nsii  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    NsiI
    Description:
    NsiI 5 000 units
    Catalog Number:
    r0127l
    Price:
    269
    Size:
    5 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs nsii
    NsiI
    NsiI 5 000 units
    https://www.bioz.com/result/nsii/product/New England Biolabs
    Average 99 stars, based on 37 article reviews
    Price from $9.99 to $1999.99
    nsii - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: .. Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2]. .. Ligation reactions were concentrated by using ethanol precipitation, electroporated into SS320 electro-competent bacteria, and grown as described above.

    Article Title: Identification of TOEFAZ1-interacting proteins reveals key regulators of Trypanosoma brucei cytokinesis
    Article Snippet: .. Endogenous tagging constructs were excised using PacI and NsiI (NEB), transfected into the 427 cell line, cloned by limiting dilution, and selected with 20 μg/mL blasticidin. .. Cells carrying inducible Ty1 BirA*-TOEFAZ1 were seeded at a concentration of 3.0 × 106 cells/mL in 240 mL of media were either induced with 40 ng/mL doxycycline or treated with 70% ethanol as a vehicle control.

    Article Title: A secreted WNT-ligand-binding domain of FZD5 generated by a frameshift mutation causes autosomal dominant coloboma
    Article Snippet: PCR products were cloned into pCR4-TOPO (Invitrogen) for sequencing confirmation and sub-cloned into pCS2+ for mRNA synthesis. .. Constructs were linearized with NsiI (New England Biolabs) and mRNA was generated using the SP6 mMessage mMachine kit (Ambion). mRNA was purified using YM-50 Microcon columns (Amicon, Millipore) and the concentration was determined through spectrophotometry.

    Amplification:

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: For each primer-less PCR reassembly reaction, 500 ng of gel-extracted fragments was used and fully reassembled capsids were amplified in a second PCR with primers (Shuffling_Rescue-F: 5′-GTCGGAAAGCATATGCCGCG-3′, Shuffling_Rescue-R: 5′-GACGTCGCATGCAACTAGTAT-3′) binding the cap gene and carrying overlapping ends to pRV plasmids. .. Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2].

    Article Title: ROP18 Is a Key Factor Responsible for Virulence Difference between Toxoplasma gondii and Neospora caninum
    Article Snippet: A synonymous mutation at the EcoRV site of the TgROP18 gene (GenBank: JX045330) except the stop codon was obtained by PCR amplification of two overlapping sections (1,243 bp and 465 bp respectively) using the following primer pairs: F1+R2 and F2+R1. .. After purification, the PCR product was double digested with EcoRV and NsiI (NEB, USA).

    Article Title: Focused Screening and Treatment (FSAT): A PCR-Based Strategy to Detect Malaria Parasite Carriers and Contain Drug Resistant P. falciparum, Pailin, Cambodia
    Article Snippet: For both nested PCR (NsiI and SspI), amplification took place in the following reaction mixture: 2.5 µl of 10× buffer, 1.5 mM MgCl2, 0.2 mM each deoxynucleoside triphosphate, 0.5 µM each primer (forward primer NsiI, 5′-ggtttacttggaacagtttttaacaatg-3′ , reverse primer NsiI, 5′-ggtttacttggaacagtttttaacaatg-3′ and forward primer SspI, 5′-acagaataatctctagcacc-3′ , reverse primer NsiI, 5′-acctgaatggtactttctacaatat-3′ ), 2 U of FirePol Taq polymerase (Solis Biodyne®, Estonia), and 2 µl of PCR products. .. Nested PCRs were performed under the following conditions: heating at 94°C for 5 min, followed by 30 cycles of heating at 94°C for 30 s, 45°C (nested PCR NsiI) or 55°C (nested PCR SspI) for 90 s, and 72°C for 2 min, and a final extension period at 72°C for 10 min. Five µl of nested PCR products adjusted to 500 ng/µl were respectively mixed with 0.2 µl of NsiI and 2.5 µl of buffer 3 (nested PCR NsiI) and with 0.2 µl of SspI and 2.5 µl of buffer 2 (nested PCR SspI) according to the manufacturer's instructions (New England Biolabs®, France), incubated for 4 hours at 37°C and inactivated at 65°C (SspI) or 80°C (NsiI) for 20 minutes.

    Article Title: Targeted Disruption of the GRA2 Locus in Toxoplasma gondii Decreases Acute Virulence in Mice
    Article Snippet: T. gondii genomic DNA was digested with either Nco I or Nsi I (New England Biolabs Inc., Beverly, Mass.), electrophoresed in agarose gels, transferred to nylon membranes, and hybridized at high stringency with specific probes as described previously ( ). .. The probe corresponding to the Nsi I- Pac I fragment of the ble gene was amplified by PCR (sense oligonucleotide, 5′ TGCATGCATGACCAAGCGACGCCCAAC 3′; antisense oligonucleotide, 5′ GCATTAATTAAGAGATGCCTGCAAGCAATTC 3′) from the pSAG1/Ble template ( ).

    Article Title: A secreted WNT-ligand-binding domain of FZD5 generated by a frameshift mutation causes autosomal dominant coloboma
    Article Snippet: Human FZD5 WT and A219Xfs*49 cDNA was amplified using pRK5 constructs as template (see below) using the following primer sequences: F—CACAGGATCCACCATGGCTCGGCCTG), R—CACAGAATTCCCTGAACCAAGTGGAA. .. Constructs were linearized with NsiI (New England Biolabs) and mRNA was generated using the SP6 mMessage mMachine kit (Ambion). mRNA was purified using YM-50 Microcon columns (Amicon, Millipore) and the concentration was determined through spectrophotometry.

    Article Title: Transcription of Hepatitis B Virus Covalently Closed Circular DNA Is Regulated by CpG Methylation during Chronic Infection
    Article Snippet: In vitro methylation of HBV CpG islands Each of the three CpG island-containing DNA fragment with flanking sequence and terminal restriction sites was amplified from HBV plasmid pHBV536207 or p1.3*HBV536207 (genotype B, Gen Bank accession number: AY220698, Fragment A, B, C, CA and AB were amplified from pHBV536207, Fragment BC was amplified from p1.3*HBV536207) ( ) , by using PrimeSTAR HS DNA Polymerase (Takara) and corresponding primer set shown in . .. The purified unmethylated CpG island (I–III)-containing DNA PCR fragments were digested by SapI, BbsI and NsiI (New England Biolabs, Ipswich, MA, USA), respectively ( ).

    Construct:

    Article Title: Identification of TOEFAZ1-interacting proteins reveals key regulators of Trypanosoma brucei cytokinesis
    Article Snippet: .. Endogenous tagging constructs were excised using PacI and NsiI (NEB), transfected into the 427 cell line, cloned by limiting dilution, and selected with 20 μg/mL blasticidin. .. Cells carrying inducible Ty1 BirA*-TOEFAZ1 were seeded at a concentration of 3.0 × 106 cells/mL in 240 mL of media were either induced with 40 ng/mL doxycycline or treated with 70% ethanol as a vehicle control.

    Article Title: A secreted WNT-ligand-binding domain of FZD5 generated by a frameshift mutation causes autosomal dominant coloboma
    Article Snippet: .. Constructs were linearized with NsiI (New England Biolabs) and mRNA was generated using the SP6 mMessage mMachine kit (Ambion). mRNA was purified using YM-50 Microcon columns (Amicon, Millipore) and the concentration was determined through spectrophotometry. .. The mRNA was diluted with dimethyl pyrocarbonate-treated water and injected at a dose of 200 pg into one-cell-stage embryos.

    Incubation:

    Article Title: Focused Screening and Treatment (FSAT): A PCR-Based Strategy to Detect Malaria Parasite Carriers and Contain Drug Resistant P. falciparum, Pailin, Cambodia
    Article Snippet: .. Nested PCRs were performed under the following conditions: heating at 94°C for 5 min, followed by 30 cycles of heating at 94°C for 30 s, 45°C (nested PCR NsiI) or 55°C (nested PCR SspI) for 90 s, and 72°C for 2 min, and a final extension period at 72°C for 10 min. Five µl of nested PCR products adjusted to 500 ng/µl were respectively mixed with 0.2 µl of NsiI and 2.5 µl of buffer 3 (nested PCR NsiI) and with 0.2 µl of SspI and 2.5 µl of buffer 2 (nested PCR SspI) according to the manufacturer's instructions (New England Biolabs®, France), incubated for 4 hours at 37°C and inactivated at 65°C (SspI) or 80°C (NsiI) for 20 minutes. .. Bands were detected by standard 2% agarose gel electrophoresis and ethidium bromide staining.

    Expressing:

    Article Title: ROP18 Is a Key Factor Responsible for Virulence Difference between Toxoplasma gondii and Neospora caninum
    Article Snippet: After purification, the PCR product was double digested with EcoRV and NsiI (NEB, USA). .. Then the recovered fragment was inserted into the pDMG vector (kindly provided by Professor Xuenan Xuan, Obihiro University of Agriculture and Veterinary Medicine, Japan), which is a transfer vector for constructing recombinant T. gondii expressing foreign genes – .

    Knock-In:

    Article Title: Retinal pathology and skin barrier defect in mice carrying a Stargardt disease-3 mutation in elongase of very long chain fatty acids-4
    Article Snippet: .. Southern blot analysis of knockin mice Tail DNA samples were digested with Nsi I or Bpu 10I (New England Biolabs, Beverly, MA), separated on an agarose gel, transferred to Hybond N+ membrane (GE Healthcare, Piscataway, NJ), and subjected to Southern blot analysis using P32-labeled DNA probes: a 453-bp 5'-external probe, a 284-bp Neo probe, or a 1.2-kb 3'-internal probe ( ). .. Polymerase chain reaction genotyping of mice After founder mice were characterized by Southern blot analysis, further genotyping of their progenies was performed by PCR using tail DNA.

    Transfection:

    Article Title: Identification of TOEFAZ1-interacting proteins reveals key regulators of Trypanosoma brucei cytokinesis
    Article Snippet: .. Endogenous tagging constructs were excised using PacI and NsiI (NEB), transfected into the 427 cell line, cloned by limiting dilution, and selected with 20 μg/mL blasticidin. .. Cells carrying inducible Ty1 BirA*-TOEFAZ1 were seeded at a concentration of 3.0 × 106 cells/mL in 240 mL of media were either induced with 40 ng/mL doxycycline or treated with 70% ethanol as a vehicle control.

    Southern Blot:

    Article Title: Pathogenic Leptospira species express surface-exposed proteins belonging to the bacterial immunoglobulin superfamily
    Article Snippet: Paragraph title: Southern blot analysis ... Approximately 3 μg of DNA was digested with 5–20 units of Nsi I (NEB) overnight in a final volume of 50 μl.

    Article Title: Retinal pathology and skin barrier defect in mice carrying a Stargardt disease-3 mutation in elongase of very long chain fatty acids-4
    Article Snippet: .. Southern blot analysis of knockin mice Tail DNA samples were digested with Nsi I or Bpu 10I (New England Biolabs, Beverly, MA), separated on an agarose gel, transferred to Hybond N+ membrane (GE Healthcare, Piscataway, NJ), and subjected to Southern blot analysis using P32-labeled DNA probes: a 453-bp 5'-external probe, a 284-bp Neo probe, or a 1.2-kb 3'-internal probe ( ). .. Polymerase chain reaction genotyping of mice After founder mice were characterized by Southern blot analysis, further genotyping of their progenies was performed by PCR using tail DNA.

    Ligation:

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2]. .. Ligation reactions were concentrated by using ethanol precipitation, electroporated into SS320 electro-competent bacteria, and grown as described above.

    Article Title: Revised Selection Criteria for Candidate Restriction Enzymes in Genome Walking
    Article Snippet: Preparation of adapter-ligated Arabidopsis genomic DNA Arabidopsis Genomic DNA (500 ng) was digested with 10 units of either Nsi I or Nde I (NEB, Pickering, Ontario) in a final volume of 20 µl overnight at 37°C. .. Prior to adapter ligation, column-filtered genomic fragments were heated to 50°C for 5 min to eliminate base-pairing between overhanging ends.

    Cell Culture:

    Article Title: Pathogenic Leptospira species express surface-exposed proteins belonging to the bacterial immunoglobulin superfamily
    Article Snippet: Genomic DNA was extracted from leptospiral strains with the Blood and Cell Culture kit (Qiagen) from 500 ml of 7-day cultures. .. Approximately 3 μg of DNA was digested with 5–20 units of Nsi I (NEB) overnight in a final volume of 50 μl.

    Generated:

    Article Title: A secreted WNT-ligand-binding domain of FZD5 generated by a frameshift mutation causes autosomal dominant coloboma
    Article Snippet: .. Constructs were linearized with NsiI (New England Biolabs) and mRNA was generated using the SP6 mMessage mMachine kit (Ambion). mRNA was purified using YM-50 Microcon columns (Amicon, Millipore) and the concentration was determined through spectrophotometry. .. The mRNA was diluted with dimethyl pyrocarbonate-treated water and injected at a dose of 200 pg into one-cell-stage embryos.

    Sequencing:

    Article Title: Identification of TOEFAZ1-interacting proteins reveals key regulators of Trypanosoma brucei cytokinesis
    Article Snippet: For C-terminal Ty1 epitope tags, targeting of endogenous loci was obtained using the last 500 bp of the 3’ coding sequence and the first 500 bp of the 3’ UTR( ). .. Endogenous tagging constructs were excised using PacI and NsiI (NEB), transfected into the 427 cell line, cloned by limiting dilution, and selected with 20 μg/mL blasticidin.

    Article Title: Targeted Disruption of the GRA2 Locus in Toxoplasma gondii Decreases Acute Virulence in Mice
    Article Snippet: T. gondii genomic DNA was digested with either Nco I or Nsi I (New England Biolabs Inc., Beverly, Mass.), electrophoresed in agarose gels, transferred to nylon membranes, and hybridized at high stringency with specific probes as described previously ( ). .. A probe corresponding to the 544-bp Sal I- Bst EII fragment within the GRA2 gene was purified by restriction digest from pG43; it spans most of the GRA2 coding sequence and intron ( ).

    Article Title: A secreted WNT-ligand-binding domain of FZD5 generated by a frameshift mutation causes autosomal dominant coloboma
    Article Snippet: PCR products were cloned into pCR4-TOPO (Invitrogen) for sequencing confirmation and sub-cloned into pCS2+ for mRNA synthesis. .. Constructs were linearized with NsiI (New England Biolabs) and mRNA was generated using the SP6 mMessage mMachine kit (Ambion). mRNA was purified using YM-50 Microcon columns (Amicon, Millipore) and the concentration was determined through spectrophotometry.

    Article Title: Transcription of Hepatitis B Virus Covalently Closed Circular DNA Is Regulated by CpG Methylation during Chronic Infection
    Article Snippet: In vitro methylation of HBV CpG islands Each of the three CpG island-containing DNA fragment with flanking sequence and terminal restriction sites was amplified from HBV plasmid pHBV536207 or p1.3*HBV536207 (genotype B, Gen Bank accession number: AY220698, Fragment A, B, C, CA and AB were amplified from pHBV536207, Fragment BC was amplified from p1.3*HBV536207) ( ) , by using PrimeSTAR HS DNA Polymerase (Takara) and corresponding primer set shown in . .. The purified unmethylated CpG island (I–III)-containing DNA PCR fragments were digested by SapI, BbsI and NsiI (New England Biolabs, Ipswich, MA, USA), respectively ( ).

    Sonication:

    Article Title: Tumor diversity and evolution revealed through RADseq
    Article Snippet: Library preparation RADseq libraries were prepared from extracted DNA according to the method described by Etter et al [ , ] using the enzymes SbfI-HF and NsiI (New England Biolabs), with 1μg of DNA starting material. .. The shearing step was performed on a Bioruptor+ sonication device (Diagenode) with 10 cycles of 30 seconds on, 1 minute off (high setting).

    Injection:

    Article Title: A secreted WNT-ligand-binding domain of FZD5 generated by a frameshift mutation causes autosomal dominant coloboma
    Article Snippet: Paragraph title: Zebrafish morpholino and FZD5 mRNA injection experiments ... Constructs were linearized with NsiI (New England Biolabs) and mRNA was generated using the SP6 mMessage mMachine kit (Ambion). mRNA was purified using YM-50 Microcon columns (Amicon, Millipore) and the concentration was determined through spectrophotometry.

    Recombinant:

    Article Title: ROP18 Is a Key Factor Responsible for Virulence Difference between Toxoplasma gondii and Neospora caninum
    Article Snippet: After purification, the PCR product was double digested with EcoRV and NsiI (NEB, USA). .. Then the recovered fragment was inserted into the pDMG vector (kindly provided by Professor Xuenan Xuan, Obihiro University of Agriculture and Veterinary Medicine, Japan), which is a transfer vector for constructing recombinant T. gondii expressing foreign genes – .

    Methylation:

    Article Title: Transcription of Hepatitis B Virus Covalently Closed Circular DNA Is Regulated by CpG Methylation during Chronic Infection
    Article Snippet: Paragraph title: In vitro methylation of HBV CpG islands ... The purified unmethylated CpG island (I–III)-containing DNA PCR fragments were digested by SapI, BbsI and NsiI (New England Biolabs, Ipswich, MA, USA), respectively ( ).

    Mutagenesis:

    Article Title: ROP18 Is a Key Factor Responsible for Virulence Difference between Toxoplasma gondii and Neospora caninum
    Article Snippet: A synonymous mutation at the EcoRV site of the TgROP18 gene (GenBank: JX045330) except the stop codon was obtained by PCR amplification of two overlapping sections (1,243 bp and 465 bp respectively) using the following primer pairs: F1+R2 and F2+R1. .. After purification, the PCR product was double digested with EcoRV and NsiI (NEB, USA).

    Random Primed:

    Article Title: Targeted Disruption of the GRA2 Locus in Toxoplasma gondii Decreases Acute Virulence in Mice
    Article Snippet: T. gondii genomic DNA was digested with either Nco I or Nsi I (New England Biolabs Inc., Beverly, Mass.), electrophoresed in agarose gels, transferred to nylon membranes, and hybridized at high stringency with specific probes as described previously ( ). .. Probes were labeled with [α-32 P]dCTP by using a random primed labeling kit (Boehringer Mannheim, Indianapolis, Ind.).

    Labeling:

    Article Title: Targeted Disruption of the GRA2 Locus in Toxoplasma gondii Decreases Acute Virulence in Mice
    Article Snippet: T. gondii genomic DNA was digested with either Nco I or Nsi I (New England Biolabs Inc., Beverly, Mass.), electrophoresed in agarose gels, transferred to nylon membranes, and hybridized at high stringency with specific probes as described previously ( ). .. Probes were labeled with [α-32 P]dCTP by using a random primed labeling kit (Boehringer Mannheim, Indianapolis, Ind.).

    Purification:

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: Total pRV library plasmids were purified with an EndoFree Maxiprep Kit (Cat #12362; QIAGEN). .. Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2].

    Article Title: ROP18 Is a Key Factor Responsible for Virulence Difference between Toxoplasma gondii and Neospora caninum
    Article Snippet: .. After purification, the PCR product was double digested with EcoRV and NsiI (NEB, USA). .. Then the recovered fragment was inserted into the pDMG vector (kindly provided by Professor Xuenan Xuan, Obihiro University of Agriculture and Veterinary Medicine, Japan), which is a transfer vector for constructing recombinant T. gondii expressing foreign genes – .

    Article Title: Revised Selection Criteria for Candidate Restriction Enzymes in Genome Walking
    Article Snippet: Preparation of adapter-ligated Arabidopsis genomic DNA Arabidopsis Genomic DNA (500 ng) was digested with 10 units of either Nsi I or Nde I (NEB, Pickering, Ontario) in a final volume of 20 µl overnight at 37°C. .. Step (9), in preparation for adapter-ligation, digested DNA was treated with Antarctic phosphatase according to the manufacturer's instruction (NEB, Pickering, Ontario), filtered through PCR purification columns (Qiagen, Mississauga, Ontario), and diluted in 50 µl H2 O.

    Article Title: Pathogenic Leptospira species express surface-exposed proteins belonging to the bacterial immunoglobulin superfamily
    Article Snippet: Approximately 3 μg of DNA was digested with 5–20 units of Nsi I (NEB) overnight in a final volume of 50 μl. .. DNA was then purified with phenol:chloroform: isoamyl and precipitated with 100% cold ethanol and 3 M sodium acetate pH 5.2 and washed with 70% ethanol.

    Article Title: Targeted Disruption of the GRA2 Locus in Toxoplasma gondii Decreases Acute Virulence in Mice
    Article Snippet: T. gondii genomic DNA was digested with either Nco I or Nsi I (New England Biolabs Inc., Beverly, Mass.), electrophoresed in agarose gels, transferred to nylon membranes, and hybridized at high stringency with specific probes as described previously ( ). .. A probe corresponding to the 544-bp Sal I- Bst EII fragment within the GRA2 gene was purified by restriction digest from pG43; it spans most of the GRA2 coding sequence and intron ( ).

    Article Title: A secreted WNT-ligand-binding domain of FZD5 generated by a frameshift mutation causes autosomal dominant coloboma
    Article Snippet: .. Constructs were linearized with NsiI (New England Biolabs) and mRNA was generated using the SP6 mMessage mMachine kit (Ambion). mRNA was purified using YM-50 Microcon columns (Amicon, Millipore) and the concentration was determined through spectrophotometry. .. The mRNA was diluted with dimethyl pyrocarbonate-treated water and injected at a dose of 200 pg into one-cell-stage embryos.

    Article Title: Transcription of Hepatitis B Virus Covalently Closed Circular DNA Is Regulated by CpG Methylation during Chronic Infection
    Article Snippet: .. The purified unmethylated CpG island (I–III)-containing DNA PCR fragments were digested by SapI, BbsI and NsiI (New England Biolabs, Ipswich, MA, USA), respectively ( ). .. Next, the three DNA fragments which contain the HBV CpG islands underwent in vitro methylation with CpG methyltransferase M.SssI (New England Biolabs) treatment according to the manufacturer's specifications.

    Polymerase Chain Reaction:

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: A GA reaction was performed by mixing an equal volume of 2 × GA Master Mix (Cat #E2611L; NEB) with 1 pmoL PCR-amplified and DpnI-treated pRV (BB_GAR-F: 5′-ACTTGTTCACTTTGATGGCGAGG-3′, BB_GAR-R: 5′-CTGCACACGACATGACATCACG-3′) and 1 pmol of the recovered shuffled capsids, at 50°C for 30 min. DNA was ethanol precipitated and electroporated into SS320 electro-competent E. coli (Cat #60512-2; Lucigen). .. Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2].

    Article Title: Tumor diversity and evolution revealed through RADseq
    Article Snippet: Library preparation RADseq libraries were prepared from extracted DNA according to the method described by Etter et al [ , ] using the enzymes SbfI-HF and NsiI (New England Biolabs), with 1μg of DNA starting material. .. The final PCR amplifications were run for 12 cycles.

    Article Title: ROP18 Is a Key Factor Responsible for Virulence Difference between Toxoplasma gondii and Neospora caninum
    Article Snippet: .. After purification, the PCR product was double digested with EcoRV and NsiI (NEB, USA). .. Then the recovered fragment was inserted into the pDMG vector (kindly provided by Professor Xuenan Xuan, Obihiro University of Agriculture and Veterinary Medicine, Japan), which is a transfer vector for constructing recombinant T. gondii expressing foreign genes – .

    Article Title: Revised Selection Criteria for Candidate Restriction Enzymes in Genome Walking
    Article Snippet: Preparation of adapter-ligated Arabidopsis genomic DNA Arabidopsis Genomic DNA (500 ng) was digested with 10 units of either Nsi I or Nde I (NEB, Pickering, Ontario) in a final volume of 20 µl overnight at 37°C. .. Step (9), in preparation for adapter-ligation, digested DNA was treated with Antarctic phosphatase according to the manufacturer's instruction (NEB, Pickering, Ontario), filtered through PCR purification columns (Qiagen, Mississauga, Ontario), and diluted in 50 µl H2 O.

    Article Title: Vector species-specific association between natural Wolbachia infections and avian malaria in black fly populations
    Article Snippet: .. Each 20 µl reaction contained 2.0 µl of PCR product (1/10 of COI gene PCR), 4 units of NheI, 4 units of NsiI (both enzymes supplied by NEB), and 1× NEB buffer 2.1 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 μg/ml BSA, pH 7.9 at 25 °C). ..

    Article Title: Focused Screening and Treatment (FSAT): A PCR-Based Strategy to Detect Malaria Parasite Carriers and Contain Drug Resistant P. falciparum, Pailin, Cambodia
    Article Snippet: For both nested PCR (NsiI and SspI), amplification took place in the following reaction mixture: 2.5 µl of 10× buffer, 1.5 mM MgCl2, 0.2 mM each deoxynucleoside triphosphate, 0.5 µM each primer (forward primer NsiI, 5′-ggtttacttggaacagtttttaacaatg-3′ , reverse primer NsiI, 5′-ggtttacttggaacagtttttaacaatg-3′ and forward primer SspI, 5′-acagaataatctctagcacc-3′ , reverse primer NsiI, 5′-acctgaatggtactttctacaatat-3′ ), 2 U of FirePol Taq polymerase (Solis Biodyne®, Estonia), and 2 µl of PCR products. .. Nested PCRs were performed under the following conditions: heating at 94°C for 5 min, followed by 30 cycles of heating at 94°C for 30 s, 45°C (nested PCR NsiI) or 55°C (nested PCR SspI) for 90 s, and 72°C for 2 min, and a final extension period at 72°C for 10 min. Five µl of nested PCR products adjusted to 500 ng/µl were respectively mixed with 0.2 µl of NsiI and 2.5 µl of buffer 3 (nested PCR NsiI) and with 0.2 µl of SspI and 2.5 µl of buffer 2 (nested PCR SspI) according to the manufacturer's instructions (New England Biolabs®, France), incubated for 4 hours at 37°C and inactivated at 65°C (SspI) or 80°C (NsiI) for 20 minutes.

    Article Title: Targeted Disruption of the GRA2 Locus in Toxoplasma gondii Decreases Acute Virulence in Mice
    Article Snippet: T. gondii genomic DNA was digested with either Nco I or Nsi I (New England Biolabs Inc., Beverly, Mass.), electrophoresed in agarose gels, transferred to nylon membranes, and hybridized at high stringency with specific probes as described previously ( ). .. The probe corresponding to the Nsi I- Pac I fragment of the ble gene was amplified by PCR (sense oligonucleotide, 5′ TGCATGCATGACCAAGCGACGCCCAAC 3′; antisense oligonucleotide, 5′ GCATTAATTAAGAGATGCCTGCAAGCAATTC 3′) from the pSAG1/Ble template ( ).

    Article Title: A secreted WNT-ligand-binding domain of FZD5 generated by a frameshift mutation causes autosomal dominant coloboma
    Article Snippet: PCR products were cloned into pCR4-TOPO (Invitrogen) for sequencing confirmation and sub-cloned into pCS2+ for mRNA synthesis. .. Constructs were linearized with NsiI (New England Biolabs) and mRNA was generated using the SP6 mMessage mMachine kit (Ambion). mRNA was purified using YM-50 Microcon columns (Amicon, Millipore) and the concentration was determined through spectrophotometry.

    Article Title: Transcription of Hepatitis B Virus Covalently Closed Circular DNA Is Regulated by CpG Methylation during Chronic Infection
    Article Snippet: .. The purified unmethylated CpG island (I–III)-containing DNA PCR fragments were digested by SapI, BbsI and NsiI (New England Biolabs, Ipswich, MA, USA), respectively ( ). .. Next, the three DNA fragments which contain the HBV CpG islands underwent in vitro methylation with CpG methyltransferase M.SssI (New England Biolabs) treatment according to the manufacturer's specifications.

    Blocking Assay:

    Article Title: A secreted WNT-ligand-binding domain of FZD5 generated by a frameshift mutation causes autosomal dominant coloboma
    Article Snippet: A previously described translation blocking MO targeting fzd5 (GATGCTCGTCTGCAGGTTTCCTCAT) was injected at a dose of 1.2 pmol ( ). .. Constructs were linearized with NsiI (New England Biolabs) and mRNA was generated using the SP6 mMessage mMachine kit (Ambion). mRNA was purified using YM-50 Microcon columns (Amicon, Millipore) and the concentration was determined through spectrophotometry.

    Nested PCR:

    Article Title: Focused Screening and Treatment (FSAT): A PCR-Based Strategy to Detect Malaria Parasite Carriers and Contain Drug Resistant P. falciparum, Pailin, Cambodia
    Article Snippet: .. Nested PCRs were performed under the following conditions: heating at 94°C for 5 min, followed by 30 cycles of heating at 94°C for 30 s, 45°C (nested PCR NsiI) or 55°C (nested PCR SspI) for 90 s, and 72°C for 2 min, and a final extension period at 72°C for 10 min. Five µl of nested PCR products adjusted to 500 ng/µl were respectively mixed with 0.2 µl of NsiI and 2.5 µl of buffer 3 (nested PCR NsiI) and with 0.2 µl of SspI and 2.5 µl of buffer 2 (nested PCR SspI) according to the manufacturer's instructions (New England Biolabs®, France), incubated for 4 hours at 37°C and inactivated at 65°C (SspI) or 80°C (NsiI) for 20 minutes. .. Bands were detected by standard 2% agarose gel electrophoresis and ethidium bromide staining.

    Mouse Assay:

    Article Title: Retinal pathology and skin barrier defect in mice carrying a Stargardt disease-3 mutation in elongase of very long chain fatty acids-4
    Article Snippet: .. Southern blot analysis of knockin mice Tail DNA samples were digested with Nsi I or Bpu 10I (New England Biolabs, Beverly, MA), separated on an agarose gel, transferred to Hybond N+ membrane (GE Healthcare, Piscataway, NJ), and subjected to Southern blot analysis using P32-labeled DNA probes: a 453-bp 5'-external probe, a 284-bp Neo probe, or a 1.2-kb 3'-internal probe ( ). .. Polymerase chain reaction genotyping of mice After founder mice were characterized by Southern blot analysis, further genotyping of their progenies was performed by PCR using tail DNA.

    Plasmid Preparation:

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: .. Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2]. .. Ligation reactions were concentrated by using ethanol precipitation, electroporated into SS320 electro-competent bacteria, and grown as described above.

    Article Title: ROP18 Is a Key Factor Responsible for Virulence Difference between Toxoplasma gondii and Neospora caninum
    Article Snippet: Paragraph title: Construction of the transfer vector pDMG-TgROP18 ... After purification, the PCR product was double digested with EcoRV and NsiI (NEB, USA).

    Article Title: Identification of TOEFAZ1-interacting proteins reveals key regulators of Trypanosoma brucei cytokinesis
    Article Snippet: Gibson Assembly was also used to rapidly generate endogenous tagging constructs into a sequencing vector (PCR4Blunt). .. Endogenous tagging constructs were excised using PacI and NsiI (NEB), transfected into the 427 cell line, cloned by limiting dilution, and selected with 20 μg/mL blasticidin.

    Article Title: Transcription of Hepatitis B Virus Covalently Closed Circular DNA Is Regulated by CpG Methylation during Chronic Infection
    Article Snippet: In vitro methylation of HBV CpG islands Each of the three CpG island-containing DNA fragment with flanking sequence and terminal restriction sites was amplified from HBV plasmid pHBV536207 or p1.3*HBV536207 (genotype B, Gen Bank accession number: AY220698, Fragment A, B, C, CA and AB were amplified from pHBV536207, Fragment BC was amplified from p1.3*HBV536207) ( ) , by using PrimeSTAR HS DNA Polymerase (Takara) and corresponding primer set shown in . .. The purified unmethylated CpG island (I–III)-containing DNA PCR fragments were digested by SapI, BbsI and NsiI (New England Biolabs, Ipswich, MA, USA), respectively ( ).

    Binding Assay:

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: For each primer-less PCR reassembly reaction, 500 ng of gel-extracted fragments was used and fully reassembled capsids were amplified in a second PCR with primers (Shuffling_Rescue-F: 5′-GTCGGAAAGCATATGCCGCG-3′, Shuffling_Rescue-R: 5′-GACGTCGCATGCAACTAGTAT-3′) binding the cap gene and carrying overlapping ends to pRV plasmids. .. Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2].

    Agarose Gel Electrophoresis:

    Article Title: Pathogenic Leptospira species express surface-exposed proteins belonging to the bacterial immunoglobulin superfamily
    Article Snippet: Approximately 3 μg of DNA was digested with 5–20 units of Nsi I (NEB) overnight in a final volume of 50 μl. .. The double digested DNA was separated in a 0.8% agarose gel at 20 V overnight.

    Article Title: Focused Screening and Treatment (FSAT): A PCR-Based Strategy to Detect Malaria Parasite Carriers and Contain Drug Resistant P. falciparum, Pailin, Cambodia
    Article Snippet: Nested PCRs were performed under the following conditions: heating at 94°C for 5 min, followed by 30 cycles of heating at 94°C for 30 s, 45°C (nested PCR NsiI) or 55°C (nested PCR SspI) for 90 s, and 72°C for 2 min, and a final extension period at 72°C for 10 min. Five µl of nested PCR products adjusted to 500 ng/µl were respectively mixed with 0.2 µl of NsiI and 2.5 µl of buffer 3 (nested PCR NsiI) and with 0.2 µl of SspI and 2.5 µl of buffer 2 (nested PCR SspI) according to the manufacturer's instructions (New England Biolabs®, France), incubated for 4 hours at 37°C and inactivated at 65°C (SspI) or 80°C (NsiI) for 20 minutes. .. Bands were detected by standard 2% agarose gel electrophoresis and ethidium bromide staining.

    Article Title: Retinal pathology and skin barrier defect in mice carrying a Stargardt disease-3 mutation in elongase of very long chain fatty acids-4
    Article Snippet: .. Southern blot analysis of knockin mice Tail DNA samples were digested with Nsi I or Bpu 10I (New England Biolabs, Beverly, MA), separated on an agarose gel, transferred to Hybond N+ membrane (GE Healthcare, Piscataway, NJ), and subjected to Southern blot analysis using P32-labeled DNA probes: a 453-bp 5'-external probe, a 284-bp Neo probe, or a 1.2-kb 3'-internal probe ( ). .. Polymerase chain reaction genotyping of mice After founder mice were characterized by Southern blot analysis, further genotyping of their progenies was performed by PCR using tail DNA.

    In Vitro:

    Article Title: Transcription of Hepatitis B Virus Covalently Closed Circular DNA Is Regulated by CpG Methylation during Chronic Infection
    Article Snippet: Paragraph title: In vitro methylation of HBV CpG islands ... The purified unmethylated CpG island (I–III)-containing DNA PCR fragments were digested by SapI, BbsI and NsiI (New England Biolabs, Ipswich, MA, USA), respectively ( ).

    Ethanol Precipitation:

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2]. .. Ligation reactions were concentrated by using ethanol precipitation, electroporated into SS320 electro-competent bacteria, and grown as described above.

    Spectrophotometry:

    Article Title: A secreted WNT-ligand-binding domain of FZD5 generated by a frameshift mutation causes autosomal dominant coloboma
    Article Snippet: .. Constructs were linearized with NsiI (New England Biolabs) and mRNA was generated using the SP6 mMessage mMachine kit (Ambion). mRNA was purified using YM-50 Microcon columns (Amicon, Millipore) and the concentration was determined through spectrophotometry. .. The mRNA was diluted with dimethyl pyrocarbonate-treated water and injected at a dose of 200 pg into one-cell-stage embryos.

    Produced:

    Article Title: Vector species-specific association between natural Wolbachia infections and avian malaria in black fly populations
    Article Snippet: A few samples were classified as S. urbanum (GenBank: ) by BLAST analysis, but as these sequences were 100% identical to S. cryophilum , for simplicity these samples are referred to as S. cryophilum ) based on an appropriate number of cut sites which resulted in unique sizes of fragments produced per species (as shown in Supplementary Table ). .. Each 20 µl reaction contained 2.0 µl of PCR product (1/10 of COI gene PCR), 4 units of NheI, 4 units of NsiI (both enzymes supplied by NEB), and 1× NEB buffer 2.1 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 μg/ml BSA, pH 7.9 at 25 °C).

    Concentration Assay:

    Article Title: A secreted WNT-ligand-binding domain of FZD5 generated by a frameshift mutation causes autosomal dominant coloboma
    Article Snippet: .. Constructs were linearized with NsiI (New England Biolabs) and mRNA was generated using the SP6 mMessage mMachine kit (Ambion). mRNA was purified using YM-50 Microcon columns (Amicon, Millipore) and the concentration was determined through spectrophotometry. .. The mRNA was diluted with dimethyl pyrocarbonate-treated water and injected at a dose of 200 pg into one-cell-stage embryos.

    Staining:

    Article Title: Focused Screening and Treatment (FSAT): A PCR-Based Strategy to Detect Malaria Parasite Carriers and Contain Drug Resistant P. falciparum, Pailin, Cambodia
    Article Snippet: Nested PCRs were performed under the following conditions: heating at 94°C for 5 min, followed by 30 cycles of heating at 94°C for 30 s, 45°C (nested PCR NsiI) or 55°C (nested PCR SspI) for 90 s, and 72°C for 2 min, and a final extension period at 72°C for 10 min. Five µl of nested PCR products adjusted to 500 ng/µl were respectively mixed with 0.2 µl of NsiI and 2.5 µl of buffer 3 (nested PCR NsiI) and with 0.2 µl of SspI and 2.5 µl of buffer 2 (nested PCR SspI) according to the manufacturer's instructions (New England Biolabs®, France), incubated for 4 hours at 37°C and inactivated at 65°C (SspI) or 80°C (NsiI) for 20 minutes. .. Bands were detected by standard 2% agarose gel electrophoresis and ethidium bromide staining.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs nsii
    Nsii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 29 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nsii/product/New England Biolabs
    Average 99 stars, based on 29 article reviews
    Price from $9.99 to $1999.99
    nsii - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results