cmv gw ires puro fragment  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Name:
    Bsu36I
    Description:
    Bsu36I 5 000 units
    Catalog Number:
    r0524l
    Price:
    269
    Size:
    5 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs cmv gw ires puro fragment
    Bsu36I
    Bsu36I 5 000 units
    https://www.bioz.com/result/cmv gw ires puro fragment/product/New England Biolabs
    Average 93 stars, based on 428 article reviews
    Price from $9.99 to $1999.99
    cmv gw ires puro fragment - by Bioz Stars, 2020-04
    93/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Novel Isoforms of the Sodium Channels Nav1.8 and Nav1.5 Are Produced by a Conserved Mechanism in Mouse and Rat *
    Article Snippet: .. Consistent with the novel cDNA sequence, there was no apparent digestion by Bsu36I either of the 435-bp seminested PCR products prior to cloning, or of 8 individual cDNA clones from each of the three DRG tissues (data not shown). ..

    Article Title: Cloning and characterization of tRNA (m1A58) methyltransferase (TrmI) from Thermus thermophilus HB27, a protein required for cell growth at extreme temperatures
    Article Snippet: A 2.9 kb T.thermophilus genomic fragment bearing the trmI gene was amplified from T.thermophilus HB27 genomic DNA using the GC-rich PCR kit (Roche Diagnostics) and the oligonucleotides PGCD-1 and PGCD-2 with Eco RI restriction sites to facilitate the cloning into the cognate site of pUC18. .. Plasmid pTT1 was digested with Bsu 36I (New England Biolabs, Beverly, MA).

    Article Title: Epigenetic CRBP downregulation appears to be an evolutionarily conserved (human and mouse) and oncogene-specific phenomenon in breast cancer
    Article Snippet: Tumor DNA (45 μg) was digested with Bsu36I, ethanol precipitated, and divided into 3 parts that were either not digested further, digested with HpaII, or digested with MsPI (restriction enzymes were from New England Biolabs, Beverly, MA). .. After ethanol precipitation, Southern blots were prepared and hybridized to a 205 bp hCRBP probe amplified from a cloned hCRBP genomic fragment using CCGGTCTCCTCTTCCTTTGTAGGGG (sense) and GGGACAGGGGGCTCTGCGGGG (antisense) primers.

    Article Title: Proviruses Selected for High and Stable Expression of Transduced Genes Accumulate in Broadly Transcribed Genome Areas ▿Proviruses Selected for High and Stable Expression of Transduced Genes Accumulate in Broadly Transcribed Genome Areas ▿ †
    Article Snippet: Paragraph title: Cloning and sequencing of integration sites. ... The product of self-ligation was subsequently cleaved overnight at 37°C with 10 U of PvuI and 10 U of Bsu36I (both enzymes from New England Biolabs, Ipswitch, MA) in 50 μl reaction mixture to eliminate the background from internal proviral PstI fragments and to increase the efficiency of I-PCR by linearization of the circles within the LTR, respectively.

    Article Title: Novel Isoforms of the Sodium Channels Nav1.8 and Nav1.5 Are Produced by a Conserved Mechanism in Mouse and Rat *
    Article Snippet: The single apparent product was cut out from a 2% agarose gel, purified (Gel Extraction kit, Qiagen), and used in a 25-cycle nested PCR with primer pair SNSfor2/SNSrev2, prior to cloning products into pCRII-TOPO using a TOPO TA cloning kit and transformation into One Shot TOP10F′ competent cells (Invitrogen). .. The purified product was used in a 25-cycle seminested PCR with primer pair SNSfor4/SNSrev3, prior to either purified PCR products (PCR purification kit, Qiagen) or DNA minipreps (Qiagen) of TA-cloned products being incubated with Bsu36I (New England Biolabs), which does not cut the vector pCRII-TOPO.

    Amplification:

    Article Title: Cloning and characterization of tRNA (m1A58) methyltransferase (TrmI) from Thermus thermophilus HB27, a protein required for cell growth at extreme temperatures
    Article Snippet: A 2.9 kb T.thermophilus genomic fragment bearing the trmI gene was amplified from T.thermophilus HB27 genomic DNA using the GC-rich PCR kit (Roche Diagnostics) and the oligonucleotides PGCD-1 and PGCD-2 with Eco RI restriction sites to facilitate the cloning into the cognate site of pUC18. .. Plasmid pTT1 was digested with Bsu 36I (New England Biolabs, Beverly, MA).

    Article Title: Frequent polymorphisms of FSH receptor do not influence antral follicle responsiveness to follicle-stimulating hormone administration as assessed by the Follicular Output RaTe (FORT)
    Article Snippet: .. The amplified fragment of 364 bp was digested with Bsu36I (New England Biolabs, USA) restriction enzyme. .. A mismatch nucleotide was introduced in the second PCR.

    Article Title: Epigenetic CRBP downregulation appears to be an evolutionarily conserved (human and mouse) and oncogene-specific phenomenon in breast cancer
    Article Snippet: Tumor DNA (45 μg) was digested with Bsu36I, ethanol precipitated, and divided into 3 parts that were either not digested further, digested with HpaII, or digested with MsPI (restriction enzymes were from New England Biolabs, Beverly, MA). .. After ethanol precipitation, Southern blots were prepared and hybridized to a 205 bp hCRBP probe amplified from a cloned hCRBP genomic fragment using CCGGTCTCCTCTTCCTTTGTAGGGG (sense) and GGGACAGGGGGCTCTGCGGGG (antisense) primers.

    Article Title: Investigation of the association between interleukin-1? polymorphism and normal tension glaucoma
    Article Snippet: A 304 bp PCR fragment of the IL-1β (-511) in the promoter region was amplified using the following primers: F5'-TGG CAT TGA TCT GGT TCA TC-3' and R5'-GTT TAG GAA TCT TCC CAC TT-3'. .. The products were digested with Bsu 36I (New England Biolabs, Inc., Beverly, MA) at 37 °C for 3 h and were run on ethidium bromide-stained 2% agarose gel.

    Article Title: Proviruses Selected for High and Stable Expression of Transduced Genes Accumulate in Broadly Transcribed Genome Areas ▿Proviruses Selected for High and Stable Expression of Transduced Genes Accumulate in Broadly Transcribed Genome Areas ▿ †
    Article Snippet: Amplification and cloning of sequences flanking the 5′ long terminal repeat (LTR) of pH19KE proviruses were done as described by Reinišová et al. ( ) with slight modifications (Fig. ). .. The product of self-ligation was subsequently cleaved overnight at 37°C with 10 U of PvuI and 10 U of Bsu36I (both enzymes from New England Biolabs, Ipswitch, MA) in 50 μl reaction mixture to eliminate the background from internal proviral PstI fragments and to increase the efficiency of I-PCR by linearization of the circles within the LTR, respectively.

    Synthesized:

    Article Title: JC virus granule cell neuronopathy is associated with VP1 C terminus mutants
    Article Snippet: JCVHWM sequence) was also synthesized by BlueHeron (nt 2097–3107, JCVHWM sequence, 1099 bp) and named PGVP1-T . .. The plasmid containing the PGVP1-T fragment was purified and digested by Pac I (2369 of JCVHWM ) ( ; ) and Bsu 36I (3056 of JCVHWM ) (New England Biolabs).

    TA Cloning:

    Article Title: Novel Isoforms of the Sodium Channels Nav1.8 and Nav1.5 Are Produced by a Conserved Mechanism in Mouse and Rat *
    Article Snippet: The single apparent product was cut out from a 2% agarose gel, purified (Gel Extraction kit, Qiagen), and used in a 25-cycle nested PCR with primer pair SNSfor2/SNSrev2, prior to cloning products into pCRII-TOPO using a TOPO TA cloning kit and transformation into One Shot TOP10F′ competent cells (Invitrogen). .. The purified product was used in a 25-cycle seminested PCR with primer pair SNSfor4/SNSrev3, prior to either purified PCR products (PCR purification kit, Qiagen) or DNA minipreps (Qiagen) of TA-cloned products being incubated with Bsu36I (New England Biolabs), which does not cut the vector pCRII-TOPO.

    Construct:

    Article Title: Cloning and characterization of tRNA (m1A58) methyltransferase (TrmI) from Thermus thermophilus HB27, a protein required for cell growth at extreme temperatures
    Article Snippet: In the resulting construct, pML11b, the knt (Kmr ) gene is transcribed from the 16S rRNA promoter. .. Plasmid pTT1 was digested with Bsu 36I (New England Biolabs, Beverly, MA).

    Incubation:

    Article Title: New Lung Cancer Panel for High-Throughput Targeted Resequencing
    Article Snippet: Target enrichment Eight different restriction reactions were used to digest genomic DNAs from each sample, including Sfc I and Hpy188I in NEB buffer 4; Dde I and Alu I in NEB buffer 2; Mse I and Bsu 36I in NEB buffer 3; Msl I and Bfa I in NEB buffer 4; Hpy CH4III and Bsp 1286 in NEB buffer 4; Sfc I and Nla III in NEB buffer 4; Mse I and Hpy CH4III in NEB buffer 4; and Hpy CH4V and Eco O109I in NEB buffer 4 (New England Biolabs, Ipswich, MA, USA). .. The reactions were incubated at 37℃ for 60 min, followed by enzyme inactivation at 80℃ for 20 min. A total of 80 µL of pooled digested sample was mixed with 10 pM biotinylated selector probes, 1 M NaCl, 10 mM Tris-HCl (pH 7.5), 5 mM EDTA, and 0.1% Tween-20 in a total volume of 160 µL.

    Article Title: Novel Isoforms of the Sodium Channels Nav1.8 and Nav1.5 Are Produced by a Conserved Mechanism in Mouse and Rat *
    Article Snippet: .. The purified product was used in a 25-cycle seminested PCR with primer pair SNSfor4/SNSrev3, prior to either purified PCR products (PCR purification kit, Qiagen) or DNA minipreps (Qiagen) of TA-cloned products being incubated with Bsu36I (New England Biolabs), which does not cut the vector pCRII-TOPO. .. Nav 1.8 cDNA inserts were also cloned from trigeminal ganglia, as above, using the primer pair SNSfor3/SNSrev3.

    Transformation Assay:

    Article Title: Cloning and characterization of tRNA (m1A58) methyltransferase (TrmI) from Thermus thermophilus HB27, a protein required for cell growth at extreme temperatures
    Article Snippet: Plasmid pTT1 was digested with Bsu 36I (New England Biolabs, Beverly, MA). .. Transformation of the T.thermophilus HB27 strain was performed as described by Koyama et al . ( ).

    Article Title: Novel Isoforms of the Sodium Channels Nav1.8 and Nav1.5 Are Produced by a Conserved Mechanism in Mouse and Rat *
    Article Snippet: The single apparent product was cut out from a 2% agarose gel, purified (Gel Extraction kit, Qiagen), and used in a 25-cycle nested PCR with primer pair SNSfor2/SNSrev2, prior to cloning products into pCRII-TOPO using a TOPO TA cloning kit and transformation into One Shot TOP10F′ competent cells (Invitrogen). .. The purified product was used in a 25-cycle seminested PCR with primer pair SNSfor4/SNSrev3, prior to either purified PCR products (PCR purification kit, Qiagen) or DNA minipreps (Qiagen) of TA-cloned products being incubated with Bsu36I (New England Biolabs), which does not cut the vector pCRII-TOPO.

    Derivative Assay:

    Article Title: The capacity to form H-DNA cannot substitute for GAGA factor binding to a (CT)n?(GA)n regulatory site
    Article Snippet: After phenol extraction and ethanol precipitation, the samples were resuspended in 1× Bsu 36I buffer and were digested to completion with Bsu 36I (NEB). .. The samples were separated electrophoretically using a 0.8% agarose gel, transferred with 10× SSC to Magna nylon membrane (MSI) and hybridized to a [32 P]dCTP-labeled 0.5 kb Bsu 36I– Eco R1 fragment derived from pCon-2 (see Fig. ) for indirect end-labeling ( ).

    Inverse PCR:

    Article Title: Proviruses Selected for High and Stable Expression of Transduced Genes Accumulate in Broadly Transcribed Genome Areas ▿Proviruses Selected for High and Stable Expression of Transduced Genes Accumulate in Broadly Transcribed Genome Areas ▿ †
    Article Snippet: The inverse-PCR (I-PCR) strategy is schematically shown in Fig. . .. The product of self-ligation was subsequently cleaved overnight at 37°C with 10 U of PvuI and 10 U of Bsu36I (both enzymes from New England Biolabs, Ipswitch, MA) in 50 μl reaction mixture to eliminate the background from internal proviral PstI fragments and to increase the efficiency of I-PCR by linearization of the circles within the LTR, respectively.

    Southern Blot:

    Article Title: Epigenetic CRBP downregulation appears to be an evolutionarily conserved (human and mouse) and oncogene-specific phenomenon in breast cancer
    Article Snippet: Paragraph title: Southern blot analysis ... Tumor DNA (45 μg) was digested with Bsu36I, ethanol precipitated, and divided into 3 parts that were either not digested further, digested with HpaII, or digested with MsPI (restriction enzymes were from New England Biolabs, Beverly, MA).

    Ligation:

    Article Title: Cloning and characterization of tRNA (m1A58) methyltransferase (TrmI) from Thermus thermophilus HB27, a protein required for cell growth at extreme temperatures
    Article Snippet: Plasmid pTT1 was digested with Bsu 36I (New England Biolabs, Beverly, MA). .. The 509 bp Bsu 36I fragment, in the coding region of trmI , was replaced by the 838 bp Bsu 36I fragment of pML11b to create the ligation product pML51 used for homologous recombination.

    Footprinting:

    Article Title: The capacity to form H-DNA cannot substitute for GAGA factor binding to a (CT)n?(GA)n regulatory site
    Article Snippet: Paragraph title: In vitro DNase I footprinting and S1 analysis ... After phenol extraction and ethanol precipitation, the samples were resuspended in 1× Bsu 36I buffer and were digested to completion with Bsu 36I (NEB).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Novel Isoforms of the Sodium Channels Nav1.8 and Nav1.5 Are Produced by a Conserved Mechanism in Mouse and Rat *
    Article Snippet: Paragraph title: RT-PCR of Mouse Nav 1.8 cDNA ... The purified product was used in a 25-cycle seminested PCR with primer pair SNSfor4/SNSrev3, prior to either purified PCR products (PCR purification kit, Qiagen) or DNA minipreps (Qiagen) of TA-cloned products being incubated with Bsu36I (New England Biolabs), which does not cut the vector pCRII-TOPO.

    other:

    Article Title: The capacity to form H-DNA cannot substitute for GAGA factor binding to a (CT)n?(GA)n regulatory site
    Article Snippet: Linear controls were prepared by digestion with Bsu 36I and were subsequently treated with S1.

    Sequencing:

    Article Title: Novel Isoforms of the Sodium Channels Nav1.8 and Nav1.5 Are Produced by a Conserved Mechanism in Mouse and Rat *
    Article Snippet: .. Consistent with the novel cDNA sequence, there was no apparent digestion by Bsu36I either of the 435-bp seminested PCR products prior to cloning, or of 8 individual cDNA clones from each of the three DRG tissues (data not shown). ..

    Article Title: JC virus granule cell neuronopathy is associated with VP1 C terminus mutants
    Article Snippet: Primer pair: JV2For (5′-AAGATATTTTGGGACACTAACAGGAGGAGA-3′, 2097–2126 of JCVHWM ) and JV2Rev (5′-TTCAGGGCATGGCATAAGCAACC-3′, 3187–3165 RC sequence of JCVHWM , designed by ‘Primer Express/version 2.0’) were used to amplify partial JCVGCN1 sequence containing the C terminus of both VP1 and T gene from PGVP1-T . .. The plasmid containing the PGVP1-T fragment was purified and digested by Pac I (2369 of JCVHWM ) ( ; ) and Bsu 36I (3056 of JCVHWM ) (New England Biolabs).

    Article Title: Proviruses Selected for High and Stable Expression of Transduced Genes Accumulate in Broadly Transcribed Genome Areas ▿Proviruses Selected for High and Stable Expression of Transduced Genes Accumulate in Broadly Transcribed Genome Areas ▿ †
    Article Snippet: Paragraph title: Cloning and sequencing of integration sites. ... The product of self-ligation was subsequently cleaved overnight at 37°C with 10 U of PvuI and 10 U of Bsu36I (both enzymes from New England Biolabs, Ipswitch, MA) in 50 μl reaction mixture to eliminate the background from internal proviral PstI fragments and to increase the efficiency of I-PCR by linearization of the circles within the LTR, respectively.

    Article Title: Novel Isoforms of the Sodium Channels Nav1.8 and Nav1.5 Are Produced by a Conserved Mechanism in Mouse and Rat *
    Article Snippet: The purified product was used in a 25-cycle seminested PCR with primer pair SNSfor4/SNSrev3, prior to either purified PCR products (PCR purification kit, Qiagen) or DNA minipreps (Qiagen) of TA-cloned products being incubated with Bsu36I (New England Biolabs), which does not cut the vector pCRII-TOPO. .. Note that the resultant product identified the T2905C substitution within the SNSfor4 primer sequence (underlined above).

    Binding Assay:

    Article Title: The capacity to form H-DNA cannot substitute for GAGA factor binding to a (CT)n?(GA)n regulatory site
    Article Snippet: GAGA factor binding, DNase I digestion and analysis were performed as previously described ( ). .. After phenol extraction and ethanol precipitation, the samples were resuspended in 1× Bsu 36I buffer and were digested to completion with Bsu 36I (NEB).

    DNA Extraction:

    Article Title: Frequent polymorphisms of FSH receptor do not influence antral follicle responsiveness to follicle-stimulating hormone administration as assessed by the Follicular Output RaTe (FORT)
    Article Snippet: Paragraph title: DNA isolation and detection of the polymorphisms Thr307Ala and Asn680Ser ... The amplified fragment of 364 bp was digested with Bsu36I (New England Biolabs, USA) restriction enzyme.

    Magnetic Beads:

    Article Title: New Lung Cancer Panel for High-Throughput Targeted Resequencing
    Article Snippet: Target enrichment Eight different restriction reactions were used to digest genomic DNAs from each sample, including Sfc I and Hpy188I in NEB buffer 4; Dde I and Alu I in NEB buffer 2; Mse I and Bsu 36I in NEB buffer 3; Msl I and Bfa I in NEB buffer 4; Hpy CH4III and Bsp 1286 in NEB buffer 4; Sfc I and Nla III in NEB buffer 4; Mse I and Hpy CH4III in NEB buffer 4; and Hpy CH4V and Eco O109I in NEB buffer 4 (New England Biolabs, Ipswich, MA, USA). .. The mixture was incubated and hybridized at 95℃ for 10 min, 75℃ for 30 min, 68℃ for 30 min, 55℃ for 30 min, and 46℃ for 10 h. The hybridized solution was mixed with 10 µL M-280 streptavidin-coated magnetic beads (3.35 × 107 beads/mL; Invitrogen, Carlsbad, CA, USA) in 1 M NaCl, 10 mM Tris-HCl (pH 7.5), 1 mM EDTA, and 0.1% Tween-20 in a final volume of 200 µL and incubated at room temperature for 10 min. After incubation, the beads were collected using a ring magnet and washed in 1 M NaCl, 10 mM Tris-HCl (pH 7.5), 5 mM EDTA, and 0.1% Tween-20 in a total volume of 200 µL at 46℃ for 30 min with rotation.

    Isolation:

    Article Title: The capacity to form H-DNA cannot substitute for GAGA factor binding to a (CT)n?(GA)n regulatory site
    Article Snippet: The DNA was then digested with Eco RI and the appropriate digestion product isolated from a native 8% polyacrylamide gel. .. After phenol extraction and ethanol precipitation, the samples were resuspended in 1× Bsu 36I buffer and were digested to completion with Bsu 36I (NEB).

    Article Title: Epigenetic CRBP downregulation appears to be an evolutionarily conserved (human and mouse) and oncogene-specific phenomenon in breast cancer
    Article Snippet: Approximately 200 mg of tissue were pulverized under liquid nitrogen and RNA and DNA isolated using Qiagen's RNA/DNA kit according to manufacturer's instructions (Qiagen, Valencia, CA). .. Tumor DNA (45 μg) was digested with Bsu36I, ethanol precipitated, and divided into 3 parts that were either not digested further, digested with HpaII, or digested with MsPI (restriction enzymes were from New England Biolabs, Beverly, MA).

    Article Title: Investigation of the association between interleukin-1? polymorphism and normal tension glaucoma
    Article Snippet: DNA preparation and genotype identification Blood samples were collected from each subject (5 ml) and genomic DNA was isolated using the Qiagen QiaAmp Blood mini kit (Qiagen, Valencia, CA). .. The products were digested with Bsu 36I (New England Biolabs, Inc., Beverly, MA) at 37 °C for 3 h and were run on ethidium bromide-stained 2% agarose gel.

    Labeling:

    Article Title: Frequent polymorphisms of FSH receptor do not influence antral follicle responsiveness to follicle-stimulating hormone administration as assessed by the Follicular Output RaTe (FORT)
    Article Snippet: The amplified fragment of 364 bp was digested with Bsu36I (New England Biolabs, USA) restriction enzyme. .. According to them, genotype of FSHR of our patients was labeled as follows: 307Thr/Thr (307TT; n = 29), 307Thr/Ala (307TA; n = 48), and 307Ala/Ala (307AA; n = 32)—results from 15 patients regarding the 307 locus remained inconclusive despite PCR was repeated several times For the RFLP analysis of the Asn680Ser SNP the methodology was as follows.

    Purification:

    Article Title: JC virus granule cell neuronopathy is associated with VP1 C terminus mutants
    Article Snippet: .. The plasmid containing the PGVP1-T fragment was purified and digested by Pac I (2369 of JCVHWM ) ( ; ) and Bsu 36I (3056 of JCVHWM ) (New England Biolabs). .. The 696 bp PGVP1-T fragment containing 10 bp VP1 deletion and intact C terminus of the T gene was recovered from agarose gel (QIAquick Gel Extraction kit; Qiagen) and then used to replace the counterpart of JCVGCN1-RR to obtain the full-length genome of JCVGCN1 .

    Article Title: Novel Isoforms of the Sodium Channels Nav1.8 and Nav1.5 Are Produced by a Conserved Mechanism in Mouse and Rat *
    Article Snippet: .. The purified product was used in a 25-cycle seminested PCR with primer pair SNSfor4/SNSrev3, prior to either purified PCR products (PCR purification kit, Qiagen) or DNA minipreps (Qiagen) of TA-cloned products being incubated with Bsu36I (New England Biolabs), which does not cut the vector pCRII-TOPO. .. Nav 1.8 cDNA inserts were also cloned from trigeminal ganglia, as above, using the primer pair SNSfor3/SNSrev3.

    Polymerase Chain Reaction:

    Article Title: Novel Isoforms of the Sodium Channels Nav1.8 and Nav1.5 Are Produced by a Conserved Mechanism in Mouse and Rat *
    Article Snippet: .. Consistent with the novel cDNA sequence, there was no apparent digestion by Bsu36I either of the 435-bp seminested PCR products prior to cloning, or of 8 individual cDNA clones from each of the three DRG tissues (data not shown). ..

    Article Title: Cloning and characterization of tRNA (m1A58) methyltransferase (TrmI) from Thermus thermophilus HB27, a protein required for cell growth at extreme temperatures
    Article Snippet: A 2.9 kb T.thermophilus genomic fragment bearing the trmI gene was amplified from T.thermophilus HB27 genomic DNA using the GC-rich PCR kit (Roche Diagnostics) and the oligonucleotides PGCD-1 and PGCD-2 with Eco RI restriction sites to facilitate the cloning into the cognate site of pUC18. .. Plasmid pTT1 was digested with Bsu 36I (New England Biolabs, Beverly, MA).

    Article Title: Proviruses Selected for High and Stable Expression of Transduced Genes Accumulate in Broadly Transcribed Genome Areas ▿Proviruses Selected for High and Stable Expression of Transduced Genes Accumulate in Broadly Transcribed Genome Areas ▿ †
    Article Snippet: The product of self-ligation was subsequently cleaved overnight at 37°C with 10 U of PvuI and 10 U of Bsu36I (both enzymes from New England Biolabs, Ipswitch, MA) in 50 μl reaction mixture to eliminate the background from internal proviral PstI fragments and to increase the efficiency of I-PCR by linearization of the circles within the LTR, respectively. .. After being desalted, 150 ng of the resulting DNA was subjected to PCR amplification with Taq polymerase (TaKaRa Bio, Otsu, Japan) in a standard reaction according to the manufacturer's instructions, with the addition of betaine and dimethyl sulfoxide.

    Article Title: Novel Isoforms of the Sodium Channels Nav1.8 and Nav1.5 Are Produced by a Conserved Mechanism in Mouse and Rat *
    Article Snippet: .. The purified product was used in a 25-cycle seminested PCR with primer pair SNSfor4/SNSrev3, prior to either purified PCR products (PCR purification kit, Qiagen) or DNA minipreps (Qiagen) of TA-cloned products being incubated with Bsu36I (New England Biolabs), which does not cut the vector pCRII-TOPO. .. Nav 1.8 cDNA inserts were also cloned from trigeminal ganglia, as above, using the primer pair SNSfor3/SNSrev3.

    Nested PCR:

    Article Title: Novel Isoforms of the Sodium Channels Nav1.8 and Nav1.5 Are Produced by a Conserved Mechanism in Mouse and Rat *
    Article Snippet: The single apparent product was cut out from a 2% agarose gel, purified (Gel Extraction kit, Qiagen), and used in a 25-cycle nested PCR with primer pair SNSfor2/SNSrev2, prior to cloning products into pCRII-TOPO using a TOPO TA cloning kit and transformation into One Shot TOP10F′ competent cells (Invitrogen). .. The purified product was used in a 25-cycle seminested PCR with primer pair SNSfor4/SNSrev3, prior to either purified PCR products (PCR purification kit, Qiagen) or DNA minipreps (Qiagen) of TA-cloned products being incubated with Bsu36I (New England Biolabs), which does not cut the vector pCRII-TOPO.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Investigation of the association between interleukin-1? polymorphism and normal tension glaucoma
    Article Snippet: A 304 bp PCR fragment of the IL-1β (-511) in the promoter region was amplified using the following primers: F5'-TGG CAT TGA TCT GGT TCA TC-3' and R5'-GTT TAG GAA TCT TCC CAC TT-3'. .. The products were digested with Bsu 36I (New England Biolabs, Inc., Beverly, MA) at 37 °C for 3 h and were run on ethidium bromide-stained 2% agarose gel.

    Plasmid Preparation:

    Article Title: Cloning and characterization of tRNA (m1A58) methyltransferase (TrmI) from Thermus thermophilus HB27, a protein required for cell growth at extreme temperatures
    Article Snippet: .. Plasmid pTT1 was digested with Bsu 36I (New England Biolabs, Beverly, MA). .. The 509 bp Bsu 36I fragment, in the coding region of trmI , was replaced by the 838 bp Bsu 36I fragment of pML11b to create the ligation product pML51 used for homologous recombination.

    Article Title: JC virus granule cell neuronopathy is associated with VP1 C terminus mutants
    Article Snippet: .. The plasmid containing the PGVP1-T fragment was purified and digested by Pac I (2369 of JCVHWM ) ( ; ) and Bsu 36I (3056 of JCVHWM ) (New England Biolabs). .. The 696 bp PGVP1-T fragment containing 10 bp VP1 deletion and intact C terminus of the T gene was recovered from agarose gel (QIAquick Gel Extraction kit; Qiagen) and then used to replace the counterpart of JCVGCN1-RR to obtain the full-length genome of JCVGCN1 .

    Article Title: The capacity to form H-DNA cannot substitute for GAGA factor binding to a (CT)n?(GA)n regulatory site
    Article Snippet: Five micrograms of supercoiled plasmid DNA were treated with 30 U of S1 nuclease (Promega) at room temperature for 15 min in S1 buffer (pH 5.0). .. After phenol extraction and ethanol precipitation, the samples were resuspended in 1× Bsu 36I buffer and were digested to completion with Bsu 36I (NEB).

    Article Title: Novel Isoforms of the Sodium Channels Nav1.8 and Nav1.5 Are Produced by a Conserved Mechanism in Mouse and Rat *
    Article Snippet: .. The purified product was used in a 25-cycle seminested PCR with primer pair SNSfor4/SNSrev3, prior to either purified PCR products (PCR purification kit, Qiagen) or DNA minipreps (Qiagen) of TA-cloned products being incubated with Bsu36I (New England Biolabs), which does not cut the vector pCRII-TOPO. .. Nav 1.8 cDNA inserts were also cloned from trigeminal ganglia, as above, using the primer pair SNSfor3/SNSrev3.

    In Vitro:

    Article Title: The capacity to form H-DNA cannot substitute for GAGA factor binding to a (CT)n?(GA)n regulatory site
    Article Snippet: Paragraph title: In vitro DNase I footprinting and S1 analysis ... After phenol extraction and ethanol precipitation, the samples were resuspended in 1× Bsu 36I buffer and were digested to completion with Bsu 36I (NEB).

    Negative Control:

    Article Title: Novel Isoforms of the Sodium Channels Nav1.8 and Nav1.5 Are Produced by a Conserved Mechanism in Mouse and Rat *
    Article Snippet: RT-PCR conditions using either TaqDNA polymerase were as above, except for extension times of 45 s, and the use of both 20 and 100 ng of total RNA equivalents for (negative control) neonatal heart. .. The purified product was used in a 25-cycle seminested PCR with primer pair SNSfor4/SNSrev3, prior to either purified PCR products (PCR purification kit, Qiagen) or DNA minipreps (Qiagen) of TA-cloned products being incubated with Bsu36I (New England Biolabs), which does not cut the vector pCRII-TOPO.

    Recombinant:

    Article Title: Novel Isoforms of the Sodium Channels Nav1.8 and Nav1.5 Are Produced by a Conserved Mechanism in Mouse and Rat *
    Article Snippet: 50 μ l of RT-PCR used 1 μ l of RT reaction (20 ng of total RNA equivalent) with primer pair SNSfor1/SNSrev1, and either recombinant TaqDNA polymerase (Invitrogen, 10342) or a hot start DNA polymerase that includes a proofreading enzyme (Clontech Advantage cDNA polymerase, 8417-1), under the following conditions: 94 °C for 2 min, and 35 cycles of 94 °C, 30 s; 64 °C, 45 s; 72 °C, 30 s, with a final 72 °C for 10 min. .. The purified product was used in a 25-cycle seminested PCR with primer pair SNSfor4/SNSrev3, prior to either purified PCR products (PCR purification kit, Qiagen) or DNA minipreps (Qiagen) of TA-cloned products being incubated with Bsu36I (New England Biolabs), which does not cut the vector pCRII-TOPO.

    Agarose Gel Electrophoresis:

    Article Title: JC virus granule cell neuronopathy is associated with VP1 C terminus mutants
    Article Snippet: The plasmid containing the PGVP1-T fragment was purified and digested by Pac I (2369 of JCVHWM ) ( ; ) and Bsu 36I (3056 of JCVHWM ) (New England Biolabs). .. The 696 bp PGVP1-T fragment containing 10 bp VP1 deletion and intact C terminus of the T gene was recovered from agarose gel (QIAquick Gel Extraction kit; Qiagen) and then used to replace the counterpart of JCVGCN1-RR to obtain the full-length genome of JCVGCN1 .

    Article Title: The capacity to form H-DNA cannot substitute for GAGA factor binding to a (CT)n?(GA)n regulatory site
    Article Snippet: After phenol extraction and ethanol precipitation, the samples were resuspended in 1× Bsu 36I buffer and were digested to completion with Bsu 36I (NEB). .. The samples were separated electrophoretically using a 0.8% agarose gel, transferred with 10× SSC to Magna nylon membrane (MSI) and hybridized to a [32 P]dCTP-labeled 0.5 kb Bsu 36I– Eco R1 fragment derived from pCon-2 (see Fig. ) for indirect end-labeling ( ).

    Article Title: Frequent polymorphisms of FSH receptor do not influence antral follicle responsiveness to follicle-stimulating hormone administration as assessed by the Follicular Output RaTe (FORT)
    Article Snippet: The amplified fragment of 364 bp was digested with Bsu36I (New England Biolabs, USA) restriction enzyme. .. This mismatch and the A to G transition created a Bsu36I restriction site, so that the second PCR fragment following Bsu36I digestion and 2.5% agarose gel electrophoresis with ethidium bromide revealed different RFLP patterns.

    Article Title: Investigation of the association between interleukin-1? polymorphism and normal tension glaucoma
    Article Snippet: .. The products were digested with Bsu 36I (New England Biolabs, Inc., Beverly, MA) at 37 °C for 3 h and were run on ethidium bromide-stained 2% agarose gel. ..

    Article Title: Novel Isoforms of the Sodium Channels Nav1.8 and Nav1.5 Are Produced by a Conserved Mechanism in Mouse and Rat *
    Article Snippet: The single apparent product was cut out from a 2% agarose gel, purified (Gel Extraction kit, Qiagen), and used in a 25-cycle nested PCR with primer pair SNSfor2/SNSrev2, prior to cloning products into pCRII-TOPO using a TOPO TA cloning kit and transformation into One Shot TOP10F′ competent cells (Invitrogen). .. The purified product was used in a 25-cycle seminested PCR with primer pair SNSfor4/SNSrev3, prior to either purified PCR products (PCR purification kit, Qiagen) or DNA minipreps (Qiagen) of TA-cloned products being incubated with Bsu36I (New England Biolabs), which does not cut the vector pCRII-TOPO.

    In Situ:

    Article Title: Epigenetic CRBP downregulation appears to be an evolutionarily conserved (human and mouse) and oncogene-specific phenomenon in breast cancer
    Article Snippet: All specimens were diagnosed as invasive breast carcinoma, with or without a carcinoma in situ component, except for one specimen which was an adenoid cystic breast carcinoma (not shown in Fig. ). .. Tumor DNA (45 μg) was digested with Bsu36I, ethanol precipitated, and divided into 3 parts that were either not digested further, digested with HpaII, or digested with MsPI (restriction enzymes were from New England Biolabs, Beverly, MA).

    Ethanol Precipitation:

    Article Title: The capacity to form H-DNA cannot substitute for GAGA factor binding to a (CT)n?(GA)n regulatory site
    Article Snippet: .. After phenol extraction and ethanol precipitation, the samples were resuspended in 1× Bsu 36I buffer and were digested to completion with Bsu 36I (NEB). .. Linear controls were prepared by digestion with Bsu 36I and were subsequently treated with S1.

    Article Title: Epigenetic CRBP downregulation appears to be an evolutionarily conserved (human and mouse) and oncogene-specific phenomenon in breast cancer
    Article Snippet: Tumor DNA (45 μg) was digested with Bsu36I, ethanol precipitated, and divided into 3 parts that were either not digested further, digested with HpaII, or digested with MsPI (restriction enzymes were from New England Biolabs, Beverly, MA). .. After ethanol precipitation, Southern blots were prepared and hybridized to a 205 bp hCRBP probe amplified from a cloned hCRBP genomic fragment using CCGGTCTCCTCTTCCTTTGTAGGGG (sense) and GGGACAGGGGGCTCTGCGGGG (antisense) primers.

    Concentration Assay:

    Article Title: New Lung Cancer Panel for High-Throughput Targeted Resequencing
    Article Snippet: Target enrichment Eight different restriction reactions were used to digest genomic DNAs from each sample, including Sfc I and Hpy188I in NEB buffer 4; Dde I and Alu I in NEB buffer 2; Mse I and Bsu 36I in NEB buffer 3; Msl I and Bfa I in NEB buffer 4; Hpy CH4III and Bsp 1286 in NEB buffer 4; Sfc I and Nla III in NEB buffer 4; Mse I and Hpy CH4III in NEB buffer 4; and Hpy CH4V and Eco O109I in NEB buffer 4 (New England Biolabs, Ipswich, MA, USA). .. The restriction reactions contained 1 unit each of two restriction enzymes and their corresponding compatible NEB buffer in 1× concentration and 0.85 µg/µL bovine serum albumin (BSA) in a total volume of 10 µL.

    End Labeling:

    Article Title: The capacity to form H-DNA cannot substitute for GAGA factor binding to a (CT)n?(GA)n regulatory site
    Article Snippet: After phenol extraction and ethanol precipitation, the samples were resuspended in 1× Bsu 36I buffer and were digested to completion with Bsu 36I (NEB). .. The samples were separated electrophoretically using a 0.8% agarose gel, transferred with 10× SSC to Magna nylon membrane (MSI) and hybridized to a [32 P]dCTP-labeled 0.5 kb Bsu 36I– Eco R1 fragment derived from pCon-2 (see Fig. ) for indirect end-labeling ( ).

    Gel Extraction:

    Article Title: JC virus granule cell neuronopathy is associated with VP1 C terminus mutants
    Article Snippet: The plasmid containing the PGVP1-T fragment was purified and digested by Pac I (2369 of JCVHWM ) ( ; ) and Bsu 36I (3056 of JCVHWM ) (New England Biolabs). .. The 696 bp PGVP1-T fragment containing 10 bp VP1 deletion and intact C terminus of the T gene was recovered from agarose gel (QIAquick Gel Extraction kit; Qiagen) and then used to replace the counterpart of JCVGCN1-RR to obtain the full-length genome of JCVGCN1 .

    Article Title: Novel Isoforms of the Sodium Channels Nav1.8 and Nav1.5 Are Produced by a Conserved Mechanism in Mouse and Rat *
    Article Snippet: The single apparent product was cut out from a 2% agarose gel, purified (Gel Extraction kit, Qiagen), and used in a 25-cycle nested PCR with primer pair SNSfor2/SNSrev2, prior to cloning products into pCRII-TOPO using a TOPO TA cloning kit and transformation into One Shot TOP10F′ competent cells (Invitrogen). .. The purified product was used in a 25-cycle seminested PCR with primer pair SNSfor4/SNSrev3, prior to either purified PCR products (PCR purification kit, Qiagen) or DNA minipreps (Qiagen) of TA-cloned products being incubated with Bsu36I (New England Biolabs), which does not cut the vector pCRII-TOPO.

    Variant Assay:

    Article Title: Frequent polymorphisms of FSH receptor do not influence antral follicle responsiveness to follicle-stimulating hormone administration as assessed by the Follicular Output RaTe (FORT)
    Article Snippet: The Thr307Ala variant, in exon 10 of the FSHR gene, was detected by the nested PCR–Restriction Fragment Length Polymorphism (RFLP) method. .. The amplified fragment of 364 bp was digested with Bsu36I (New England Biolabs, USA) restriction enzyme.

    Homologous Recombination:

    Article Title: Cloning and characterization of tRNA (m1A58) methyltransferase (TrmI) from Thermus thermophilus HB27, a protein required for cell growth at extreme temperatures
    Article Snippet: Plasmid pTT1 was digested with Bsu 36I (New England Biolabs, Beverly, MA). .. The 509 bp Bsu 36I fragment, in the coding region of trmI , was replaced by the 838 bp Bsu 36I fragment of pML11b to create the ligation product pML51 used for homologous recombination.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs bsu36i snabi enzymes
    Bsu36i Snabi Enzymes, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsu36i snabi enzymes/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bsu36i snabi enzymes - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs snabi
    Snabi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/snabi/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    snabi - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    90
    New England Biolabs snabi restriction enzyme
    Snabi Restriction Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/snabi restriction enzyme/product/New England Biolabs
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    snabi restriction enzyme - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    Image Search Results