bsmi  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    BsmI
    Description:
    BsmI 2 500 units
    Catalog Number:
    r0134l
    Price:
    282
    Size:
    2 500 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs bsmi
    BsmI
    BsmI 2 500 units
    https://www.bioz.com/result/bsmi/product/New England Biolabs
    Average 95 stars, based on 24 article reviews
    Price from $9.99 to $1999.99
    bsmi - by Bioz Stars, 2020-02
    95/100 stars

    Images

    1) Product Images from "Genetic Case-Control Study for Eight Polymorphisms Associated with Rheumatoid Arthritis"

    Article Title: Genetic Case-Control Study for Eight Polymorphisms Associated with Rheumatoid Arthritis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0131960

    Pairwise LD Plot for the VDR SNPs. The ID of each SNP was taken as reference. The rs731236, rs7975232, rs1544410, and rs2228570 correspond to TaqI, ApaI, BsmI, and FokI respectively. (a) D′ values. (b) r 2 values. The plot was generated using the Haploview 4 . 2 program.
    Figure Legend Snippet: Pairwise LD Plot for the VDR SNPs. The ID of each SNP was taken as reference. The rs731236, rs7975232, rs1544410, and rs2228570 correspond to TaqI, ApaI, BsmI, and FokI respectively. (a) D′ values. (b) r 2 values. The plot was generated using the Haploview 4 . 2 program.

    Techniques Used: Generated

    2) Product Images from "Vitamin D Receptor Gene Polymorphisms and Prognosis of Breast Cancer among African-American and Hispanic Women"

    Article Title: Vitamin D Receptor Gene Polymorphisms and Prognosis of Breast Cancer among African-American and Hispanic Women

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0057967

    Five-year disease free survival (DFS) of breast cancer patients in relation to VDR gene polymorphisms. Kaplan-Meier survival curves were used to compare the 5-year DFS between the VDR gene polymorphisms in (a) VDR-FokI, (b) VDR-BsmI, (c) VDR-ApaI, and (d) VDR-TaqI. The differences between the curves were estimated by log-rank test, where P
    Figure Legend Snippet: Five-year disease free survival (DFS) of breast cancer patients in relation to VDR gene polymorphisms. Kaplan-Meier survival curves were used to compare the 5-year DFS between the VDR gene polymorphisms in (a) VDR-FokI, (b) VDR-BsmI, (c) VDR-ApaI, and (d) VDR-TaqI. The differences between the curves were estimated by log-rank test, where P

    Techniques Used:

    3) Product Images from "Sensitive isothermal detection of nucleic-acid sequence by primer generation-rolling circle amplification"

    Article Title: Sensitive isothermal detection of nucleic-acid sequence by primer generation-rolling circle amplification

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkn1014

    Optimization of reaction conditions for PG–RCA. Threshold time in the presence (open circle) or absence (cross) of 500 zmol sample DNA was compared at various concentrations of each reaction component ( n =2). ( A ) At constant concentrations of Vent (exo-) DNA polymerase (0.4 U), Nb.BsmI (1 U) and circular probe II (7.5 nM), dNTP concentrations were compared among 400 (original), 40, 4 and 0.4 µM. ( B ) At constant concentrations of dNTP (400 µM), Nb.BsmI (1 U) and circular probe II (7.5 nM), Vent (exo-) polymerase concentrations were compared among 0.4 (original), 0.08, 0.04 and 0.02 U. ( C ) At constant concentrations of dNTP (400 µM), Vent (exo-) DNA polymerase (0.4 U) and circular probe II (7.5 nM), Nb.BsmI concentrations were compared among 1 (original), 0.5, 0.25 and 0.125 U. ( D ) At constant concentrations of dNTP (0.4 µM, 1000-fold dilution of the original concentration), Nb.BsmI (1 U) and circular probe II (7.5 nM), Vent (exo-) polymerase concentrations were compared among 0.4, 0.2, 0.1 and 0.05 U.
    Figure Legend Snippet: Optimization of reaction conditions for PG–RCA. Threshold time in the presence (open circle) or absence (cross) of 500 zmol sample DNA was compared at various concentrations of each reaction component ( n =2). ( A ) At constant concentrations of Vent (exo-) DNA polymerase (0.4 U), Nb.BsmI (1 U) and circular probe II (7.5 nM), dNTP concentrations were compared among 400 (original), 40, 4 and 0.4 µM. ( B ) At constant concentrations of dNTP (400 µM), Nb.BsmI (1 U) and circular probe II (7.5 nM), Vent (exo-) polymerase concentrations were compared among 0.4 (original), 0.08, 0.04 and 0.02 U. ( C ) At constant concentrations of dNTP (400 µM), Vent (exo-) DNA polymerase (0.4 U) and circular probe II (7.5 nM), Nb.BsmI concentrations were compared among 1 (original), 0.5, 0.25 and 0.125 U. ( D ) At constant concentrations of dNTP (0.4 µM, 1000-fold dilution of the original concentration), Nb.BsmI (1 U) and circular probe II (7.5 nM), Vent (exo-) polymerase concentrations were compared among 0.4, 0.2, 0.1 and 0.05 U.

    Techniques Used: Concentration Assay

    PG–RCA under optimized reaction condition. ( A ) Fluorescent intensity of PG–RCA reaction at the optimized reaction condition (0.4 µM dNTP, 0.05 U Vent (exo-) DNA polymerase, 1 U Nb.BsmI and 7.5 nM circular probe II) was monitored in real time. Sample DNA concentration in each reaction was prepared by 10-fold serial dilution from 5 fmol to 0.5 ymol and their signal amplification curves were indicated by colored lines (dark blue, blue, light blue, purple, dark green, green, brown, orange, yellow, red and gray, respectively) ( n =2). Negative controls are indicated by black lines ( n =2). ( B ) Threshold time ( T T ) was plotted against the sample DNA concentration (S) of the reaction. Solid line indicates linear least squares fitting between 5 fmol and 0.5 zmol sample DNA and its formulation is T T =−19.2 log 10 (S)+75.6 ( R 2 =0.998). Perforated line indicates average T T value of the negative controls. Limit of detection is 84.5 ymol or 50.7 molecules of sample DNA by calculation from the intersection of both lines.
    Figure Legend Snippet: PG–RCA under optimized reaction condition. ( A ) Fluorescent intensity of PG–RCA reaction at the optimized reaction condition (0.4 µM dNTP, 0.05 U Vent (exo-) DNA polymerase, 1 U Nb.BsmI and 7.5 nM circular probe II) was monitored in real time. Sample DNA concentration in each reaction was prepared by 10-fold serial dilution from 5 fmol to 0.5 ymol and their signal amplification curves were indicated by colored lines (dark blue, blue, light blue, purple, dark green, green, brown, orange, yellow, red and gray, respectively) ( n =2). Negative controls are indicated by black lines ( n =2). ( B ) Threshold time ( T T ) was plotted against the sample DNA concentration (S) of the reaction. Solid line indicates linear least squares fitting between 5 fmol and 0.5 zmol sample DNA and its formulation is T T =−19.2 log 10 (S)+75.6 ( R 2 =0.998). Perforated line indicates average T T value of the negative controls. Limit of detection is 84.5 ymol or 50.7 molecules of sample DNA by calculation from the intersection of both lines.

    Techniques Used: Concentration Assay, Serial Dilution, Amplification

    Real-time product analysis of PG–RCA. ( A ) Fluorescent intensity of PG–RCA reaction was monitored in real time. PG–RCA was conducted at 60°C with 400 µM each dNTP, 0.4 U Vent (exo-) DNA polymerase, 1 U Nb.BsmI and 7.5 nM circular probe II as described in Materials and methods section. Sample DNA concentration in each reaction was prepared by 10-fold serial dilution from 500 amol to 0.5 zmol, and their signal amplification curves were indicated by colored lines (blue, light blue, purple, dark green, green, brown and orange, respectively) ( n =3). Negative controls are indicated by black lines ( n =3). ( B ) Threshold time T T (the reaction time when fluorescent intensity of each reaction exceeds a threshold, indicated by a perforated line in Figure 3A) was plotted against the sample DNA concentration (S) of the reaction. Solid line indicates linear least squares fitting between 500 and 0.5 amol sample DNA and its formulation is T T =−8.65 log 10 (S)+28.5 (R 2 =0.997). Perforated line indicates average T T value of the negative controls. Limit of detection is 58.4 zmol or 3.50 × 10 4 molecules of sample DNA by calculation from the intersection of both lines.
    Figure Legend Snippet: Real-time product analysis of PG–RCA. ( A ) Fluorescent intensity of PG–RCA reaction was monitored in real time. PG–RCA was conducted at 60°C with 400 µM each dNTP, 0.4 U Vent (exo-) DNA polymerase, 1 U Nb.BsmI and 7.5 nM circular probe II as described in Materials and methods section. Sample DNA concentration in each reaction was prepared by 10-fold serial dilution from 500 amol to 0.5 zmol, and their signal amplification curves were indicated by colored lines (blue, light blue, purple, dark green, green, brown and orange, respectively) ( n =3). Negative controls are indicated by black lines ( n =3). ( B ) Threshold time T T (the reaction time when fluorescent intensity of each reaction exceeds a threshold, indicated by a perforated line in Figure 3A) was plotted against the sample DNA concentration (S) of the reaction. Solid line indicates linear least squares fitting between 500 and 0.5 amol sample DNA and its formulation is T T =−8.65 log 10 (S)+28.5 (R 2 =0.997). Perforated line indicates average T T value of the negative controls. Limit of detection is 58.4 zmol or 3.50 × 10 4 molecules of sample DNA by calculation from the intersection of both lines.

    Techniques Used: Concentration Assay, Serial Dilution, Amplification

    Endpoint product analysis of PG–RCA. ( A ) Endpoint products in the presence or absence of 500 amol sample DNA were analyzed on 1.0% agarose gel electrophoresis. The reaction was conducted at 60°C for 30, 45, 60, 75, 90, 105 and 120 min and each reaction was analyzed separately. Lane M was loaded with a 100 bp DNA marker (100, 200, 300, 400, 500/517, 600, 700, 800, 900, 1000, 1200 and 1517 bp from the bottom). ( B ) Endpoint products of 90-min reactions with all or partial reaction components were analyzed on 1.0% agarose gel electrophoresis. DNA, POL and NICK indicate sample DNA, Vent (exo-) DNA polymerase and Nb.BsmI, respectively. Lane M is a 100 bp DNA marker. ( C ) Endpoint product of a 120-min PG–RCA reaction was digested with either BsmI or BbvCI and analyzed on 1.5% agarose gel electrophoresis. Lane ‘-’ was loaded with the 120 min reaction product before restriction enzyme digestion. Lane M is a 100 bp DNA marker.
    Figure Legend Snippet: Endpoint product analysis of PG–RCA. ( A ) Endpoint products in the presence or absence of 500 amol sample DNA were analyzed on 1.0% agarose gel electrophoresis. The reaction was conducted at 60°C for 30, 45, 60, 75, 90, 105 and 120 min and each reaction was analyzed separately. Lane M was loaded with a 100 bp DNA marker (100, 200, 300, 400, 500/517, 600, 700, 800, 900, 1000, 1200 and 1517 bp from the bottom). ( B ) Endpoint products of 90-min reactions with all or partial reaction components were analyzed on 1.0% agarose gel electrophoresis. DNA, POL and NICK indicate sample DNA, Vent (exo-) DNA polymerase and Nb.BsmI, respectively. Lane M is a 100 bp DNA marker. ( C ) Endpoint product of a 120-min PG–RCA reaction was digested with either BsmI or BbvCI and analyzed on 1.5% agarose gel electrophoresis. Lane ‘-’ was loaded with the 120 min reaction product before restriction enzyme digestion. Lane M is a 100 bp DNA marker.

    Techniques Used: Agarose Gel Electrophoresis, Marker

    Real-time quantification of hly gene in L. monocytogenes genomic DNA by PG–RCA. ( A ) Circular probe LM for detection of pathogenic L. monocytogenes genomic DNA. The probe targets the complementary strand of virulence gene, hly (GeneBank GeneID 2797098), encoding a cholesterol-dependent cytolysin, listeriolysin O (LLO). Circular probe LM contains three repeats of a 26-base sequence complementary to the gene including a nicking site for Nb.BsmI. Since these repeat sequences have 5-base overlaps each other, the circular probe comprises three repeats of a 21-base sequence (red, blue and green). ( B ) Genomic DNA from L. monocytogenes (0.1–100 pg) was analyzed by real-time PG–RCA with circular probe LM. Threshold time ( T T ) was plotted against the L. monocytogenes genomic DNA concentration (S) of the reaction. Solid line indicates linear least squares fitting between 0.1 and 100 pg L. monocytogenes genomic DNA and its formulation is T T = −19.1 log 10 (S) + 233 ( R 2 =0.964). Perforated line indicates average T T value of the negative controls ( n =2). Limit of detection is 0.163 pg (∼60 molecules) of L. monocytogenes genomic DNA by calculation from the intersection of both lines. ( C ) Genomic DNA (100 pg) from L. monocytogenes , L. innocua , E. coli and S. enterica were analyzed by real-time PG–RCA with circular probe LM and their threshold times were compared with the values for L. monocytogenes (100 pg). ‘No DNA’ indicates the negative controls.
    Figure Legend Snippet: Real-time quantification of hly gene in L. monocytogenes genomic DNA by PG–RCA. ( A ) Circular probe LM for detection of pathogenic L. monocytogenes genomic DNA. The probe targets the complementary strand of virulence gene, hly (GeneBank GeneID 2797098), encoding a cholesterol-dependent cytolysin, listeriolysin O (LLO). Circular probe LM contains three repeats of a 26-base sequence complementary to the gene including a nicking site for Nb.BsmI. Since these repeat sequences have 5-base overlaps each other, the circular probe comprises three repeats of a 21-base sequence (red, blue and green). ( B ) Genomic DNA from L. monocytogenes (0.1–100 pg) was analyzed by real-time PG–RCA with circular probe LM. Threshold time ( T T ) was plotted against the L. monocytogenes genomic DNA concentration (S) of the reaction. Solid line indicates linear least squares fitting between 0.1 and 100 pg L. monocytogenes genomic DNA and its formulation is T T = −19.1 log 10 (S) + 233 ( R 2 =0.964). Perforated line indicates average T T value of the negative controls ( n =2). Limit of detection is 0.163 pg (∼60 molecules) of L. monocytogenes genomic DNA by calculation from the intersection of both lines. ( C ) Genomic DNA (100 pg) from L. monocytogenes , L. innocua , E. coli and S. enterica were analyzed by real-time PG–RCA with circular probe LM and their threshold times were compared with the values for L. monocytogenes (100 pg). ‘No DNA’ indicates the negative controls.

    Techniques Used: Sequencing, Concentration Assay

    4) Product Images from "Association of vitamin D receptor gene BsmI (A > G) and FokI (C > T) polymorphism in gestational diabetes among Saudi Women"

    Article Title: Association of vitamin D receptor gene BsmI (A > G) and FokI (C > T) polymorphism in gestational diabetes among Saudi Women

    Journal: Pakistan Journal of Medical Sciences

    doi: 10.12669/pjms.316.7525

    2% agarose gel electrophoresis of VDR PCR for [A] VDR SNPs BsmI enzyme showing a wild type bb 822bp product [B] VDR SNPs FokI enzyme showing a wild type ff 265bp product. Lane 1: 100bp DNA ladder, Lanes 2-10: PCR product DNA. PCR: polymerase chain reaction; SNPs: single nucleotide polymorphism; VDR: vitamin D receptor.
    Figure Legend Snippet: 2% agarose gel electrophoresis of VDR PCR for [A] VDR SNPs BsmI enzyme showing a wild type bb 822bp product [B] VDR SNPs FokI enzyme showing a wild type ff 265bp product. Lane 1: 100bp DNA ladder, Lanes 2-10: PCR product DNA. PCR: polymerase chain reaction; SNPs: single nucleotide polymorphism; VDR: vitamin D receptor.

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction

    5) Product Images from "Interaction of Vitamin D Receptor with HLA DRB1*0301 in Type 1 Diabetes Patients from North India"

    Article Title: Interaction of Vitamin D Receptor with HLA DRB1*0301 in Type 1 Diabetes Patients from North India

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0008023

    The genotypes for the four SNPs were determined by PCR amplification and restriction digestion of the PCR products with enzymes FokI, BsmI, ApaI , and TaqI . A: Fok1 digestion: SNP C/T in exon 2 was studied by amplifying a 265 bp fragment using primers 5′AGCTGGCCCTGGCACTGACTCTTGCTCT 3′ and 5′ATGGAAACACCTTGCTTCTTCTCCCTC 3′ with 68°C as annealing temperature and digestion by fok1 at 37°C for 3 hours. Presence of restriction site is denoted by ‘f’ while absence of restriction is denoted by ‘F’. Results show FF (CC) i.e., a 265 bp band or Ff (CT) i.e., 265 bp, 196 bp and 69 bp, bands, ff (TT) i.e., 196 bp and 69 bp bands. M is the100 bp ladder. B: Bsm 1 digestion: SNP A/G in Intron 8 was studied by amplifying an 825 bp fragment using primers 5′CAACCAAGACTACAAGTACCGCGTCAGTGA 3′ and 5′AACCAGCGGGAAGAGGTCAAGGG 3′ with 65°C as annealing temperature and digestion by Bsm1 at 65°C for one hour. Presence of restriction site is denoted as ‘b’ and absence of restriction is denoted by ‘B’. The results show BB (AA) i.e., 825 bp band, Bb (AG) i.e., 825 bp, 650 bp and 175 bp and bands and bb (GG) 650 bp and 175 bp bands. M is 25 bp ladder. C: Apa 1 digestion: SNP T/G in Intron 8 was studied by amplifying an 740 bp fragment using primers 5′ CAGAGCATGGACAGGGAGCAAG 3′ and 5′ GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65°C as annealing temperature and digestion by Apa1 at 37°C for one hour. Presence of restriction site is denoted as ‘a; and absence of restriction is denoted by ‘A’. The results show AA (TT) i.e., 740 bp band, Aa (TG) i.e., 740 bp, 520 bp and 220 bp bands and aa (GG) 520 bp and 220 bp bands. M is 100 bp ladder. D: Taq 1 digestion: SNP T/C in exon 9 was studied by amplifying an 740 bp fragment using primers 5′CAGAGCATGGACAGGGAGCAAG 3′ and 5′GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65°C as annealing temperature and digestion by Taq1 at 65°C for one hour. Presence of restriction site is denoted as ‘t’ and absence of restriction is denoted by ‘T’. The results show TT (TT) i.e., 495 bp and 245 bp bands Tt (TC) i.e., 495 bp, 290 bp, 245 bp and 205 bp bands and tt (CC) 290 bp, 245 bp and 205 bp bands. M is 100 bp ladder.
    Figure Legend Snippet: The genotypes for the four SNPs were determined by PCR amplification and restriction digestion of the PCR products with enzymes FokI, BsmI, ApaI , and TaqI . A: Fok1 digestion: SNP C/T in exon 2 was studied by amplifying a 265 bp fragment using primers 5′AGCTGGCCCTGGCACTGACTCTTGCTCT 3′ and 5′ATGGAAACACCTTGCTTCTTCTCCCTC 3′ with 68°C as annealing temperature and digestion by fok1 at 37°C for 3 hours. Presence of restriction site is denoted by ‘f’ while absence of restriction is denoted by ‘F’. Results show FF (CC) i.e., a 265 bp band or Ff (CT) i.e., 265 bp, 196 bp and 69 bp, bands, ff (TT) i.e., 196 bp and 69 bp bands. M is the100 bp ladder. B: Bsm 1 digestion: SNP A/G in Intron 8 was studied by amplifying an 825 bp fragment using primers 5′CAACCAAGACTACAAGTACCGCGTCAGTGA 3′ and 5′AACCAGCGGGAAGAGGTCAAGGG 3′ with 65°C as annealing temperature and digestion by Bsm1 at 65°C for one hour. Presence of restriction site is denoted as ‘b’ and absence of restriction is denoted by ‘B’. The results show BB (AA) i.e., 825 bp band, Bb (AG) i.e., 825 bp, 650 bp and 175 bp and bands and bb (GG) 650 bp and 175 bp bands. M is 25 bp ladder. C: Apa 1 digestion: SNP T/G in Intron 8 was studied by amplifying an 740 bp fragment using primers 5′ CAGAGCATGGACAGGGAGCAAG 3′ and 5′ GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65°C as annealing temperature and digestion by Apa1 at 37°C for one hour. Presence of restriction site is denoted as ‘a; and absence of restriction is denoted by ‘A’. The results show AA (TT) i.e., 740 bp band, Aa (TG) i.e., 740 bp, 520 bp and 220 bp bands and aa (GG) 520 bp and 220 bp bands. M is 100 bp ladder. D: Taq 1 digestion: SNP T/C in exon 9 was studied by amplifying an 740 bp fragment using primers 5′CAGAGCATGGACAGGGAGCAAG 3′ and 5′GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65°C as annealing temperature and digestion by Taq1 at 65°C for one hour. Presence of restriction site is denoted as ‘t’ and absence of restriction is denoted by ‘T’. The results show TT (TT) i.e., 495 bp and 245 bp bands Tt (TC) i.e., 495 bp, 290 bp, 245 bp and 205 bp bands and tt (CC) 290 bp, 245 bp and 205 bp bands. M is 100 bp ladder.

    Techniques Used: Polymerase Chain Reaction, Amplification

    6) Product Images from "Sclera-related gene polymorphisms in high myopia"

    Article Title: Sclera-related gene polymorphisms in high myopia

    Journal: Molecular Vision

    doi:

    The PCR product of FMOD exon 2 codon 79 genetic polymorphism. The PCR product of FMOD exon 2 codon 79 genetic polymorphism was digested with BsmI. The “ G ” allele was 1,033 bp and the “ A ” allele was 751 bp + 282 bp.
    Figure Legend Snippet: The PCR product of FMOD exon 2 codon 79 genetic polymorphism. The PCR product of FMOD exon 2 codon 79 genetic polymorphism was digested with BsmI. The “ G ” allele was 1,033 bp and the “ A ” allele was 751 bp + 282 bp.

    Techniques Used: Polymerase Chain Reaction

    Related Articles

    Clone Assay:

    Article Title: trans Activity of the Norovirus Camberwell Proteinase and Cleavage of the N-Terminal Protein Encoded by ORF1
    Article Snippet: .. The PCR fragments were digested with Bsm I and Eco RI and inserted into corresponding sites in the multiple cloning site of vector pTYB12 (NEB). .. This vector encodes a T7 promoter, a chitin binding domain, and the intein gene from Saccharomyces cerevisiae , followed by a multiple cloning site.

    Article Title: In vivo imaging of murid herpesvirus-4 infection
    Article Snippet: An ORF50-deficient derivative was made by cloning a Hin cII genomic fragment (co-ordinates 63 844–70 433) into the Hin cII site of pUC9 (New England Biolabs), with the Bam HI site of pUC9 at the 70 433 end of the insert. .. This was cut with Bsm I (67 792) and Cla I (69 177) to remove most of ORF50 exon 2 (67 661–69 376), blunted and dephosphorylated with Antarctic alkaline phosphatase (New England Biolabs).

    Article Title: Galectin multimerization and lattice formation are regulated by linker region structure
    Article Snippet: Gal-1L9 was constructed by serial PCR reactions to ligate cDNA encoding the galectin-1 CRD with the first half of the L9 linker (sequence from ) and the second half of the L9 linker with a second galectin-1 CRD, which were each cloned into pCR-XL-TOPO vector (Invitrogen). .. TOPO vector with the N-terminal CRD and L9 linker cDNA was cut with restriction enzymes Xba I and Bsm I (New England Biolabs).

    Article Title: Gain-of-function variant in GLUD2 glutamate dehydrogenase modifies Parkinson's disease onset
    Article Snippet: .. From this amplified segment, a 350 bp fragment containing the T1492G change was cleaved using Bsm I and Bsr GI restriction endonucleases (New England Biolabs) and inserted into a Bsm I/ BsrG I-digested GLUD2 cDNA cloned in pBSKII+ vector, replacing the corresponding region of the gene. .. Cloning of human GLUD2 and GLUD1 genes in pBSKII+ vector has been described elsewhere.

    Article Title: Engineering of Yarrowia lipolytica for production of astaxanthin
    Article Snippet: BioBricks were assembled by into EasyCloneYALI vectors using USER cloning . .. Bsm I (New England Biolabs).

    Amplification:

    Article Title: Androgen receptor polyglutamine repeat length affects receptor activity and C2C12 cell development
    Article Snippet: Genomic DNA from human subjects ( ) carrying 14 and 33 CAG repeats, respectively (representing the smallest and largest repeat lengths available from our samples), was amplified via PCR using recombinant Taq DNA polymerase (Fermentas, Glen Burnie, MD) and the following primers: forward primer, 5′-TGCACCTACTTCAGTGGACACTGAAT-3′, reverse primer; 5′-GTATCTTCAGTGCTCTTGCCTGCG-3′. .. The reaction mix was denatured at 95°C for 5 min, followed by 40 cycles of 95°C denaturation for 30 s, 60°C annealing for 30 s, and 72°C extension for 75 s. The fragments and pCMVhAR vector were sequentially restriction enzyme-digested with Bgl II and Bsm I (New England Biolabs, Ipswich, MA) at 37°C overnight and at 65°C for 2 h, respectively.

    Article Title: Bone Mineral Density and Vitamin D Receptor Genetic Variants in Egyptian Children with Beta Thalassemia Major on Vitamin D Supplementation
    Article Snippet: .. The amplified products were digested by the New England Biolabs BsmI, TaqI, and FokI restriction endonucleases. .. BsmI and TaqI restriction endonucleases were incubated at 65°C for 15 minutes then inactivated at 80°C for 20 minutes.

    Article Title: trans Activity of the Norovirus Camberwell Proteinase and Cleavage of the N-Terminal Protein Encoded by ORF1
    Article Snippet: The proteinase gene containing mutations in the motif GDC1147 GC1149 was also amplified under similar conditions with C1P , previously named pCMC3 , used as the template. .. The PCR fragments were digested with Bsm I and Eco RI and inserted into corresponding sites in the multiple cloning site of vector pTYB12 (NEB).

    Article Title: Complement receptor 1 polymorphisms associated with resistance to severe malaria in Kenya
    Article Snippet: The amplification reactions were carried out on ~500 ng of genomic DNA in a 100 μl final volume containing 1× GeneAmp PCR Buffer II (Applied Biosystems, Foster City, CA), 2.5 mM MgCl2 , 200 μM each dNTP, 0.2 μM each primer and 5 U AmpliTaq Gold® DNA Polymerase (Applied Biosystems, Foster City, CA). .. For RFLP analysis, 28 μL of each PCR product was digested with either Mfe I (New England Biolabs, Beverly, MA), for the detection of Sl1 /Sl2 , or Bsm I (New England Biolabs), for the detection of McC a /McC b , and the restriction fragments were resolved by agarose gel electrophoresis as previously described [ ].

    Article Title: Strong Evidence of a Combination Polymorphism of the Tyrosine Kinase 2 Gene and the Signal Transducer and Activator of Transcription 3 Gene as a DNA-Based Biomarker for Susceptibility to Crohn's Disease in the Japanese Population
    Article Snippet: The amplification protocol comprised initial denaturation at 95°C for 2 min, followed by 30 cycles of denaturation at 95°C for 30 s, annealing at 64°C (rs280496, rs280519, and rs280523) or 62°C (rs2304256) for 30 s, and extension at 72°C for 30 s and final extension at 72°C for 5 min. .. The PCR products were digested with Bsl I (New England BioLabs Inc., Beverly, MA, USA) for rs280496, Hpy 99 I (New England BioLabs Inc.) for rs280519, Bsm I (New England BioLabs Inc.) for rs2304256, and Bsi E I (New England BioLabs Inc.) for rs280523.

    Article Title: Association between LMP2 and LMP7 gene polymorphisms and the risk of gastric cancer: A case-control study
    Article Snippet: .. For PCR amplification, an initial denaturation was performed at 95°C for 2 min, followed by 30 cycles of denaturation at 95°C for 35 sec, annealing at 56.5°C for LMP2-60, or 57.5°C for LMP7-145, for 30 sec and elongation at 72°C for 45 sec, with a final elongation step at 72°C for 10 min. For RFLP, the 330-bp and 351-bp PCR products for the LMP2-60 and LMP7-145 polymorphisms were digested using the 5 units each of the restriction enzymes Hha I and Bsm I (New England Biolabs, Ipswich, MA, USA) for 16 h at 37°C and 65°C, respectively, followed by electrophoresis on a 3% agarose gel. ..

    Article Title: Association of two Common Single Nucleotide Polymorphisms (+45T/G and +276G/T) of ADIPOQ Gene with Coronary Artery Disease in Type 2 Diabetic Patients
    Article Snippet: The DNA fragment containing each SNP was amplified using the following primers: +45T/G (rs 2241766): 5'-GCA GCT CCT AGA AGT AGA CTC TG-3' (forward) and 5′-TCT GTG ATG AAA GAG GCC AG-3' (reverse) +276G/T (rs 1501299): 5′-GTC TCT CCA TGG CTG ACA GT-3' (forward) and 5′- GGT GAA GAT GGG AAA GGG GA-3' (reverse) The amplification reaction was performed in a 20-µl volume containing 12.5 µl commercially available PCR premix (AccuPower PCR PremiX; Bioneer, Daejeon, Korea), 2.0 µl (10 pmol/μl) forward and reverse primers, 2.0 µl (50 ng/µl) genomic DNA and 6.5 µl sterile nuclease free water. .. The resulting 504-bp PCR product for +276G/T was digested with Bsm I (New England Biolabs, Beverly, MA) at 37°C for 12 hours according to the manufacturer’s protocol.

    Article Title: Epidemiological and Genetic Characterization of Methicillin-Resistant Staphylococcus aureus Isolates from the Ear Discharge of Outpatients with Chronic Otitis Media
    Article Snippet: The 643-bp ccrB gene fragment was amplified using a pair of primers: CRB-1 (5'-GGC TAT TAT CAA GGC AAT TTA CC -3'), and CRB-2 (5'-ACT TTA TCA CTT TTG ACT ATT TCG 3'). .. PCR products were purified by the QIAquick-spin PCR purification kit (Qiagen Inc., Valencia, CA, U.S.A.) and followed by digestion with Hinf I and Bsm I (New England Biolabs Inc., Ipswich, MA, U.S.A.).

    Article Title: Gain-of-function variant in GLUD2 glutamate dehydrogenase modifies Parkinson's disease onset
    Article Snippet: .. From this amplified segment, a 350 bp fragment containing the T1492G change was cleaved using Bsm I and Bsr GI restriction endonucleases (New England Biolabs) and inserted into a Bsm I/ BsrG I-digested GLUD2 cDNA cloned in pBSKII+ vector, replacing the corresponding region of the gene. .. Cloning of human GLUD2 and GLUD1 genes in pBSKII+ vector has been described elsewhere.

    Article Title: Engineering of Yarrowia lipolytica for production of astaxanthin
    Article Snippet: BioBricks were amplified by PCR using Phusion U polymerase (Thermo Fisher Scientific) under the following conditions: 98 °C for 30 s; 6 cycles of 98 °C for 10 s, 51 °C for 20 s and 72 °C for 30 s/kb; 26 cycles of 98 °C for 10 s, 58 °C for 20 s and 72 °C for 30 s/kb, and 72 °C for 5 min. BioBricks were purified from agarose gels using the NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel). .. Bsm I (New England Biolabs).

    Synthesized:

    Article Title: trans Activity of the Norovirus Camberwell Proteinase and Cleavage of the N-Terminal Protein Encoded by ORF1
    Article Snippet: The PCR fragments were digested with Bsm I and Eco RI and inserted into corresponding sites in the multiple cloning site of vector pTYB12 (NEB). .. The proteinase was synthesized in Escherichia coli as a fusion protein consisting of the chitin binding domain-intein-CAM proteinase (Fig. ).

    Construct:

    Article Title: Androgen receptor polyglutamine repeat length affects receptor activity and C2C12 cell development
    Article Snippet: The human androgen receptor expression vector pCMVhAR (a kind gift from Dr. Elizabeth Wilson, Department of Biochemistry and Biophysics, University of North Carolina, Chapel Hill, NC) was used to derive human (h) AR constructs encoding for 14, 24 (parent vector), or 33 AR CAG repeats. .. The reaction mix was denatured at 95°C for 5 min, followed by 40 cycles of 95°C denaturation for 30 s, 60°C annealing for 30 s, and 72°C extension for 75 s. The fragments and pCMVhAR vector were sequentially restriction enzyme-digested with Bgl II and Bsm I (New England Biolabs, Ipswich, MA) at 37°C overnight and at 65°C for 2 h, respectively.

    Article Title: Galectin multimerization and lattice formation are regulated by linker region structure
    Article Snippet: Gal-1L9 was constructed by serial PCR reactions to ligate cDNA encoding the galectin-1 CRD with the first half of the L9 linker (sequence from ) and the second half of the L9 linker with a second galectin-1 CRD, which were each cloned into pCR-XL-TOPO vector (Invitrogen). .. TOPO vector with the N-terminal CRD and L9 linker cDNA was cut with restriction enzymes Xba I and Bsm I (New England Biolabs).

    Electrophoresis:

    Article Title: Association between LMP2 and LMP7 gene polymorphisms and the risk of gastric cancer: A case-control study
    Article Snippet: .. For PCR amplification, an initial denaturation was performed at 95°C for 2 min, followed by 30 cycles of denaturation at 95°C for 35 sec, annealing at 56.5°C for LMP2-60, or 57.5°C for LMP7-145, for 30 sec and elongation at 72°C for 45 sec, with a final elongation step at 72°C for 10 min. For RFLP, the 330-bp and 351-bp PCR products for the LMP2-60 and LMP7-145 polymorphisms were digested using the 5 units each of the restriction enzymes Hha I and Bsm I (New England Biolabs, Ipswich, MA, USA) for 16 h at 37°C and 65°C, respectively, followed by electrophoresis on a 3% agarose gel. ..

    Article Title: Association of two Common Single Nucleotide Polymorphisms (+45T/G and +276G/T) of ADIPOQ Gene with Coronary Artery Disease in Type 2 Diabetic Patients
    Article Snippet: The resulting 504-bp PCR product for +276G/T was digested with Bsm I (New England Biolabs, Beverly, MA) at 37°C for 12 hours according to the manufacturer’s protocol. .. For genotyping, digested fragments were separated by electrophoresis on 2% agarose gel and visualized by ethidium bromide staining.

    Microarray:

    Article Title: Galectin multimerization and lattice formation are regulated by linker region structure
    Article Snippet: TOPO vector with the N-terminal CRD and L9 linker cDNA was cut with restriction enzymes Xba I and Bsm I (New England Biolabs). .. Biotinylated proteins at 200 µg/mL or 2 µg/mL were assayed at Core H at the Consortium for Functional Glycomics on the mammalian version 4 slide glycan microarray.

    Incubation:

    Article Title: Bone Mineral Density and Vitamin D Receptor Genetic Variants in Egyptian Children with Beta Thalassemia Major on Vitamin D Supplementation
    Article Snippet: The amplified products were digested by the New England Biolabs BsmI, TaqI, and FokI restriction endonucleases. .. BsmI and TaqI restriction endonucleases were incubated at 65°C for 15 minutes then inactivated at 80°C for 20 minutes.

    Article Title: Engineering of Yarrowia lipolytica for production of astaxanthin
    Article Snippet: BioBricks were incubated in CutSmart® buffer (New England Biolabs) with USER enzyme and the parental vector for 25 min at 37 °C, followed by 10 min at 25 °C, 10 min at 20 °C and 10 min at 15 °C. .. Bsm I (New England Biolabs).

    Luciferase:

    Article Title: In vivo imaging of murid herpesvirus-4 infection
    Article Snippet: The luciferase coding sequence plus polyadenylation signal was removed from pGL4.10 (Promega) by digestion with Bgl II/Sal I and cloned into the Bam HI/Sal I sites of pSP73, downstream of a 500 bp MuHV-4 M3 promoter ( ). .. This was cut with Bsm I (67 792) and Cla I (69 177) to remove most of ORF50 exon 2 (67 661–69 376), blunted and dephosphorylated with Antarctic alkaline phosphatase (New England Biolabs).

    Infection:

    Article Title: Gain-of-function variant in GLUD2 glutamate dehydrogenase modifies Parkinson's disease onset
    Article Snippet: From this amplified segment, a 350 bp fragment containing the T1492G change was cleaved using Bsm I and Bsr GI restriction endonucleases (New England Biolabs) and inserted into a Bsm I/ BsrG I-digested GLUD2 cDNA cloned in pBSKII+ vector, replacing the corresponding region of the gene. .. Cultured cells expressing the recombinant GDH proteins were harvested 5 days after infection.

    Expressing:

    Article Title: Androgen receptor polyglutamine repeat length affects receptor activity and C2C12 cell development
    Article Snippet: The human androgen receptor expression vector pCMVhAR (a kind gift from Dr. Elizabeth Wilson, Department of Biochemistry and Biophysics, University of North Carolina, Chapel Hill, NC) was used to derive human (h) AR constructs encoding for 14, 24 (parent vector), or 33 AR CAG repeats. .. The reaction mix was denatured at 95°C for 5 min, followed by 40 cycles of 95°C denaturation for 30 s, 60°C annealing for 30 s, and 72°C extension for 75 s. The fragments and pCMVhAR vector were sequentially restriction enzyme-digested with Bgl II and Bsm I (New England Biolabs, Ipswich, MA) at 37°C overnight and at 65°C for 2 h, respectively.

    Article Title: In vivo imaging of murid herpesvirus-4 infection
    Article Snippet: The expression cassette plus genomic flanks was subcloned into the Bam HI site of the pST76K-SR shuttle vector and recombined into a MuHV-4 bacterial artificial chromosome (BAC; ). .. This was cut with Bsm I (67 792) and Cla I (69 177) to remove most of ORF50 exon 2 (67 661–69 376), blunted and dephosphorylated with Antarctic alkaline phosphatase (New England Biolabs).

    Article Title: Galectin multimerization and lattice formation are regulated by linker region structure
    Article Snippet: Paragraph title: Galectin construction, expression and biotinylation ... TOPO vector with the N-terminal CRD and L9 linker cDNA was cut with restriction enzymes Xba I and Bsm I (New England Biolabs).

    Article Title: Gain-of-function variant in GLUD2 glutamate dehydrogenase modifies Parkinson's disease onset
    Article Snippet: Paragraph title: Production, expression and purification of the variant and wild-type GDHs ... From this amplified segment, a 350 bp fragment containing the T1492G change was cleaved using Bsm I and Bsr GI restriction endonucleases (New England Biolabs) and inserted into a Bsm I/ BsrG I-digested GLUD2 cDNA cloned in pBSKII+ vector, replacing the corresponding region of the gene.

    Modification:

    Article Title: trans Activity of the Norovirus Camberwell Proteinase and Cleavage of the N-Terminal Protein Encoded by ORF1
    Article Snippet: The modified motif was GDA1147 GA1149 . .. The PCR fragments were digested with Bsm I and Eco RI and inserted into corresponding sites in the multiple cloning site of vector pTYB12 (NEB).

    Article Title: Galectin multimerization and lattice formation are regulated by linker region structure
    Article Snippet: TOPO vector with the N-terminal CRD and L9 linker cDNA was cut with restriction enzymes Xba I and Bsm I (New England Biolabs). .. Vector and reaction products were ligated with T4 DNA ligase and transformed into JM109 cells. cDNA was verified by DNA sequencing (UC Davis Sequencing) and Gal-1 L9 in modified pGEMEX vector was expressed and purified as for galectin-1.

    Transformation Assay:

    Article Title: Androgen receptor polyglutamine repeat length affects receptor activity and C2C12 cell development
    Article Snippet: The reaction mix was denatured at 95°C for 5 min, followed by 40 cycles of 95°C denaturation for 30 s, 60°C annealing for 30 s, and 72°C extension for 75 s. The fragments and pCMVhAR vector were sequentially restriction enzyme-digested with Bgl II and Bsm I (New England Biolabs, Ipswich, MA) at 37°C overnight and at 65°C for 2 h, respectively. .. Ligated products were transformed into MAX Efficiency DH5α competent Escherichia coli bacterial cells (Invitrogen) before being seeded on ampicillin-positive agar.

    Article Title: Galectin multimerization and lattice formation are regulated by linker region structure
    Article Snippet: TOPO vector with the N-terminal CRD and L9 linker cDNA was cut with restriction enzymes Xba I and Bsm I (New England Biolabs). .. Vector and reaction products were ligated with T4 DNA ligase and transformed into JM109 cells. cDNA was verified by DNA sequencing (UC Davis Sequencing) and Gal-1 L9 in modified pGEMEX vector was expressed and purified as for galectin-1.

    Article Title: Engineering of Yarrowia lipolytica for production of astaxanthin
    Article Snippet: Bsm I (New England Biolabs). .. The USER reactions were transformed into chemically competent E. coli DH5α.

    Hybridization:

    Article Title: Inositol 1,3,4,5,6-Pentakisphosphate 2-Kinase from Maize: Molecular and Biochemical Characterization [OA]
    Article Snippet: Approximately 12 μ g genomic DNA was digested overnight with the following restriction enzymes: Eco RI, Bam HI, Ban II, Nco I, Nsi I, and Bsm I (New England Biolabs). .. Hybridization was performed at 65°C overnight with a probe consisting of a PCR-amplified 916 bp fragment of ZmIPK1 cDNA (the same probe described for BAC library screening) and Hin dIII digested λ DNA labeled with 32 P-dCTP using the Random Priming DNA labeling system from Invitrogen.

    Southern Blot:

    Article Title: Inositol 1,3,4,5,6-Pentakisphosphate 2-Kinase from Maize: Molecular and Biochemical Characterization [OA]
    Article Snippet: Paragraph title: Southern-Blot Analysis ... Approximately 12 μ g genomic DNA was digested overnight with the following restriction enzymes: Eco RI, Bam HI, Ban II, Nco I, Nsi I, and Bsm I (New England Biolabs).

    Library Screening:

    Article Title: Inositol 1,3,4,5,6-Pentakisphosphate 2-Kinase from Maize: Molecular and Biochemical Characterization [OA]
    Article Snippet: Approximately 12 μ g genomic DNA was digested overnight with the following restriction enzymes: Eco RI, Bam HI, Ban II, Nco I, Nsi I, and Bsm I (New England Biolabs). .. Hybridization was performed at 65°C overnight with a probe consisting of a PCR-amplified 916 bp fragment of ZmIPK1 cDNA (the same probe described for BAC library screening) and Hin dIII digested λ DNA labeled with 32 P-dCTP using the Random Priming DNA labeling system from Invitrogen.

    Cell Culture:

    Article Title: Gain-of-function variant in GLUD2 glutamate dehydrogenase modifies Parkinson's disease onset
    Article Snippet: From this amplified segment, a 350 bp fragment containing the T1492G change was cleaved using Bsm I and Bsr GI restriction endonucleases (New England Biolabs) and inserted into a Bsm I/ BsrG I-digested GLUD2 cDNA cloned in pBSKII+ vector, replacing the corresponding region of the gene. .. Cultured cells expressing the recombinant GDH proteins were harvested 5 days after infection.

    DNA Sequencing:

    Article Title: Galectin multimerization and lattice formation are regulated by linker region structure
    Article Snippet: TOPO vector with the N-terminal CRD and L9 linker cDNA was cut with restriction enzymes Xba I and Bsm I (New England Biolabs). .. Vector and reaction products were ligated with T4 DNA ligase and transformed into JM109 cells. cDNA was verified by DNA sequencing (UC Davis Sequencing) and Gal-1 L9 in modified pGEMEX vector was expressed and purified as for galectin-1.

    DNA Labeling:

    Article Title: Inositol 1,3,4,5,6-Pentakisphosphate 2-Kinase from Maize: Molecular and Biochemical Characterization [OA]
    Article Snippet: Approximately 12 μ g genomic DNA was digested overnight with the following restriction enzymes: Eco RI, Bam HI, Ban II, Nco I, Nsi I, and Bsm I (New England Biolabs). .. Hybridization was performed at 65°C overnight with a probe consisting of a PCR-amplified 916 bp fragment of ZmIPK1 cDNA (the same probe described for BAC library screening) and Hin dIII digested λ DNA labeled with 32 P-dCTP using the Random Priming DNA labeling system from Invitrogen.

    Sequencing:

    Article Title: Bone Mineral Density and Vitamin D Receptor Genetic Variants in Egyptian Children with Beta Thalassemia Major on Vitamin D Supplementation
    Article Snippet: Two sequence-specific primers were used for each targeted fragment of VDR gene including intron 9 TaqI restriction site, intron 8 BsmI restriction site and intron 2 FokI restriction site as previously described. .. The amplified products were digested by the New England Biolabs BsmI, TaqI, and FokI restriction endonucleases.

    Article Title: BIG Regulates Dynamic Adjustment of Circadian Period in Arabidopsis thaliana
    Article Snippet: Paragraph title: SNP Verification with dCAPS and Sanger Sequencing ... Hin dIII (Fisher Scientific), Tas I (New England Biolabs), and Bsm I (New England Biolabs) reactions were prepared for 100 µg of DNA in their optimal buffers as specified in their instructions.

    Article Title: In vivo imaging of murid herpesvirus-4 infection
    Article Snippet: The luciferase coding sequence plus polyadenylation signal was removed from pGL4.10 (Promega) by digestion with Bgl II/Sal I and cloned into the Bam HI/Sal I sites of pSP73, downstream of a 500 bp MuHV-4 M3 promoter ( ). .. This was cut with Bsm I (67 792) and Cla I (69 177) to remove most of ORF50 exon 2 (67 661–69 376), blunted and dephosphorylated with Antarctic alkaline phosphatase (New England Biolabs).

    Article Title: Galectin multimerization and lattice formation are regulated by linker region structure
    Article Snippet: Gal-1L9 was constructed by serial PCR reactions to ligate cDNA encoding the galectin-1 CRD with the first half of the L9 linker (sequence from ) and the second half of the L9 linker with a second galectin-1 CRD, which were each cloned into pCR-XL-TOPO vector (Invitrogen). .. TOPO vector with the N-terminal CRD and L9 linker cDNA was cut with restriction enzymes Xba I and Bsm I (New England Biolabs).

    Article Title: Engineering of Yarrowia lipolytica for production of astaxanthin
    Article Snippet: Bsm I (New England Biolabs). .. Correct assembly was verified by sequencing.

    Binding Assay:

    Article Title: trans Activity of the Norovirus Camberwell Proteinase and Cleavage of the N-Terminal Protein Encoded by ORF1
    Article Snippet: The PCR fragments were digested with Bsm I and Eco RI and inserted into corresponding sites in the multiple cloning site of vector pTYB12 (NEB). .. This vector encodes a T7 promoter, a chitin binding domain, and the intein gene from Saccharomyces cerevisiae , followed by a multiple cloning site.

    Cellular Antioxidant Activity Assay:

    Article Title: Epidemiological and Genetic Characterization of Methicillin-Resistant Staphylococcus aureus Isolates from the Ear Discharge of Outpatients with Chronic Otitis Media
    Article Snippet: The 643-bp ccrB gene fragment was amplified using a pair of primers: CRB-1 (5'-GGC TAT TAT CAA GGC AAT TTA CC -3'), and CRB-2 (5'-ACT TTA TCA CTT TTG ACT ATT TCG 3'). .. PCR products were purified by the QIAquick-spin PCR purification kit (Qiagen Inc., Valencia, CA, U.S.A.) and followed by digestion with Hinf I and Bsm I (New England Biolabs Inc., Ipswich, MA, U.S.A.).

    DNA Extraction:

    Article Title: Association between LMP2 and LMP7 gene polymorphisms and the risk of gastric cancer: A case-control study
    Article Snippet: Genomic DNA was extracted from 2 ml of peripheral blood using standard methods, and the protocol used for the genomic DNA extraction was described in a previous study ( ). .. For PCR amplification, an initial denaturation was performed at 95°C for 2 min, followed by 30 cycles of denaturation at 95°C for 35 sec, annealing at 56.5°C for LMP2-60, or 57.5°C for LMP7-145, for 30 sec and elongation at 72°C for 45 sec, with a final elongation step at 72°C for 10 min. For RFLP, the 330-bp and 351-bp PCR products for the LMP2-60 and LMP7-145 polymorphisms were digested using the 5 units each of the restriction enzymes Hha I and Bsm I (New England Biolabs, Ipswich, MA, USA) for 16 h at 37°C and 65°C, respectively, followed by electrophoresis on a 3% agarose gel.

    DNA Purification:

    Article Title: Association of two Common Single Nucleotide Polymorphisms (+45T/G and +276G/T) of ADIPOQ Gene with Coronary Artery Disease in Type 2 Diabetic Patients
    Article Snippet: Venous blood samples from all patients were collected in EDTA-containing tubes following an overnight fasting of at least 12 h. Genotyping the +45T/G and +276G/T polymor-phisms of ADIPOQ gene Genomic DNA was extracted from the whole blood using a DNA purification kit (SinaClon BioScience Co., Tehran, Iran). .. The resulting 504-bp PCR product for +276G/T was digested with Bsm I (New England Biolabs, Beverly, MA) at 37°C for 12 hours according to the manufacturer’s protocol.

    Isolation:

    Article Title: Inositol 1,3,4,5,6-Pentakisphosphate 2-Kinase from Maize: Molecular and Biochemical Characterization [OA]
    Article Snippet: Genomic DNA from inbred 5XH751 was isolated from 3-week-old leaf tissues as described by . .. Approximately 12 μ g genomic DNA was digested overnight with the following restriction enzymes: Eco RI, Bam HI, Ban II, Nco I, Nsi I, and Bsm I (New England Biolabs).

    Size-exclusion Chromatography:

    Article Title: Association between LMP2 and LMP7 gene polymorphisms and the risk of gastric cancer: A case-control study
    Article Snippet: .. For PCR amplification, an initial denaturation was performed at 95°C for 2 min, followed by 30 cycles of denaturation at 95°C for 35 sec, annealing at 56.5°C for LMP2-60, or 57.5°C for LMP7-145, for 30 sec and elongation at 72°C for 45 sec, with a final elongation step at 72°C for 10 min. For RFLP, the 330-bp and 351-bp PCR products for the LMP2-60 and LMP7-145 polymorphisms were digested using the 5 units each of the restriction enzymes Hha I and Bsm I (New England Biolabs, Ipswich, MA, USA) for 16 h at 37°C and 65°C, respectively, followed by electrophoresis on a 3% agarose gel. ..

    Article Title: Epidemiological and Genetic Characterization of Methicillin-Resistant Staphylococcus aureus Isolates from the Ear Discharge of Outpatients with Chronic Otitis Media
    Article Snippet: Thermal cycling was set at 30 cycles (30 sec for denaturation at 94℃, 1 min for annealing at 50℃, and 2 min for elongation at 72℃). .. PCR products were purified by the QIAquick-spin PCR purification kit (Qiagen Inc., Valencia, CA, U.S.A.) and followed by digestion with Hinf I and Bsm I (New England Biolabs Inc., Ipswich, MA, U.S.A.).

    Labeling:

    Article Title: Inositol 1,3,4,5,6-Pentakisphosphate 2-Kinase from Maize: Molecular and Biochemical Characterization [OA]
    Article Snippet: Approximately 12 μ g genomic DNA was digested overnight with the following restriction enzymes: Eco RI, Bam HI, Ban II, Nco I, Nsi I, and Bsm I (New England Biolabs). .. Hybridization was performed at 65°C overnight with a probe consisting of a PCR-amplified 916 bp fragment of ZmIPK1 cDNA (the same probe described for BAC library screening) and Hin dIII digested λ DNA labeled with 32 P-dCTP using the Random Priming DNA labeling system from Invitrogen.

    Purification:

    Article Title: Androgen receptor polyglutamine repeat length affects receptor activity and C2C12 cell development
    Article Snippet: The reaction mix was denatured at 95°C for 5 min, followed by 40 cycles of 95°C denaturation for 30 s, 60°C annealing for 30 s, and 72°C extension for 75 s. The fragments and pCMVhAR vector were sequentially restriction enzyme-digested with Bgl II and Bsm I (New England Biolabs, Ipswich, MA) at 37°C overnight and at 65°C for 2 h, respectively. .. Digested PCR products and vector backbone were resolved via agarose gel electrophoresis and purified using the PureLink quick gel extraction kit (Invitrogen, Carlsbad, CA).

    Article Title: BIG Regulates Dynamic Adjustment of Circadian Period in Arabidopsis thaliana
    Article Snippet: PCR products were purified using the QIAquick PCR Purification Kit (Qiagen) and quantified using a Nanodrop 2000 (Thermo Scientific). .. Hin dIII (Fisher Scientific), Tas I (New England Biolabs), and Bsm I (New England Biolabs) reactions were prepared for 100 µg of DNA in their optimal buffers as specified in their instructions.

    Article Title: trans Activity of the Norovirus Camberwell Proteinase and Cleavage of the N-Terminal Protein Encoded by ORF1
    Article Snippet: Paragraph title: Synthesis and purification of CAM proteinase. ... The PCR fragments were digested with Bsm I and Eco RI and inserted into corresponding sites in the multiple cloning site of vector pTYB12 (NEB).

    Article Title: Epidemiological and Genetic Characterization of Methicillin-Resistant Staphylococcus aureus Isolates from the Ear Discharge of Outpatients with Chronic Otitis Media
    Article Snippet: .. PCR products were purified by the QIAquick-spin PCR purification kit (Qiagen Inc., Valencia, CA, U.S.A.) and followed by digestion with Hinf I and Bsm I (New England Biolabs Inc., Ipswich, MA, U.S.A.). .. The RFLP patterns were analyzed using 2% agarose gel electrophoresis.

    Article Title: Galectin multimerization and lattice formation are regulated by linker region structure
    Article Snippet: Galectin-1, gal-1GG and gal-1-9-1 were constructed, expressed and purified as described ( ; ). .. TOPO vector with the N-terminal CRD and L9 linker cDNA was cut with restriction enzymes Xba I and Bsm I (New England Biolabs).

    Article Title: Gain-of-function variant in GLUD2 glutamate dehydrogenase modifies Parkinson's disease onset
    Article Snippet: Paragraph title: Production, expression and purification of the variant and wild-type GDHs ... From this amplified segment, a 350 bp fragment containing the T1492G change was cleaved using Bsm I and Bsr GI restriction endonucleases (New England Biolabs) and inserted into a Bsm I/ BsrG I-digested GLUD2 cDNA cloned in pBSKII+ vector, replacing the corresponding region of the gene.

    Article Title: Engineering of Yarrowia lipolytica for production of astaxanthin
    Article Snippet: BioBricks were amplified by PCR using Phusion U polymerase (Thermo Fisher Scientific) under the following conditions: 98 °C for 30 s; 6 cycles of 98 °C for 10 s, 51 °C for 20 s and 72 °C for 30 s/kb; 26 cycles of 98 °C for 10 s, 58 °C for 20 s and 72 °C for 30 s/kb, and 72 °C for 5 min. BioBricks were purified from agarose gels using the NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel). .. Bsm I (New England Biolabs).

    Polymerase Chain Reaction:

    Article Title: Androgen receptor polyglutamine repeat length affects receptor activity and C2C12 cell development
    Article Snippet: Genomic DNA from human subjects ( ) carrying 14 and 33 CAG repeats, respectively (representing the smallest and largest repeat lengths available from our samples), was amplified via PCR using recombinant Taq DNA polymerase (Fermentas, Glen Burnie, MD) and the following primers: forward primer, 5′-TGCACCTACTTCAGTGGACACTGAAT-3′, reverse primer; 5′-GTATCTTCAGTGCTCTTGCCTGCG-3′. .. The reaction mix was denatured at 95°C for 5 min, followed by 40 cycles of 95°C denaturation for 30 s, 60°C annealing for 30 s, and 72°C extension for 75 s. The fragments and pCMVhAR vector were sequentially restriction enzyme-digested with Bgl II and Bsm I (New England Biolabs, Ipswich, MA) at 37°C overnight and at 65°C for 2 h, respectively.

    Article Title: Bone Mineral Density and Vitamin D Receptor Genetic Variants in Egyptian Children with Beta Thalassemia Major on Vitamin D Supplementation
    Article Snippet: The PCR primers were: One hundred ng DNA was added to 12.5 ul of MyTaq Red Mix (Bioline, London, United Kingdom) and ten pmol of each primer in a total volume of 25 uL reaction mix. .. The amplified products were digested by the New England Biolabs BsmI, TaqI, and FokI restriction endonucleases.

    Article Title: BIG Regulates Dynamic Adjustment of Circadian Period in Arabidopsis thaliana
    Article Snippet: PCR products were purified using the QIAquick PCR Purification Kit (Qiagen) and quantified using a Nanodrop 2000 (Thermo Scientific). .. Hin dIII (Fisher Scientific), Tas I (New England Biolabs), and Bsm I (New England Biolabs) reactions were prepared for 100 µg of DNA in their optimal buffers as specified in their instructions.

    Article Title: trans Activity of the Norovirus Camberwell Proteinase and Cleavage of the N-Terminal Protein Encoded by ORF1
    Article Snippet: .. The PCR fragments were digested with Bsm I and Eco RI and inserted into corresponding sites in the multiple cloning site of vector pTYB12 (NEB). .. This vector encodes a T7 promoter, a chitin binding domain, and the intein gene from Saccharomyces cerevisiae , followed by a multiple cloning site.

    Article Title: Complement receptor 1 polymorphisms associated with resistance to severe malaria in Kenya
    Article Snippet: .. For RFLP analysis, 28 μL of each PCR product was digested with either Mfe I (New England Biolabs, Beverly, MA), for the detection of Sl1 /Sl2 , or Bsm I (New England Biolabs), for the detection of McC a /McC b , and the restriction fragments were resolved by agarose gel electrophoresis as previously described [ ]. .. Statistical analysis All analyses were done using SPSS version 11.5 (SPSS Inc., Chicago, IL).

    Article Title: Strong Evidence of a Combination Polymorphism of the Tyrosine Kinase 2 Gene and the Signal Transducer and Activator of Transcription 3 Gene as a DNA-Based Biomarker for Susceptibility to Crohn's Disease in the Japanese Population
    Article Snippet: .. The PCR products were digested with Bsl I (New England BioLabs Inc., Beverly, MA, USA) for rs280496, Hpy 99 I (New England BioLabs Inc.) for rs280519, Bsm I (New England BioLabs Inc.) for rs2304256, and Bsi E I (New England BioLabs Inc.) for rs280523. ..

    Article Title: Association between LMP2 and LMP7 gene polymorphisms and the risk of gastric cancer: A case-control study
    Article Snippet: .. For PCR amplification, an initial denaturation was performed at 95°C for 2 min, followed by 30 cycles of denaturation at 95°C for 35 sec, annealing at 56.5°C for LMP2-60, or 57.5°C for LMP7-145, for 30 sec and elongation at 72°C for 45 sec, with a final elongation step at 72°C for 10 min. For RFLP, the 330-bp and 351-bp PCR products for the LMP2-60 and LMP7-145 polymorphisms were digested using the 5 units each of the restriction enzymes Hha I and Bsm I (New England Biolabs, Ipswich, MA, USA) for 16 h at 37°C and 65°C, respectively, followed by electrophoresis on a 3% agarose gel. ..

    Article Title: Association of two Common Single Nucleotide Polymorphisms (+45T/G and +276G/T) of ADIPOQ Gene with Coronary Artery Disease in Type 2 Diabetic Patients
    Article Snippet: .. The resulting 504-bp PCR product for +276G/T was digested with Bsm I (New England Biolabs, Beverly, MA) at 37°C for 12 hours according to the manufacturer’s protocol. ..

    Article Title: Epidemiological and Genetic Characterization of Methicillin-Resistant Staphylococcus aureus Isolates from the Ear Discharge of Outpatients with Chronic Otitis Media
    Article Snippet: .. PCR products were purified by the QIAquick-spin PCR purification kit (Qiagen Inc., Valencia, CA, U.S.A.) and followed by digestion with Hinf I and Bsm I (New England Biolabs Inc., Ipswich, MA, U.S.A.). .. The RFLP patterns were analyzed using 2% agarose gel electrophoresis.

    Article Title: Galectin multimerization and lattice formation are regulated by linker region structure
    Article Snippet: Gal-1L9 was constructed by serial PCR reactions to ligate cDNA encoding the galectin-1 CRD with the first half of the L9 linker (sequence from ) and the second half of the L9 linker with a second galectin-1 CRD, which were each cloned into pCR-XL-TOPO vector (Invitrogen). .. TOPO vector with the N-terminal CRD and L9 linker cDNA was cut with restriction enzymes Xba I and Bsm I (New England Biolabs).

    Article Title: Inositol 1,3,4,5,6-Pentakisphosphate 2-Kinase from Maize: Molecular and Biochemical Characterization [OA]
    Article Snippet: Approximately 12 μ g genomic DNA was digested overnight with the following restriction enzymes: Eco RI, Bam HI, Ban II, Nco I, Nsi I, and Bsm I (New England Biolabs). .. Hybridization was performed at 65°C overnight with a probe consisting of a PCR-amplified 916 bp fragment of ZmIPK1 cDNA (the same probe described for BAC library screening) and Hin dIII digested λ DNA labeled with 32 P-dCTP using the Random Priming DNA labeling system from Invitrogen.

    Article Title: Gain-of-function variant in GLUD2 glutamate dehydrogenase modifies Parkinson's disease onset
    Article Snippet: Using genomic DNA from a male PD patient carrying the T1492G variant as a template, a 527 bp segment of the GLUD2 gene was PCR amplified (primers: 5′-TGAATGCTGGAGGAGTGACA-3′ and 5′-TGGATTGACTTGAGAATGG-3′). .. From this amplified segment, a 350 bp fragment containing the T1492G change was cleaved using Bsm I and Bsr GI restriction endonucleases (New England Biolabs) and inserted into a Bsm I/ BsrG I-digested GLUD2 cDNA cloned in pBSKII+ vector, replacing the corresponding region of the gene.

    Article Title: Engineering of Yarrowia lipolytica for production of astaxanthin
    Article Snippet: BioBricks were amplified by PCR using Phusion U polymerase (Thermo Fisher Scientific) under the following conditions: 98 °C for 30 s; 6 cycles of 98 °C for 10 s, 51 °C for 20 s and 72 °C for 30 s/kb; 26 cycles of 98 °C for 10 s, 58 °C for 20 s and 72 °C for 30 s/kb, and 72 °C for 5 min. BioBricks were purified from agarose gels using the NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel). .. Bsm I (New England Biolabs).

    Staining:

    Article Title: Bone Mineral Density and Vitamin D Receptor Genetic Variants in Egyptian Children with Beta Thalassemia Major on Vitamin D Supplementation
    Article Snippet: The amplified products were digested by the New England Biolabs BsmI, TaqI, and FokI restriction endonucleases. .. Digested products were electrophoretically separated electrophoresed through 2% agarose gels and 0.5× TBE buffer and visualized under UV light with ethidium bromide staining using Dolphin Doc gel documentation system ( ).

    Article Title: Association of two Common Single Nucleotide Polymorphisms (+45T/G and +276G/T) of ADIPOQ Gene with Coronary Artery Disease in Type 2 Diabetic Patients
    Article Snippet: The resulting 504-bp PCR product for +276G/T was digested with Bsm I (New England Biolabs, Beverly, MA) at 37°C for 12 hours according to the manufacturer’s protocol. .. For genotyping, digested fragments were separated by electrophoresis on 2% agarose gel and visualized by ethidium bromide staining.

    Activated Clotting Time Assay:

    Article Title: Epidemiological and Genetic Characterization of Methicillin-Resistant Staphylococcus aureus Isolates from the Ear Discharge of Outpatients with Chronic Otitis Media
    Article Snippet: The 643-bp ccrB gene fragment was amplified using a pair of primers: CRB-1 (5'-GGC TAT TAT CAA GGC AAT TTA CC -3'), and CRB-2 (5'-ACT TTA TCA CTT TTG ACT ATT TCG 3'). .. PCR products were purified by the QIAquick-spin PCR purification kit (Qiagen Inc., Valencia, CA, U.S.A.) and followed by digestion with Hinf I and Bsm I (New England Biolabs Inc., Ipswich, MA, U.S.A.).

    Plasmid Preparation:

    Article Title: Androgen receptor polyglutamine repeat length affects receptor activity and C2C12 cell development
    Article Snippet: .. The reaction mix was denatured at 95°C for 5 min, followed by 40 cycles of 95°C denaturation for 30 s, 60°C annealing for 30 s, and 72°C extension for 75 s. The fragments and pCMVhAR vector were sequentially restriction enzyme-digested with Bgl II and Bsm I (New England Biolabs, Ipswich, MA) at 37°C overnight and at 65°C for 2 h, respectively. .. Digested PCR products and vector backbone were resolved via agarose gel electrophoresis and purified using the PureLink quick gel extraction kit (Invitrogen, Carlsbad, CA).

    Article Title: trans Activity of the Norovirus Camberwell Proteinase and Cleavage of the N-Terminal Protein Encoded by ORF1
    Article Snippet: .. The PCR fragments were digested with Bsm I and Eco RI and inserted into corresponding sites in the multiple cloning site of vector pTYB12 (NEB). .. This vector encodes a T7 promoter, a chitin binding domain, and the intein gene from Saccharomyces cerevisiae , followed by a multiple cloning site.

    Article Title: In vivo imaging of murid herpesvirus-4 infection
    Article Snippet: The expression cassette plus genomic flanks was subcloned into the Bam HI site of the pST76K-SR shuttle vector and recombined into a MuHV-4 bacterial artificial chromosome (BAC; ). .. This was cut with Bsm I (67 792) and Cla I (69 177) to remove most of ORF50 exon 2 (67 661–69 376), blunted and dephosphorylated with Antarctic alkaline phosphatase (New England Biolabs).

    Article Title: Galectin multimerization and lattice formation are regulated by linker region structure
    Article Snippet: .. TOPO vector with the N-terminal CRD and L9 linker cDNA was cut with restriction enzymes Xba I and Bsm I (New England Biolabs). .. TOPO vector with the C-terminal CRD and L9 linker cDNA was cut with restriction enzymes Bam HI and Bsm I. pGEMEX vector was cut with restriction enzymes Xba I and Bam HI.

    Article Title: Gain-of-function variant in GLUD2 glutamate dehydrogenase modifies Parkinson's disease onset
    Article Snippet: .. From this amplified segment, a 350 bp fragment containing the T1492G change was cleaved using Bsm I and Bsr GI restriction endonucleases (New England Biolabs) and inserted into a Bsm I/ BsrG I-digested GLUD2 cDNA cloned in pBSKII+ vector, replacing the corresponding region of the gene. .. Cloning of human GLUD2 and GLUD1 genes in pBSKII+ vector has been described elsewhere.

    Article Title: Engineering of Yarrowia lipolytica for production of astaxanthin
    Article Snippet: Paragraph title: Plasmid construction ... Bsm I (New England Biolabs).

    Software:

    Article Title: Association of two Common Single Nucleotide Polymorphisms (+45T/G and +276G/T) of ADIPOQ Gene with Coronary Artery Disease in Type 2 Diabetic Patients
    Article Snippet: The resulting 504-bp PCR product for +276G/T was digested with Bsm I (New England Biolabs, Beverly, MA) at 37°C for 12 hours according to the manufacturer’s protocol. .. Statistical analysis All statistical analyses were performed with the SPSS version 15.0 software (SPSS, Inc., Chicago IL, USA).

    Functional Assay:

    Article Title: Galectin multimerization and lattice formation are regulated by linker region structure
    Article Snippet: TOPO vector with the N-terminal CRD and L9 linker cDNA was cut with restriction enzymes Xba I and Bsm I (New England Biolabs). .. Biotinylated proteins at 200 µg/mL or 2 µg/mL were assayed at Core H at the Consortium for Functional Glycomics on the mammalian version 4 slide glycan microarray.

    Recombinant:

    Article Title: Androgen receptor polyglutamine repeat length affects receptor activity and C2C12 cell development
    Article Snippet: Genomic DNA from human subjects ( ) carrying 14 and 33 CAG repeats, respectively (representing the smallest and largest repeat lengths available from our samples), was amplified via PCR using recombinant Taq DNA polymerase (Fermentas, Glen Burnie, MD) and the following primers: forward primer, 5′-TGCACCTACTTCAGTGGACACTGAAT-3′, reverse primer; 5′-GTATCTTCAGTGCTCTTGCCTGCG-3′. .. The reaction mix was denatured at 95°C for 5 min, followed by 40 cycles of 95°C denaturation for 30 s, 60°C annealing for 30 s, and 72°C extension for 75 s. The fragments and pCMVhAR vector were sequentially restriction enzyme-digested with Bgl II and Bsm I (New England Biolabs, Ipswich, MA) at 37°C overnight and at 65°C for 2 h, respectively.

    Article Title: Gain-of-function variant in GLUD2 glutamate dehydrogenase modifies Parkinson's disease onset
    Article Snippet: From this amplified segment, a 350 bp fragment containing the T1492G change was cleaved using Bsm I and Bsr GI restriction endonucleases (New England Biolabs) and inserted into a Bsm I/ BsrG I-digested GLUD2 cDNA cloned in pBSKII+ vector, replacing the corresponding region of the gene. .. Cultured cells expressing the recombinant GDH proteins were harvested 5 days after infection.

    Agarose Gel Electrophoresis:

    Article Title: Androgen receptor polyglutamine repeat length affects receptor activity and C2C12 cell development
    Article Snippet: The reaction mix was denatured at 95°C for 5 min, followed by 40 cycles of 95°C denaturation for 30 s, 60°C annealing for 30 s, and 72°C extension for 75 s. The fragments and pCMVhAR vector were sequentially restriction enzyme-digested with Bgl II and Bsm I (New England Biolabs, Ipswich, MA) at 37°C overnight and at 65°C for 2 h, respectively. .. Digested PCR products and vector backbone were resolved via agarose gel electrophoresis and purified using the PureLink quick gel extraction kit (Invitrogen, Carlsbad, CA).

    Article Title: Complement receptor 1 polymorphisms associated with resistance to severe malaria in Kenya
    Article Snippet: .. For RFLP analysis, 28 μL of each PCR product was digested with either Mfe I (New England Biolabs, Beverly, MA), for the detection of Sl1 /Sl2 , or Bsm I (New England Biolabs), for the detection of McC a /McC b , and the restriction fragments were resolved by agarose gel electrophoresis as previously described [ ]. .. Statistical analysis All analyses were done using SPSS version 11.5 (SPSS Inc., Chicago, IL).

    Article Title: Association between LMP2 and LMP7 gene polymorphisms and the risk of gastric cancer: A case-control study
    Article Snippet: .. For PCR amplification, an initial denaturation was performed at 95°C for 2 min, followed by 30 cycles of denaturation at 95°C for 35 sec, annealing at 56.5°C for LMP2-60, or 57.5°C for LMP7-145, for 30 sec and elongation at 72°C for 45 sec, with a final elongation step at 72°C for 10 min. For RFLP, the 330-bp and 351-bp PCR products for the LMP2-60 and LMP7-145 polymorphisms were digested using the 5 units each of the restriction enzymes Hha I and Bsm I (New England Biolabs, Ipswich, MA, USA) for 16 h at 37°C and 65°C, respectively, followed by electrophoresis on a 3% agarose gel. ..

    Article Title: Association of two Common Single Nucleotide Polymorphisms (+45T/G and +276G/T) of ADIPOQ Gene with Coronary Artery Disease in Type 2 Diabetic Patients
    Article Snippet: The resulting 504-bp PCR product for +276G/T was digested with Bsm I (New England Biolabs, Beverly, MA) at 37°C for 12 hours according to the manufacturer’s protocol. .. For genotyping, digested fragments were separated by electrophoresis on 2% agarose gel and visualized by ethidium bromide staining.

    Article Title: Epidemiological and Genetic Characterization of Methicillin-Resistant Staphylococcus aureus Isolates from the Ear Discharge of Outpatients with Chronic Otitis Media
    Article Snippet: PCR products were purified by the QIAquick-spin PCR purification kit (Qiagen Inc., Valencia, CA, U.S.A.) and followed by digestion with Hinf I and Bsm I (New England Biolabs Inc., Ipswich, MA, U.S.A.). .. The RFLP patterns were analyzed using 2% agarose gel electrophoresis.

    Article Title: Inositol 1,3,4,5,6-Pentakisphosphate 2-Kinase from Maize: Molecular and Biochemical Characterization [OA]
    Article Snippet: Approximately 12 μ g genomic DNA was digested overnight with the following restriction enzymes: Eco RI, Bam HI, Ban II, Nco I, Nsi I, and Bsm I (New England Biolabs). .. The digested DNAs and Hin dIII digested λ DNA markers were separated on a 0.8% agarose gel and transferred to a Nylon membrane.

    Produced:

    Article Title: Association between LMP2 and LMP7 gene polymorphisms and the risk of gastric cancer: A case-control study
    Article Snippet: For PCR amplification, an initial denaturation was performed at 95°C for 2 min, followed by 30 cycles of denaturation at 95°C for 35 sec, annealing at 56.5°C for LMP2-60, or 57.5°C for LMP7-145, for 30 sec and elongation at 72°C for 45 sec, with a final elongation step at 72°C for 10 min. For RFLP, the 330-bp and 351-bp PCR products for the LMP2-60 and LMP7-145 polymorphisms were digested using the 5 units each of the restriction enzymes Hha I and Bsm I (New England Biolabs, Ipswich, MA, USA) for 16 h at 37°C and 65°C, respectively, followed by electrophoresis on a 3% agarose gel. .. The Gln/Gln genotype at LMP7-145 yielded 146 and 205-bp bands, the Lys/Lys genotype yielded a 351-bp band and the Gln/Lys genotype produced bands 146, 205 and 351 bp in length on agarose electrophoresis ( ).

    BAC Assay:

    Article Title: In vivo imaging of murid herpesvirus-4 infection
    Article Snippet: The expression cassette plus genomic flanks was subcloned into the Bam HI site of the pST76K-SR shuttle vector and recombined into a MuHV-4 bacterial artificial chromosome (BAC; ). .. This was cut with Bsm I (67 792) and Cla I (69 177) to remove most of ORF50 exon 2 (67 661–69 376), blunted and dephosphorylated with Antarctic alkaline phosphatase (New England Biolabs).

    Article Title: Inositol 1,3,4,5,6-Pentakisphosphate 2-Kinase from Maize: Molecular and Biochemical Characterization [OA]
    Article Snippet: Approximately 12 μ g genomic DNA was digested overnight with the following restriction enzymes: Eco RI, Bam HI, Ban II, Nco I, Nsi I, and Bsm I (New England Biolabs). .. Hybridization was performed at 65°C overnight with a probe consisting of a PCR-amplified 916 bp fragment of ZmIPK1 cDNA (the same probe described for BAC library screening) and Hin dIII digested λ DNA labeled with 32 P-dCTP using the Random Priming DNA labeling system from Invitrogen.

    CTG Assay:

    Article Title: Complement receptor 1 polymorphisms associated with resistance to severe malaria in Kenya
    Article Snippet: Briefly, the oligonucleotide forward primer 24KnNde: 5'-ACC AGT GCC ACA CTG GAC CAG ATG GAG AAC AGC TGT TTG AGC AT-3' and reverse primer 25Rb: 5'-GGA GGA GTG TGG CAG CTT G-3', were used to amplify a 305 bp fragment of CR1 exon 29 by PCR. .. For RFLP analysis, 28 μL of each PCR product was digested with either Mfe I (New England Biolabs, Beverly, MA), for the detection of Sl1 /Sl2 , or Bsm I (New England Biolabs), for the detection of McC a /McC b , and the restriction fragments were resolved by agarose gel electrophoresis as previously described [ ].

    Article Title: Association of two Common Single Nucleotide Polymorphisms (+45T/G and +276G/T) of ADIPOQ Gene with Coronary Artery Disease in Type 2 Diabetic Patients
    Article Snippet: The DNA fragment containing each SNP was amplified using the following primers: +45T/G (rs 2241766): 5'-GCA GCT CCT AGA AGT AGA CTC TG-3' (forward) and 5′-TCT GTG ATG AAA GAG GCC AG-3' (reverse) +276G/T (rs 1501299): 5′-GTC TCT CCA TGG CTG ACA GT-3' (forward) and 5′- GGT GAA GAT GGG AAA GGG GA-3' (reverse) The amplification reaction was performed in a 20-µl volume containing 12.5 µl commercially available PCR premix (AccuPower PCR PremiX; Bioneer, Daejeon, Korea), 2.0 µl (10 pmol/μl) forward and reverse primers, 2.0 µl (50 ng/µl) genomic DNA and 6.5 µl sterile nuclease free water. .. The resulting 504-bp PCR product for +276G/T was digested with Bsm I (New England Biolabs, Beverly, MA) at 37°C for 12 hours according to the manufacturer’s protocol.

    Gel Extraction:

    Article Title: Androgen receptor polyglutamine repeat length affects receptor activity and C2C12 cell development
    Article Snippet: The reaction mix was denatured at 95°C for 5 min, followed by 40 cycles of 95°C denaturation for 30 s, 60°C annealing for 30 s, and 72°C extension for 75 s. The fragments and pCMVhAR vector were sequentially restriction enzyme-digested with Bgl II and Bsm I (New England Biolabs, Ipswich, MA) at 37°C overnight and at 65°C for 2 h, respectively. .. Digested PCR products and vector backbone were resolved via agarose gel electrophoresis and purified using the PureLink quick gel extraction kit (Invitrogen, Carlsbad, CA).

    Variant Assay:

    Article Title: Gain-of-function variant in GLUD2 glutamate dehydrogenase modifies Parkinson's disease onset
    Article Snippet: Paragraph title: Production, expression and purification of the variant and wild-type GDHs ... From this amplified segment, a 350 bp fragment containing the T1492G change was cleaved using Bsm I and Bsr GI restriction endonucleases (New England Biolabs) and inserted into a Bsm I/ BsrG I-digested GLUD2 cDNA cloned in pBSKII+ vector, replacing the corresponding region of the gene.

    Chick Chorioallantoic Membrane Assay:

    Article Title: trans Activity of the Norovirus Camberwell Proteinase and Cleavage of the N-Terminal Protein Encoded by ORF1
    Article Snippet: Paragraph title: Synthesis and purification of CAM proteinase. ... The PCR fragments were digested with Bsm I and Eco RI and inserted into corresponding sites in the multiple cloning site of vector pTYB12 (NEB).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs bsmi
    Pairwise LD Plot for the <t>VDR</t> SNPs. The ID of each SNP was taken as reference. The rs731236, rs7975232, rs1544410, and rs2228570 correspond to TaqI, ApaI, <t>BsmI,</t> and FokI respectively. (a) D′ values. (b) r 2 values. The plot was generated using the Haploview 4 . 2 program.
    Bsmi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 37 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsmi/product/New England Biolabs
    Average 95 stars, based on 37 article reviews
    Price from $9.99 to $1999.99
    bsmi - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results


    Pairwise LD Plot for the VDR SNPs. The ID of each SNP was taken as reference. The rs731236, rs7975232, rs1544410, and rs2228570 correspond to TaqI, ApaI, BsmI, and FokI respectively. (a) D′ values. (b) r 2 values. The plot was generated using the Haploview 4 . 2 program.

    Journal: PLoS ONE

    Article Title: Genetic Case-Control Study for Eight Polymorphisms Associated with Rheumatoid Arthritis

    doi: 10.1371/journal.pone.0131960

    Figure Lengend Snippet: Pairwise LD Plot for the VDR SNPs. The ID of each SNP was taken as reference. The rs731236, rs7975232, rs1544410, and rs2228570 correspond to TaqI, ApaI, BsmI, and FokI respectively. (a) D′ values. (b) r 2 values. The plot was generated using the Haploview 4 . 2 program.

    Article Snippet: VDR (ApaI, BsmI, FokI, and TaqI) genotyping The VDR ApaI (rs7975232), the BsmI (rs1544410), the FokI (rs2228570), and the TaqI (rs731236) SNPs were detected by PCR–RFLP according to the manufacturer’s instructions (New England BioLabs, Ipswich, USA).

    Techniques: Generated

    Southern-blot analysis of ZmIPK1A. Genomic DNA was isolated from inbred line 5XH751 and digested with Eco RI, Bam HI, Ban II, Nco I, Nsi I, and Bsm I. The digested maize genomic DNA and λ phage DNA were separated on 0.8% agarose and transferred to Nylon membrane. The blot was probed with 32 P-dCTP labeled ZmIPK1A and λ phage DNA. Black bars indicate the size and positions of the DNA M r markers.

    Journal: Plant Physiology

    Article Title: Inositol 1,3,4,5,6-Pentakisphosphate 2-Kinase from Maize: Molecular and Biochemical Characterization [OA]

    doi: 10.1104/pp.107.095455

    Figure Lengend Snippet: Southern-blot analysis of ZmIPK1A. Genomic DNA was isolated from inbred line 5XH751 and digested with Eco RI, Bam HI, Ban II, Nco I, Nsi I, and Bsm I. The digested maize genomic DNA and λ phage DNA were separated on 0.8% agarose and transferred to Nylon membrane. The blot was probed with 32 P-dCTP labeled ZmIPK1A and λ phage DNA. Black bars indicate the size and positions of the DNA M r markers.

    Article Snippet: Approximately 12 μ g genomic DNA was digested overnight with the following restriction enzymes: Eco RI, Bam HI, Ban II, Nco I, Nsi I, and Bsm I (New England Biolabs).

    Techniques: Southern Blot, Isolation, Labeling

    Five-year disease free survival (DFS) of breast cancer patients in relation to VDR gene polymorphisms. Kaplan-Meier survival curves were used to compare the 5-year DFS between the VDR gene polymorphisms in (a) VDR-FokI, (b) VDR-BsmI, (c) VDR-ApaI, and (d) VDR-TaqI. The differences between the curves were estimated by log-rank test, where P

    Journal: PLoS ONE

    Article Title: Vitamin D Receptor Gene Polymorphisms and Prognosis of Breast Cancer among African-American and Hispanic Women

    doi: 10.1371/journal.pone.0057967

    Figure Lengend Snippet: Five-year disease free survival (DFS) of breast cancer patients in relation to VDR gene polymorphisms. Kaplan-Meier survival curves were used to compare the 5-year DFS between the VDR gene polymorphisms in (a) VDR-FokI, (b) VDR-BsmI, (c) VDR-ApaI, and (d) VDR-TaqI. The differences between the curves were estimated by log-rank test, where P

    Article Snippet: Following PCR, aliquots of the amplified PCR products was digested with BsmI, ApaI, TaqI and FokI in accordance with the manufacturer's specifications (New England Biolabs, Beverly, MA, USA).

    Techniques:

    Optimization of reaction conditions for PG–RCA. Threshold time in the presence (open circle) or absence (cross) of 500 zmol sample DNA was compared at various concentrations of each reaction component ( n =2). ( A ) At constant concentrations of Vent (exo-) DNA polymerase (0.4 U), Nb.BsmI (1 U) and circular probe II (7.5 nM), dNTP concentrations were compared among 400 (original), 40, 4 and 0.4 µM. ( B ) At constant concentrations of dNTP (400 µM), Nb.BsmI (1 U) and circular probe II (7.5 nM), Vent (exo-) polymerase concentrations were compared among 0.4 (original), 0.08, 0.04 and 0.02 U. ( C ) At constant concentrations of dNTP (400 µM), Vent (exo-) DNA polymerase (0.4 U) and circular probe II (7.5 nM), Nb.BsmI concentrations were compared among 1 (original), 0.5, 0.25 and 0.125 U. ( D ) At constant concentrations of dNTP (0.4 µM, 1000-fold dilution of the original concentration), Nb.BsmI (1 U) and circular probe II (7.5 nM), Vent (exo-) polymerase concentrations were compared among 0.4, 0.2, 0.1 and 0.05 U.

    Journal: Nucleic Acids Research

    Article Title: Sensitive isothermal detection of nucleic-acid sequence by primer generation-rolling circle amplification

    doi: 10.1093/nar/gkn1014

    Figure Lengend Snippet: Optimization of reaction conditions for PG–RCA. Threshold time in the presence (open circle) or absence (cross) of 500 zmol sample DNA was compared at various concentrations of each reaction component ( n =2). ( A ) At constant concentrations of Vent (exo-) DNA polymerase (0.4 U), Nb.BsmI (1 U) and circular probe II (7.5 nM), dNTP concentrations were compared among 400 (original), 40, 4 and 0.4 µM. ( B ) At constant concentrations of dNTP (400 µM), Nb.BsmI (1 U) and circular probe II (7.5 nM), Vent (exo-) polymerase concentrations were compared among 0.4 (original), 0.08, 0.04 and 0.02 U. ( C ) At constant concentrations of dNTP (400 µM), Vent (exo-) DNA polymerase (0.4 U) and circular probe II (7.5 nM), Nb.BsmI concentrations were compared among 1 (original), 0.5, 0.25 and 0.125 U. ( D ) At constant concentrations of dNTP (0.4 µM, 1000-fold dilution of the original concentration), Nb.BsmI (1 U) and circular probe II (7.5 nM), Vent (exo-) polymerase concentrations were compared among 0.4, 0.2, 0.1 and 0.05 U.

    Article Snippet: Vent (exo-) DNA polymerase, Nb.BsmI, BsmI, BbvCI and exonuclease III were purchased from New England Biolabs.

    Techniques: Concentration Assay

    PG–RCA under optimized reaction condition. ( A ) Fluorescent intensity of PG–RCA reaction at the optimized reaction condition (0.4 µM dNTP, 0.05 U Vent (exo-) DNA polymerase, 1 U Nb.BsmI and 7.5 nM circular probe II) was monitored in real time. Sample DNA concentration in each reaction was prepared by 10-fold serial dilution from 5 fmol to 0.5 ymol and their signal amplification curves were indicated by colored lines (dark blue, blue, light blue, purple, dark green, green, brown, orange, yellow, red and gray, respectively) ( n =2). Negative controls are indicated by black lines ( n =2). ( B ) Threshold time ( T T ) was plotted against the sample DNA concentration (S) of the reaction. Solid line indicates linear least squares fitting between 5 fmol and 0.5 zmol sample DNA and its formulation is T T =−19.2 log 10 (S)+75.6 ( R 2 =0.998). Perforated line indicates average T T value of the negative controls. Limit of detection is 84.5 ymol or 50.7 molecules of sample DNA by calculation from the intersection of both lines.

    Journal: Nucleic Acids Research

    Article Title: Sensitive isothermal detection of nucleic-acid sequence by primer generation-rolling circle amplification

    doi: 10.1093/nar/gkn1014

    Figure Lengend Snippet: PG–RCA under optimized reaction condition. ( A ) Fluorescent intensity of PG–RCA reaction at the optimized reaction condition (0.4 µM dNTP, 0.05 U Vent (exo-) DNA polymerase, 1 U Nb.BsmI and 7.5 nM circular probe II) was monitored in real time. Sample DNA concentration in each reaction was prepared by 10-fold serial dilution from 5 fmol to 0.5 ymol and their signal amplification curves were indicated by colored lines (dark blue, blue, light blue, purple, dark green, green, brown, orange, yellow, red and gray, respectively) ( n =2). Negative controls are indicated by black lines ( n =2). ( B ) Threshold time ( T T ) was plotted against the sample DNA concentration (S) of the reaction. Solid line indicates linear least squares fitting between 5 fmol and 0.5 zmol sample DNA and its formulation is T T =−19.2 log 10 (S)+75.6 ( R 2 =0.998). Perforated line indicates average T T value of the negative controls. Limit of detection is 84.5 ymol or 50.7 molecules of sample DNA by calculation from the intersection of both lines.

    Article Snippet: Vent (exo-) DNA polymerase, Nb.BsmI, BsmI, BbvCI and exonuclease III were purchased from New England Biolabs.

    Techniques: Concentration Assay, Serial Dilution, Amplification

    Real-time product analysis of PG–RCA. ( A ) Fluorescent intensity of PG–RCA reaction was monitored in real time. PG–RCA was conducted at 60°C with 400 µM each dNTP, 0.4 U Vent (exo-) DNA polymerase, 1 U Nb.BsmI and 7.5 nM circular probe II as described in Materials and methods section. Sample DNA concentration in each reaction was prepared by 10-fold serial dilution from 500 amol to 0.5 zmol, and their signal amplification curves were indicated by colored lines (blue, light blue, purple, dark green, green, brown and orange, respectively) ( n =3). Negative controls are indicated by black lines ( n =3). ( B ) Threshold time T T (the reaction time when fluorescent intensity of each reaction exceeds a threshold, indicated by a perforated line in Figure 3A) was plotted against the sample DNA concentration (S) of the reaction. Solid line indicates linear least squares fitting between 500 and 0.5 amol sample DNA and its formulation is T T =−8.65 log 10 (S)+28.5 (R 2 =0.997). Perforated line indicates average T T value of the negative controls. Limit of detection is 58.4 zmol or 3.50 × 10 4 molecules of sample DNA by calculation from the intersection of both lines.

    Journal: Nucleic Acids Research

    Article Title: Sensitive isothermal detection of nucleic-acid sequence by primer generation-rolling circle amplification

    doi: 10.1093/nar/gkn1014

    Figure Lengend Snippet: Real-time product analysis of PG–RCA. ( A ) Fluorescent intensity of PG–RCA reaction was monitored in real time. PG–RCA was conducted at 60°C with 400 µM each dNTP, 0.4 U Vent (exo-) DNA polymerase, 1 U Nb.BsmI and 7.5 nM circular probe II as described in Materials and methods section. Sample DNA concentration in each reaction was prepared by 10-fold serial dilution from 500 amol to 0.5 zmol, and their signal amplification curves were indicated by colored lines (blue, light blue, purple, dark green, green, brown and orange, respectively) ( n =3). Negative controls are indicated by black lines ( n =3). ( B ) Threshold time T T (the reaction time when fluorescent intensity of each reaction exceeds a threshold, indicated by a perforated line in Figure 3A) was plotted against the sample DNA concentration (S) of the reaction. Solid line indicates linear least squares fitting between 500 and 0.5 amol sample DNA and its formulation is T T =−8.65 log 10 (S)+28.5 (R 2 =0.997). Perforated line indicates average T T value of the negative controls. Limit of detection is 58.4 zmol or 3.50 × 10 4 molecules of sample DNA by calculation from the intersection of both lines.

    Article Snippet: Vent (exo-) DNA polymerase, Nb.BsmI, BsmI, BbvCI and exonuclease III were purchased from New England Biolabs.

    Techniques: Concentration Assay, Serial Dilution, Amplification

    Endpoint product analysis of PG–RCA. ( A ) Endpoint products in the presence or absence of 500 amol sample DNA were analyzed on 1.0% agarose gel electrophoresis. The reaction was conducted at 60°C for 30, 45, 60, 75, 90, 105 and 120 min and each reaction was analyzed separately. Lane M was loaded with a 100 bp DNA marker (100, 200, 300, 400, 500/517, 600, 700, 800, 900, 1000, 1200 and 1517 bp from the bottom). ( B ) Endpoint products of 90-min reactions with all or partial reaction components were analyzed on 1.0% agarose gel electrophoresis. DNA, POL and NICK indicate sample DNA, Vent (exo-) DNA polymerase and Nb.BsmI, respectively. Lane M is a 100 bp DNA marker. ( C ) Endpoint product of a 120-min PG–RCA reaction was digested with either BsmI or BbvCI and analyzed on 1.5% agarose gel electrophoresis. Lane ‘-’ was loaded with the 120 min reaction product before restriction enzyme digestion. Lane M is a 100 bp DNA marker.

    Journal: Nucleic Acids Research

    Article Title: Sensitive isothermal detection of nucleic-acid sequence by primer generation-rolling circle amplification

    doi: 10.1093/nar/gkn1014

    Figure Lengend Snippet: Endpoint product analysis of PG–RCA. ( A ) Endpoint products in the presence or absence of 500 amol sample DNA were analyzed on 1.0% agarose gel electrophoresis. The reaction was conducted at 60°C for 30, 45, 60, 75, 90, 105 and 120 min and each reaction was analyzed separately. Lane M was loaded with a 100 bp DNA marker (100, 200, 300, 400, 500/517, 600, 700, 800, 900, 1000, 1200 and 1517 bp from the bottom). ( B ) Endpoint products of 90-min reactions with all or partial reaction components were analyzed on 1.0% agarose gel electrophoresis. DNA, POL and NICK indicate sample DNA, Vent (exo-) DNA polymerase and Nb.BsmI, respectively. Lane M is a 100 bp DNA marker. ( C ) Endpoint product of a 120-min PG–RCA reaction was digested with either BsmI or BbvCI and analyzed on 1.5% agarose gel electrophoresis. Lane ‘-’ was loaded with the 120 min reaction product before restriction enzyme digestion. Lane M is a 100 bp DNA marker.

    Article Snippet: Vent (exo-) DNA polymerase, Nb.BsmI, BsmI, BbvCI and exonuclease III were purchased from New England Biolabs.

    Techniques: Agarose Gel Electrophoresis, Marker

    Real-time quantification of hly gene in L. monocytogenes genomic DNA by PG–RCA. ( A ) Circular probe LM for detection of pathogenic L. monocytogenes genomic DNA. The probe targets the complementary strand of virulence gene, hly (GeneBank GeneID 2797098), encoding a cholesterol-dependent cytolysin, listeriolysin O (LLO). Circular probe LM contains three repeats of a 26-base sequence complementary to the gene including a nicking site for Nb.BsmI. Since these repeat sequences have 5-base overlaps each other, the circular probe comprises three repeats of a 21-base sequence (red, blue and green). ( B ) Genomic DNA from L. monocytogenes (0.1–100 pg) was analyzed by real-time PG–RCA with circular probe LM. Threshold time ( T T ) was plotted against the L. monocytogenes genomic DNA concentration (S) of the reaction. Solid line indicates linear least squares fitting between 0.1 and 100 pg L. monocytogenes genomic DNA and its formulation is T T = −19.1 log 10 (S) + 233 ( R 2 =0.964). Perforated line indicates average T T value of the negative controls ( n =2). Limit of detection is 0.163 pg (∼60 molecules) of L. monocytogenes genomic DNA by calculation from the intersection of both lines. ( C ) Genomic DNA (100 pg) from L. monocytogenes , L. innocua , E. coli and S. enterica were analyzed by real-time PG–RCA with circular probe LM and their threshold times were compared with the values for L. monocytogenes (100 pg). ‘No DNA’ indicates the negative controls.

    Journal: Nucleic Acids Research

    Article Title: Sensitive isothermal detection of nucleic-acid sequence by primer generation-rolling circle amplification

    doi: 10.1093/nar/gkn1014

    Figure Lengend Snippet: Real-time quantification of hly gene in L. monocytogenes genomic DNA by PG–RCA. ( A ) Circular probe LM for detection of pathogenic L. monocytogenes genomic DNA. The probe targets the complementary strand of virulence gene, hly (GeneBank GeneID 2797098), encoding a cholesterol-dependent cytolysin, listeriolysin O (LLO). Circular probe LM contains three repeats of a 26-base sequence complementary to the gene including a nicking site for Nb.BsmI. Since these repeat sequences have 5-base overlaps each other, the circular probe comprises three repeats of a 21-base sequence (red, blue and green). ( B ) Genomic DNA from L. monocytogenes (0.1–100 pg) was analyzed by real-time PG–RCA with circular probe LM. Threshold time ( T T ) was plotted against the L. monocytogenes genomic DNA concentration (S) of the reaction. Solid line indicates linear least squares fitting between 0.1 and 100 pg L. monocytogenes genomic DNA and its formulation is T T = −19.1 log 10 (S) + 233 ( R 2 =0.964). Perforated line indicates average T T value of the negative controls ( n =2). Limit of detection is 0.163 pg (∼60 molecules) of L. monocytogenes genomic DNA by calculation from the intersection of both lines. ( C ) Genomic DNA (100 pg) from L. monocytogenes , L. innocua , E. coli and S. enterica were analyzed by real-time PG–RCA with circular probe LM and their threshold times were compared with the values for L. monocytogenes (100 pg). ‘No DNA’ indicates the negative controls.

    Article Snippet: Vent (exo-) DNA polymerase, Nb.BsmI, BsmI, BbvCI and exonuclease III were purchased from New England Biolabs.

    Techniques: Sequencing, Concentration Assay