 900, 1000, 1200 and 1517 bp from the bottom). ( B ) Endpoint products of 90-min reactions with all or partial reaction components were analyzed on 1.0% agarose gel electrophoresis. DNA, POL and NICK indicate sample DNA, Vent (exo-) DNA polymerase and Nb.BsmI, respectively. Lane M is a 100 bp DNA marker. ( C ) Endpoint product of a 120-min PG–RCA reaction was digested with either BsmI or BbvCI and analyzed on 1.5% agarose gel electrophoresis. Lane ‘-’ was loaded with the 120 min reaction product before restriction enzyme digestion. Lane M is a 100 bp DNA marker.

    Article Snippet: Vent (exo-) DNA polymerase, Nb.BsmI, BsmI, BbvCI and exonuclease III were purchased from New England Biolabs.

    Techniques: Agarose Gel Electrophoresis, Marker

    Real-time quantification of hly gene in L. monocytogenes genomic DNA by PG–RCA. ( A ) Circular probe LM for detection of pathogenic L. monocytogenes genomic DNA. The probe targets the complementary strand of virulence gene, hly (GeneBank GeneID 2797098), encoding a cholesterol-dependent cytolysin, listeriolysin O (LLO). Circular probe LM contains three repeats of a 26-base sequence complementary to the gene including a nicking site for Nb.BsmI. Since these repeat sequences have 5-base overlaps each other, the circular probe comprises three repeats of a 21-base sequence (red, blue and green). ( B ) Genomic DNA from L. monocytogenes (0.1–100 pg) was analyzed by real-time PG–RCA with circular probe LM. Threshold time ( T T ) was plotted against the L. monocytogenes genomic DNA concentration (S) of the reaction. Solid line indicates linear least squares fitting between 0.1 and 100 pg L. monocytogenes genomic DNA and its formulation is T T = −19.1 log 10 (S) + 233 ( R 2 =0.964). Perforated line indicates average T T value of the negative controls ( n =2). Limit of detection is 0.163 pg (∼60 molecules) of L. monocytogenes genomic DNA by calculation from the intersection of both lines. ( C ) Genomic DNA (100 pg) from L. monocytogenes , L. innocua , E. coli and S. enterica were analyzed by real-time PG–RCA with circular probe LM and their threshold times were compared with the values for L. monocytogenes (100 pg). ‘No DNA’ indicates the negative controls.

    Journal: Nucleic Acids Research

    Article Title: Sensitive isothermal detection of nucleic-acid sequence by primer generation-rolling circle amplification

    doi: 10.1093/nar/gkn1014

    Figure Lengend Snippet: Real-time quantification of hly gene in L. monocytogenes genomic DNA by PG–RCA. ( A ) Circular probe LM for detection of pathogenic L. monocytogenes genomic DNA. The probe targets the complementary strand of virulence gene, hly (GeneBank GeneID 2797098), encoding a cholesterol-dependent cytolysin, listeriolysin O (LLO). Circular probe LM contains three repeats of a 26-base sequence complementary to the gene including a nicking site for Nb.BsmI. Since these repeat sequences have 5-base overlaps each other, the circular probe comprises three repeats of a 21-base sequence (red, blue and green). ( B ) Genomic DNA from L. monocytogenes (0.1–100 pg) was analyzed by real-time PG–RCA with circular probe LM. Threshold time ( T T ) was plotted against the L. monocytogenes genomic DNA concentration (S) of the reaction. Solid line indicates linear least squares fitting between 0.1 and 100 pg L. monocytogenes genomic DNA and its formulation is T T = −19.1 log 10 (S) + 233 ( R 2 =0.964). Perforated line indicates average T T value of the negative controls ( n =2). Limit of detection is 0.163 pg (∼60 molecules) of L. monocytogenes genomic DNA by calculation from the intersection of both lines. ( C ) Genomic DNA (100 pg) from L. monocytogenes , L. innocua , E. coli and S. enterica were analyzed by real-time PG–RCA with circular probe LM and their threshold times were compared with the values for L. monocytogenes (100 pg). ‘No DNA’ indicates the negative controls.

    Article Snippet: Vent (exo-) DNA polymerase, Nb.BsmI, BsmI, BbvCI and exonuclease III were purchased from New England Biolabs.

    Techniques: Sequencing, Concentration Assay