phosphorylated hairpin linker ig dmr hp  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88
    Name:
    SpeI
    Description:
    SpeI 2 500 units
    Catalog Number:
    r0133l
    Price:
    282
    Size:
    2 500 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs phosphorylated hairpin linker ig dmr hp
    SpeI
    SpeI 2 500 units
    https://www.bioz.com/result/phosphorylated hairpin linker ig dmr hp/product/New England Biolabs
    Average 88 stars, based on 27 article reviews
    Price from $9.99 to $1999.99
    phosphorylated hairpin linker ig dmr hp - by Bioz Stars, 2020-03
    88/100 stars

    Images

    1) Product Images from "Asymmetric DNA methylation of CpG dyads is a feature of secondary DMRs associated with the Dlk1/Gtl2 imprinting cluster in mouse"

    Article Title: Asymmetric DNA methylation of CpG dyads is a feature of secondary DMRs associated with the Dlk1/Gtl2 imprinting cluster in mouse

    Journal: Epigenetics & Chromatin

    doi: 10.1186/s13072-017-0138-0

    DNA methylation in the 5′ portion of the Gtl2 -DMR displays a high level of hemimethylation. Bisulfite mutagenesis and sequencing of F 1 hybrid DNA derived from 7.5 d.p.c. B6 × CAST embryos, 14.5 d.p.c. B6 × CAST12 embryos, 5 d.p.p. B6 × CAST12 liver and adult B6 × CAST12 liver. Individual circles in each row represent one of the 11 potentially methylated CpG dinucleotides analyzed, and each paired row of circles represents the complementary strands of an individual subclone; semicircles to the right indicate the location of the linker connecting the complementary strands. Filled circles represent methylated cytosines, open circles represent unmethylated cytosines, and absent circles represent ambiguous data. Labels to the left identify the PCR subclone analyzed; letters represent independent amplification reactions, while numbers represent individual subclones. Subclones derived from the same amplification that have identical sequence and methylation patterns are grouped together, as it was not possible to determine whether these amplicons were derived from the same or different template molecules
    Figure Legend Snippet: DNA methylation in the 5′ portion of the Gtl2 -DMR displays a high level of hemimethylation. Bisulfite mutagenesis and sequencing of F 1 hybrid DNA derived from 7.5 d.p.c. B6 × CAST embryos, 14.5 d.p.c. B6 × CAST12 embryos, 5 d.p.p. B6 × CAST12 liver and adult B6 × CAST12 liver. Individual circles in each row represent one of the 11 potentially methylated CpG dinucleotides analyzed, and each paired row of circles represents the complementary strands of an individual subclone; semicircles to the right indicate the location of the linker connecting the complementary strands. Filled circles represent methylated cytosines, open circles represent unmethylated cytosines, and absent circles represent ambiguous data. Labels to the left identify the PCR subclone analyzed; letters represent independent amplification reactions, while numbers represent individual subclones. Subclones derived from the same amplification that have identical sequence and methylation patterns are grouped together, as it was not possible to determine whether these amplicons were derived from the same or different template molecules

    Techniques Used: DNA Methylation Assay, Mutagenesis, Sequencing, Derivative Assay, Methylation, Polymerase Chain Reaction, Amplification

    DNA methylation in the 3′ portion of the Gtl2 -DMR displays a high level of hemimethylation. Details as described in Fig. 2 , with the following exceptions: semicircles indicating the location of the linker connecting the complementary strands are on the left and labels identifying PCR subclones analyzed are on the right . The bias in amplification of paternal versus maternal strands was inconsistent and was not dependent on developmental stage nor F 1 hybrid genetic background
    Figure Legend Snippet: DNA methylation in the 3′ portion of the Gtl2 -DMR displays a high level of hemimethylation. Details as described in Fig. 2 , with the following exceptions: semicircles indicating the location of the linker connecting the complementary strands are on the left and labels identifying PCR subclones analyzed are on the right . The bias in amplification of paternal versus maternal strands was inconsistent and was not dependent on developmental stage nor F 1 hybrid genetic background

    Techniques Used: DNA Methylation Assay, Polymerase Chain Reaction, Amplification

    Hemimethylation levels are higher at the Dlk1 - and Gtl2 - secondary DMRs than at the primary IG-DMR. a Hemimethylation levels at the Dlk1 -, IG- and Gtl2 -DMRs in DNA from 7.5 and 14.5 d.p.c. embryos and from 5 d.p.p. and adult liver. b Across development, average hemimethylation levels at the IG-DMR are less than 8.5%, while hemimethylation averages range from 22 to 34% at the Dlk1 - and Gtl2 -DMRs. Error bars represent the 95% confidence interval
    Figure Legend Snippet: Hemimethylation levels are higher at the Dlk1 - and Gtl2 - secondary DMRs than at the primary IG-DMR. a Hemimethylation levels at the Dlk1 -, IG- and Gtl2 -DMRs in DNA from 7.5 and 14.5 d.p.c. embryos and from 5 d.p.p. and adult liver. b Across development, average hemimethylation levels at the IG-DMR are less than 8.5%, while hemimethylation averages range from 22 to 34% at the Dlk1 - and Gtl2 -DMRs. Error bars represent the 95% confidence interval

    Techniques Used:

    2) Product Images from "Asymmetric DNA methylation of CpG dyads is a feature of secondary DMRs associated with the Dlk1/Gtl2 imprinting cluster in mouse"

    Article Title: Asymmetric DNA methylation of CpG dyads is a feature of secondary DMRs associated with the Dlk1/Gtl2 imprinting cluster in mouse

    Journal: Epigenetics & Chromatin

    doi: 10.1186/s13072-017-0138-0

    DNA methylation in the 5′ portion of the Gtl2 -DMR displays a high level of hemimethylation. Bisulfite mutagenesis and sequencing of F 1 hybrid DNA derived from 7.5 d.p.c. B6 × CAST embryos, 14.5 d.p.c. B6 × CAST12 embryos, 5 d.p.p. B6 × CAST12 liver and adult B6 × CAST12 liver. Individual circles in each row represent one of the 11 potentially methylated CpG dinucleotides analyzed, and each paired row of circles represents the complementary strands of an individual subclone; semicircles to the right indicate the location of the linker connecting the complementary strands. Filled circles represent methylated cytosines, open circles represent unmethylated cytosines, and absent circles represent ambiguous data. Labels to the left identify the PCR subclone analyzed; letters represent independent amplification reactions, while numbers represent individual subclones. Subclones derived from the same amplification that have identical sequence and methylation patterns are grouped together, as it was not possible to determine whether these amplicons were derived from the same or different template molecules
    Figure Legend Snippet: DNA methylation in the 5′ portion of the Gtl2 -DMR displays a high level of hemimethylation. Bisulfite mutagenesis and sequencing of F 1 hybrid DNA derived from 7.5 d.p.c. B6 × CAST embryos, 14.5 d.p.c. B6 × CAST12 embryos, 5 d.p.p. B6 × CAST12 liver and adult B6 × CAST12 liver. Individual circles in each row represent one of the 11 potentially methylated CpG dinucleotides analyzed, and each paired row of circles represents the complementary strands of an individual subclone; semicircles to the right indicate the location of the linker connecting the complementary strands. Filled circles represent methylated cytosines, open circles represent unmethylated cytosines, and absent circles represent ambiguous data. Labels to the left identify the PCR subclone analyzed; letters represent independent amplification reactions, while numbers represent individual subclones. Subclones derived from the same amplification that have identical sequence and methylation patterns are grouped together, as it was not possible to determine whether these amplicons were derived from the same or different template molecules

    Techniques Used: DNA Methylation Assay, Mutagenesis, Sequencing, Derivative Assay, Methylation, Polymerase Chain Reaction, Amplification

    DNA methylation at the IG-DMR displays low levels of hemimethylation. Details as described in Fig. 2 , with the following exceptions: individual circles in each row represent one of the 22 potentially methylated CpG dinucleotides analyzed, semicircles indicating the location of the linker connecting the complementary strands are on the left and labels identifying PCR subclones analyzed are on the right
    Figure Legend Snippet: DNA methylation at the IG-DMR displays low levels of hemimethylation. Details as described in Fig. 2 , with the following exceptions: individual circles in each row represent one of the 22 potentially methylated CpG dinucleotides analyzed, semicircles indicating the location of the linker connecting the complementary strands are on the left and labels identifying PCR subclones analyzed are on the right

    Techniques Used: DNA Methylation Assay, Methylation, Polymerase Chain Reaction

    DNA methylation in the 3′ portion of the Gtl2 -DMR displays a high level of hemimethylation. Details as described in Fig. 2 , with the following exceptions: semicircles indicating the location of the linker connecting the complementary strands are on the left and labels identifying PCR subclones analyzed are on the right . The bias in amplification of paternal versus maternal strands was inconsistent and was not dependent on developmental stage nor F 1 hybrid genetic background
    Figure Legend Snippet: DNA methylation in the 3′ portion of the Gtl2 -DMR displays a high level of hemimethylation. Details as described in Fig. 2 , with the following exceptions: semicircles indicating the location of the linker connecting the complementary strands are on the left and labels identifying PCR subclones analyzed are on the right . The bias in amplification of paternal versus maternal strands was inconsistent and was not dependent on developmental stage nor F 1 hybrid genetic background

    Techniques Used: DNA Methylation Assay, Polymerase Chain Reaction, Amplification

    Hemimethylation levels are higher at the Dlk1 - and Gtl2 - secondary DMRs than at the primary IG-DMR. a Hemimethylation levels at the Dlk1 -, IG- and Gtl2 -DMRs in DNA from 7.5 and 14.5 d.p.c. embryos and from 5 d.p.p. and adult liver. b Across development, average hemimethylation levels at the IG-DMR are less than 8.5%, while hemimethylation averages range from 22 to 34% at the Dlk1 - and Gtl2 -DMRs. Error bars represent the 95% confidence interval
    Figure Legend Snippet: Hemimethylation levels are higher at the Dlk1 - and Gtl2 - secondary DMRs than at the primary IG-DMR. a Hemimethylation levels at the Dlk1 -, IG- and Gtl2 -DMRs in DNA from 7.5 and 14.5 d.p.c. embryos and from 5 d.p.p. and adult liver. b Across development, average hemimethylation levels at the IG-DMR are less than 8.5%, while hemimethylation averages range from 22 to 34% at the Dlk1 - and Gtl2 -DMRs. Error bars represent the 95% confidence interval

    Techniques Used:

    3) Product Images from "Asymmetric DNA methylation of CpG dyads is a feature of secondary DMRs associated with the Dlk1/Gtl2 imprinting cluster in mouse"

    Article Title: Asymmetric DNA methylation of CpG dyads is a feature of secondary DMRs associated with the Dlk1/Gtl2 imprinting cluster in mouse

    Journal: Epigenetics & Chromatin

    doi: 10.1186/s13072-017-0138-0

    DNA methylation in the 5′ portion of the Gtl2 -DMR displays a high level of hemimethylation. Bisulfite mutagenesis and sequencing of F 1 hybrid DNA derived from 7.5 d.p.c. B6 × CAST embryos, 14.5 d.p.c. B6 × CAST12 embryos, 5 d.p.p. B6 × CAST12 liver and adult B6 × CAST12 liver. Individual circles in each row represent one of the 11 potentially methylated CpG dinucleotides analyzed, and each paired row of circles represents the complementary strands of an individual subclone; semicircles to the right indicate the location of the linker connecting the complementary strands. Filled circles represent methylated cytosines, open circles represent unmethylated cytosines, and absent circles represent ambiguous data. Labels to the left identify the PCR subclone analyzed; letters represent independent amplification reactions, while numbers represent individual subclones. Subclones derived from the same amplification that have identical sequence and methylation patterns are grouped together, as it was not possible to determine whether these amplicons were derived from the same or different template molecules
    Figure Legend Snippet: DNA methylation in the 5′ portion of the Gtl2 -DMR displays a high level of hemimethylation. Bisulfite mutagenesis and sequencing of F 1 hybrid DNA derived from 7.5 d.p.c. B6 × CAST embryos, 14.5 d.p.c. B6 × CAST12 embryos, 5 d.p.p. B6 × CAST12 liver and adult B6 × CAST12 liver. Individual circles in each row represent one of the 11 potentially methylated CpG dinucleotides analyzed, and each paired row of circles represents the complementary strands of an individual subclone; semicircles to the right indicate the location of the linker connecting the complementary strands. Filled circles represent methylated cytosines, open circles represent unmethylated cytosines, and absent circles represent ambiguous data. Labels to the left identify the PCR subclone analyzed; letters represent independent amplification reactions, while numbers represent individual subclones. Subclones derived from the same amplification that have identical sequence and methylation patterns are grouped together, as it was not possible to determine whether these amplicons were derived from the same or different template molecules

    Techniques Used: DNA Methylation Assay, Mutagenesis, Sequencing, Derivative Assay, Methylation, Polymerase Chain Reaction, Amplification

    DNA methylation in the 3′ portion of the Gtl2 -DMR displays a high level of hemimethylation. Details as described in Fig. 2 , with the following exceptions: semicircles indicating the location of the linker connecting the complementary strands are on the left and labels identifying PCR subclones analyzed are on the right . The bias in amplification of paternal versus maternal strands was inconsistent and was not dependent on developmental stage nor F 1 hybrid genetic background
    Figure Legend Snippet: DNA methylation in the 3′ portion of the Gtl2 -DMR displays a high level of hemimethylation. Details as described in Fig. 2 , with the following exceptions: semicircles indicating the location of the linker connecting the complementary strands are on the left and labels identifying PCR subclones analyzed are on the right . The bias in amplification of paternal versus maternal strands was inconsistent and was not dependent on developmental stage nor F 1 hybrid genetic background

    Techniques Used: DNA Methylation Assay, Polymerase Chain Reaction, Amplification

    Hemimethylation levels are higher at the Dlk1 - and Gtl2 - secondary DMRs than at the primary IG-DMR. a Hemimethylation levels at the Dlk1 -, IG- and Gtl2 -DMRs in DNA from 7.5 and 14.5 d.p.c. embryos and from 5 d.p.p. and adult liver. b Across development, average hemimethylation levels at the IG-DMR are less than 8.5%, while hemimethylation averages range from 22 to 34% at the Dlk1 - and Gtl2 -DMRs. Error bars represent the 95% confidence interval
    Figure Legend Snippet: Hemimethylation levels are higher at the Dlk1 - and Gtl2 - secondary DMRs than at the primary IG-DMR. a Hemimethylation levels at the Dlk1 -, IG- and Gtl2 -DMRs in DNA from 7.5 and 14.5 d.p.c. embryos and from 5 d.p.p. and adult liver. b Across development, average hemimethylation levels at the IG-DMR are less than 8.5%, while hemimethylation averages range from 22 to 34% at the Dlk1 - and Gtl2 -DMRs. Error bars represent the 95% confidence interval

    Techniques Used:

    Related Articles

    Clone Assay:

    Article Title: vLIP, a Viral Lipase Homologue, Is a Virulence Factor of Marek's Disease Virus
    Article Snippet: The PCR product was then cloned into pCR2.1-TopoTA (Invitrogen) and sequenced (Cornell BioResource Center). .. In order to construct a shuttle vector to incorporate an in-frame deletion of amino acids 256 to 428 of the vLIP open reading frame, a 519-bp fragment was released from the pEco4.268 plasmid using MluI and SpeI, and overhangs were filled in using T4 DNA polymerase (NEB).

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: .. DNA from selected recombinant clones was digested with the restriction enzyme, Spe I (NEB Cat:R0133) and homologous recombination was confirmed by Southern hybridization. ..

    Article Title: A Nucleolus-Predominant piggyBac Transposase, NP-mPB, Mediates Elevated Transposition Efficiency in Mammalian Cells
    Article Snippet: .. To generate the pTriEx-NP-mPB transposase construct, the coding sequence of the mPB was cloned into the pTriEX-HTNC plasmid by replacing the Cre-encoding sequence restricted by Spe I and Xho I (New England Biolabs Inc., Ipswich, MA, USA). .. The pTriEX-mPB vector was constructed by removing the NP-encoding sequence from pTriEX-NP-mPB .

    Article Title: A streamlined method for the design and cloning of shRNAs into an optimized Dox-inducible lentiviral vector
    Article Snippet: Restriction enzyme digest screen Clones were minipreped by alkaline lysis. .. DNA was digested using the SpeI restriction enzyme (NEB).

    Centrifugation:

    Article Title: Inducible ?-Lactam Resistance in Aeromonas hydrophila: Therapeutic Challenge for Antimicrobial Therapy
    Article Snippet: The beads were incubated overnight at 40 to 45°C in solution C (1% sarcosyl, 0.4 M EDTA, 0.1 mg of protease K per ml), harvested by centrifugation, and resuspended in 15 ml of TE buffer (pH 8.0) containing 1 mM phenylmethylsulfonly fluoride and incubated for 2 h at room temperature with gentle shaking. .. The agarose beads were digested with 10 U of Spe I (New Englands Biolabs) for 18 h and were electrophoresed through a 1% agarose gel in TBE buffer at 8°C by using the contour-clamped homogeneous electric field system (Pulsaphor plus; Pharmacia LKB Biotechnology, Uppsala, Sweden).

    Amplification:

    Article Title: Comparison between single and multi-locus approaches for specimen identification in Mytilus mussels
    Article Snippet: All experiments included a negative control (with no template DNA added) and a positive control consisting of template DNA that was previously extracted and successfully amplified by conventional PCR with Me15-16 . .. Triple digestion with EcoR V, Nhe I and Spe I (New England Biolabs) was performed in the same reaction using 10, 5 and 5 units of each enzyme, respectively, with 1x NEB2 buffer.

    Positive Control:

    Article Title: Comparison between single and multi-locus approaches for specimen identification in Mytilus mussels
    Article Snippet: All experiments included a negative control (with no template DNA added) and a positive control consisting of template DNA that was previously extracted and successfully amplified by conventional PCR with Me15-16 . .. Triple digestion with EcoR V, Nhe I and Spe I (New England Biolabs) was performed in the same reaction using 10, 5 and 5 units of each enzyme, respectively, with 1x NEB2 buffer.

    Lambda DNA Preparation:

    Article Title: Chromosomal Integration of a Cephalosporinase Gene from Acinetobacter baumannii into Oligella urethralis as a Source of Acquired Resistance to ?-Lactams
    Article Snippet: Macrorestriction analysis of whole-cell DNA of O. urethralis COH-1 was done by the pulsed-field gel electrophoresis (PFGE) technique with Xba I, Spe I, Dra I, Apa I, and Sfi I (New England Biolabs), as reported previously ( , ). .. The sizes of the fragments generated with Ceu I fragment I were determined by comparison with those of a bacteriophage lambda DNA molecular weight marker (Bio-Rad).

    Article Title: Inducible ?-Lactam Resistance in Aeromonas hydrophila: Therapeutic Challenge for Antimicrobial Therapy
    Article Snippet: The agarose beads were digested with 10 U of Spe I (New Englands Biolabs) for 18 h and were electrophoresed through a 1% agarose gel in TBE buffer at 8°C by using the contour-clamped homogeneous electric field system (Pulsaphor plus; Pharmacia LKB Biotechnology, Uppsala, Sweden). .. Bacteriophage lambda DNA concatemers (Gibco BRL, Gaithersburg, Md.) were used as size standards.

    Construct:

    Article Title: vLIP, a Viral Lipase Homologue, Is a Virulence Factor of Marek's Disease Virus
    Article Snippet: .. In order to construct a shuttle vector to incorporate an in-frame deletion of amino acids 256 to 428 of the vLIP open reading frame, a 519-bp fragment was released from the pEco4.268 plasmid using MluI and SpeI, and overhangs were filled in using T4 DNA polymerase (NEB). .. Finally, the plasmid was closed using T4 DNA ligase (NEB) and transformed into Escherichia coli .

    Article Title: A Nucleolus-Predominant piggyBac Transposase, NP-mPB, Mediates Elevated Transposition Efficiency in Mammalian Cells
    Article Snippet: .. To generate the pTriEx-NP-mPB transposase construct, the coding sequence of the mPB was cloned into the pTriEX-HTNC plasmid by replacing the Cre-encoding sequence restricted by Spe I and Xho I (New England Biolabs Inc., Ipswich, MA, USA). .. The pTriEX-mPB vector was constructed by removing the NP-encoding sequence from pTriEX-NP-mPB .

    Article Title: Soluble L1CAM promotes breast cancer cell adhesion and migration in vitro, but not invasion
    Article Snippet: The following primers with SpeI or XhoI (NEB, Ipswich, MA) cleavage sites were used to amplify the sequence: sense, 5'-GAAACTAGTCGCCGGGAAAG-3'; antisense, 5'- GCCTCGAGGAGGGAGCC- 3'. .. Constructs obtained were both confirmed by DNA sequencing and used to make virus to infect MDA-MB-468 cells.

    Electrophoresis:

    Article Title: Genetic Diversity among Strains of Moraxella catarrhalis: Analysis Using Multiple DNA Probes and a Single-Locus PCR-Restriction Fragment Length Polymorphism Method
    Article Snippet: For restriction endonuclease digestion, an 80-μl agarose plug containing DNA was placed into restriction enzyme buffer containing 100 mg of acetylated bovine serum albumin and 12 U of Spe I (New England Biolabs, Beverly, Mass.) and incubated overnight at 37°C. .. Electrophoresis was performed with the contour-clamped homogeneous gel electrophoresis device (CHEF DR II; Bio-Rad, Richmond, Calif.).

    Article Title: Identification and Detection of Stenotrophomonas maltophilia by rRNA-Directed PCR
    Article Snippet: A 5-mm slice of each plug was digested with 40 U of Spe I (New England Biolabs, Inc., Beverly, Mass.) in 150 μl of reaction buffer at 37°C for 24 h prior to loading in to a 1.0% Pulse Field Certified Agarose (Bio-Rad Laboratories) gel in 0.5× TBE. .. Electrophoresis was performed in a CHEF-DRIII system (Bio-Rad Laboratories) at 14°C.

    Article Title: Chromosomal Integration of a Cephalosporinase Gene from Acinetobacter baumannii into Oligella urethralis as a Source of Acquired Resistance to ?-Lactams
    Article Snippet: Paragraph title: Endonuclease restriction, electrophoresis, and hybridization experiments. ... Macrorestriction analysis of whole-cell DNA of O. urethralis COH-1 was done by the pulsed-field gel electrophoresis (PFGE) technique with Xba I, Spe I, Dra I, Apa I, and Sfi I (New England Biolabs), as reported previously ( , ).

    Article Title: Inducible ?-Lactam Resistance in Aeromonas hydrophila: Therapeutic Challenge for Antimicrobial Therapy
    Article Snippet: The agarose beads were digested with 10 U of Spe I (New Englands Biolabs) for 18 h and were electrophoresed through a 1% agarose gel in TBE buffer at 8°C by using the contour-clamped homogeneous electric field system (Pulsaphor plus; Pharmacia LKB Biotechnology, Uppsala, Sweden). .. The conditions for electrophoresis were 150 V for 30 h, with pulse times ranging from 5 to 35 s. The DNA bands were visualized by staining the gel with ethidium bromide and were photographed.

    Incubation:

    Article Title: Genetic Diversity among Strains of Moraxella catarrhalis: Analysis Using Multiple DNA Probes and a Single-Locus PCR-Restriction Fragment Length Polymorphism Method
    Article Snippet: .. For restriction endonuclease digestion, an 80-μl agarose plug containing DNA was placed into restriction enzyme buffer containing 100 mg of acetylated bovine serum albumin and 12 U of Spe I (New England Biolabs, Beverly, Mass.) and incubated overnight at 37°C. ..

    Article Title: Identification and Detection of Stenotrophomonas maltophilia by rRNA-Directed PCR
    Article Snippet: Following chilling at 4°C for 15 min, the plugs were extruded into sterile PEN buffer (0.5 mM EDTA, 1.0% N -lauroyl sarcosine; pH 9.6) containing 1 mg of Pronase (Roche Molecular Biochemicals, Indianapolis, Ind.) per ml and incubated at 37°C for 24 h. Plugs were washed twice in TE buffer at 4°C for 24 h and three times at room temperature for 1 h with gentle rocking. .. A 5-mm slice of each plug was digested with 40 U of Spe I (New England Biolabs, Inc., Beverly, Mass.) in 150 μl of reaction buffer at 37°C for 24 h prior to loading in to a 1.0% Pulse Field Certified Agarose (Bio-Rad Laboratories) gel in 0.5× TBE.

    Article Title: Inducible ?-Lactam Resistance in Aeromonas hydrophila: Therapeutic Challenge for Antimicrobial Therapy
    Article Snippet: The beads were incubated overnight at 40 to 45°C in solution C (1% sarcosyl, 0.4 M EDTA, 0.1 mg of protease K per ml), harvested by centrifugation, and resuspended in 15 ml of TE buffer (pH 8.0) containing 1 mM phenylmethylsulfonly fluoride and incubated for 2 h at room temperature with gentle shaking. .. The agarose beads were digested with 10 U of Spe I (New Englands Biolabs) for 18 h and were electrophoresed through a 1% agarose gel in TBE buffer at 8°C by using the contour-clamped homogeneous electric field system (Pulsaphor plus; Pharmacia LKB Biotechnology, Uppsala, Sweden).

    Transformation Assay:

    Article Title: vLIP, a Viral Lipase Homologue, Is a Virulence Factor of Marek's Disease Virus
    Article Snippet: In order to construct a shuttle vector to incorporate an in-frame deletion of amino acids 256 to 428 of the vLIP open reading frame, a 519-bp fragment was released from the pEco4.268 plasmid using MluI and SpeI, and overhangs were filled in using T4 DNA polymerase (NEB). .. Finally, the plasmid was closed using T4 DNA ligase (NEB) and transformed into Escherichia coli .

    Derivative Assay:

    Article Title: vLIP, a Viral Lipase Homologue, Is a Virulence Factor of Marek's Disease Virus
    Article Snippet: The pEco4.268 plasmid was originally constructed by inserting the EcoRI 4,268-bp subfragment of the Md5 genome derived from the sn5 cosmid ( ) (a gift of Sanjay Reddy) into pUC18 (Fig. ). .. In order to construct a shuttle vector to incorporate an in-frame deletion of amino acids 256 to 428 of the vLIP open reading frame, a 519-bp fragment was released from the pEco4.268 plasmid using MluI and SpeI, and overhangs were filled in using T4 DNA polymerase (NEB).

    Hybridization:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: .. DNA from selected recombinant clones was digested with the restriction enzyme, Spe I (NEB Cat:R0133) and homologous recombination was confirmed by Southern hybridization. ..

    Article Title: Chromosomal Integration of a Cephalosporinase Gene from Acinetobacter baumannii into Oligella urethralis as a Source of Acquired Resistance to ?-Lactams
    Article Snippet: Paragraph title: Endonuclease restriction, electrophoresis, and hybridization experiments. ... Macrorestriction analysis of whole-cell DNA of O. urethralis COH-1 was done by the pulsed-field gel electrophoresis (PFGE) technique with Xba I, Spe I, Dra I, Apa I, and Sfi I (New England Biolabs), as reported previously ( , ).

    Infection:

    Article Title: Soluble L1CAM promotes breast cancer cell adhesion and migration in vitro, but not invasion
    Article Snippet: Paragraph title: Vector construction and lentivirus infection ... The following primers with SpeI or XhoI (NEB, Ipswich, MA) cleavage sites were used to amplify the sequence: sense, 5'-GAAACTAGTCGCCGGGAAAG-3'; antisense, 5'- GCCTCGAGGAGGGAGCC- 3'.

    Mutagenesis:

    Article Title: vLIP, a Viral Lipase Homologue, Is a Virulence Factor of Marek's Disease Virus
    Article Snippet: In order to construct a shuttle vector to incorporate an in-frame deletion of amino acids 256 to 428 of the vLIP open reading frame, a 519-bp fragment was released from the pEco4.268 plasmid using MluI and SpeI, and overhangs were filled in using T4 DNA polymerase (NEB). .. The 3,307-bp BamHI-PshAI fragment was inserted into pST76K-SR , a vector for performing RecA-based shuttle mutagenesis, which had been opened with BamHI and SmaI.

    Generated:

    Article Title: Chromosomal Integration of a Cephalosporinase Gene from Acinetobacter baumannii into Oligella urethralis as a Source of Acquired Resistance to ?-Lactams
    Article Snippet: Macrorestriction analysis of whole-cell DNA of O. urethralis COH-1 was done by the pulsed-field gel electrophoresis (PFGE) technique with Xba I, Spe I, Dra I, Apa I, and Sfi I (New England Biolabs), as reported previously ( , ). .. The sizes of the fragments generated with Ceu I fragment I were determined by comparison with those of a bacteriophage lambda DNA molecular weight marker (Bio-Rad).

    Article Title: Soluble L1CAM promotes breast cancer cell adhesion and migration in vitro, but not invasion
    Article Snippet: Vector construction and lentivirus infection L1 ectodomain (L1ED) fragment was generated from the pCDNA3-L1 vector kindly provided by Dr. Vance Lemmon (The Miami Project to Cure Paralysis, University of Miami, FL). .. The following primers with SpeI or XhoI (NEB, Ipswich, MA) cleavage sites were used to amplify the sequence: sense, 5'-GAAACTAGTCGCCGGGAAAG-3'; antisense, 5'- GCCTCGAGGAGGGAGCC- 3'.

    DNA Sequencing:

    Article Title: Soluble L1CAM promotes breast cancer cell adhesion and migration in vitro, but not invasion
    Article Snippet: The following primers with SpeI or XhoI (NEB, Ipswich, MA) cleavage sites were used to amplify the sequence: sense, 5'-GAAACTAGTCGCCGGGAAAG-3'; antisense, 5'- GCCTCGAGGAGGGAGCC- 3'. .. Constructs obtained were both confirmed by DNA sequencing and used to make virus to infect MDA-MB-468 cells.

    Polymerase Chain Reaction:

    Article Title: vLIP, a Viral Lipase Homologue, Is a Virulence Factor of Marek's Disease Virus
    Article Snippet: The PCR product was then cloned into pCR2.1-TopoTA (Invitrogen) and sequenced (Cornell BioResource Center). .. In order to construct a shuttle vector to incorporate an in-frame deletion of amino acids 256 to 428 of the vLIP open reading frame, a 519-bp fragment was released from the pEco4.268 plasmid using MluI and SpeI, and overhangs were filled in using T4 DNA polymerase (NEB).

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: Using Q5 High-Fidelity Polymerase with GC Enhancer (NEB Catalog:M0491) and the primers: WT = TCTTAGATTCTGCCCTTTCTGACAG, CKO = CCAAGGAGATGACCACGCATAG, R2 = CTCTTGTAGGGCCTCCTGTG, we performed a PCR to identify recombinant clones. .. DNA from selected recombinant clones was digested with the restriction enzyme, Spe I (NEB Cat:R0133) and homologous recombination was confirmed by Southern hybridization.

    Article Title: Comparison between single and multi-locus approaches for specimen identification in Mytilus mussels
    Article Snippet: Digestion with Aci I (New England Biolabs), Hha I and Xba I (Thermo Scientific) was performed separately in a final volume of 20 μL, using 15 μL of PCR product and 4, 10 and 10 units of each enzyme with 1x NEB4 and Tango buffers, respectively. .. Triple digestion with EcoR V, Nhe I and Spe I (New England Biolabs) was performed in the same reaction using 10, 5 and 5 units of each enzyme, respectively, with 1x NEB2 buffer.

    Recombinant:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: .. DNA from selected recombinant clones was digested with the restriction enzyme, Spe I (NEB Cat:R0133) and homologous recombination was confirmed by Southern hybridization. ..

    Article Title: Comparison between single and multi-locus approaches for specimen identification in Mytilus mussels
    Article Snippet: DNA amplifications were performed in a Techne TC-412 (Bibby Scientific Ltd, UK) thermocycler and Palm-CyclerTM (Corbett Life Science, Australia) with recombinant Taq DNA polymerase (RBC Bioscience® and Thermo Fisher® ) using 40 ng of template DNA in a final volume of 25 μL. .. Triple digestion with EcoR V, Nhe I and Spe I (New England Biolabs) was performed in the same reaction using 10, 5 and 5 units of each enzyme, respectively, with 1x NEB2 buffer.

    Molecular Weight:

    Article Title: Genetic Diversity among Strains of Moraxella catarrhalis: Analysis Using Multiple DNA Probes and a Single-Locus PCR-Restriction Fragment Length Polymorphism Method
    Article Snippet: For restriction endonuclease digestion, an 80-μl agarose plug containing DNA was placed into restriction enzyme buffer containing 100 mg of acetylated bovine serum albumin and 12 U of Spe I (New England Biolabs, Beverly, Mass.) and incubated overnight at 37°C. .. Lambda concatamers (Lambda Ladder PFG marker; New England Biolabs) were used as a molecular weight standard.

    Article Title: Chromosomal Integration of a Cephalosporinase Gene from Acinetobacter baumannii into Oligella urethralis as a Source of Acquired Resistance to ?-Lactams
    Article Snippet: Macrorestriction analysis of whole-cell DNA of O. urethralis COH-1 was done by the pulsed-field gel electrophoresis (PFGE) technique with Xba I, Spe I, Dra I, Apa I, and Sfi I (New England Biolabs), as reported previously ( , ). .. The sizes of the fragments generated with Ceu I fragment I were determined by comparison with those of a bacteriophage lambda DNA molecular weight marker (Bio-Rad).

    Imaging:

    Article Title: Mobilizable Plasmids for Tunable Gene Expression in Francisella novicida
    Article Snippet: The next day, colonies were grown in liquid LB supplemented with 50 μg/ml kanamycin, plasmid DNA was isolated and 250 ng of each plasmid was digested with SacI-HF and SpeI restriction enzymes (New England BioLabs) for 1 h. As control, both plasmids were additionally isolated from E. coli directly, without passaging in F. novicida , and digested identically. .. DNA was stained with RedSafe (iNtRON Biotechnology) and a Red imaging system (Alpha Innotech) was used for imaging.

    Nucleic Acid Electrophoresis:

    Article Title: Genetic Diversity among Strains of Moraxella catarrhalis: Analysis Using Multiple DNA Probes and a Single-Locus PCR-Restriction Fragment Length Polymorphism Method
    Article Snippet: For restriction endonuclease digestion, an 80-μl agarose plug containing DNA was placed into restriction enzyme buffer containing 100 mg of acetylated bovine serum albumin and 12 U of Spe I (New England Biolabs, Beverly, Mass.) and incubated overnight at 37°C. .. Electrophoresis was performed with the contour-clamped homogeneous gel electrophoresis device (CHEF DR II; Bio-Rad, Richmond, Calif.).

    Article Title: Rapid Microarray-Based Genotyping of Enterohemorrhagic Escherichia coli Serotype O156:H25/H-/Hnt Isolates from Cattle and Clonal Relationship Analysis ▿ Serotype O156:H25/H-/Hnt Isolates from Cattle and Clonal Relationship Analysis ▿ †
    Article Snippet: Preparation of genomic DNA for contour-clamped homogeneous electric field-pulsed-field gel electrophoresis (CHEF-PFGE) was done by a protocol described previously ( , , ). .. Slices of the DNA agarose plugs were equilibrated in the respective restriction endonuclease buffer and then digested for 4 h with XbaI, NotI, BlnI (AvrII), or SpeI (New England Biolabs GmbH, Frankfurt am Main, Germany).

    Passaging:

    Article Title: Mobilizable Plasmids for Tunable Gene Expression in Francisella novicida
    Article Snippet: .. The next day, colonies were grown in liquid LB supplemented with 50 μg/ml kanamycin, plasmid DNA was isolated and 250 ng of each plasmid was digested with SacI-HF and SpeI restriction enzymes (New England BioLabs) for 1 h. As control, both plasmids were additionally isolated from E. coli directly, without passaging in F. novicida , and digested identically. .. After heat inactivation of the enzymes (80°C for 20 min), the digested plasmids were loaded on a 1% agarose gel (BioConcept) together with a 1 kb ladder (New England BioLabs).

    Isolation:

    Article Title: Gluconobacter as Well as Asaia Species, Newly Emerging Opportunistic Human Pathogens among Acetic Acid Bacteria ▿ Species, Newly Emerging Opportunistic Human Pathogens among Acetic Acid Bacteria ▿ †
    Article Snippet: The five Gluconobacter sp. strains isolated from patients 1, 2, and 3 were submitted to pulsed-field gel electrophoresis (PFGE) in order to assess whether there was an epidemiological link between the strains. .. Genomic DNAs were prepared in agarose plugs and submitted to SpeI (New England Biolabs, Hertfordshire, United Kingdom) restriction, as described previously ( ).

    Article Title: Mobilizable Plasmids for Tunable Gene Expression in Francisella novicida
    Article Snippet: .. The next day, colonies were grown in liquid LB supplemented with 50 μg/ml kanamycin, plasmid DNA was isolated and 250 ng of each plasmid was digested with SacI-HF and SpeI restriction enzymes (New England BioLabs) for 1 h. As control, both plasmids were additionally isolated from E. coli directly, without passaging in F. novicida , and digested identically. .. After heat inactivation of the enzymes (80°C for 20 min), the digested plasmids were loaded on a 1% agarose gel (BioConcept) together with a 1 kb ladder (New England BioLabs).

    Purification:

    Article Title: Genetic Diversity among Strains of Moraxella catarrhalis: Analysis Using Multiple DNA Probes and a Single-Locus PCR-Restriction Fragment Length Polymorphism Method
    Article Snippet: M. catarrhalis strains were grown overnight at 37°C in brain heart infusion broth, and DNA was purified as described previously ( ). .. For restriction endonuclease digestion, an 80-μl agarose plug containing DNA was placed into restriction enzyme buffer containing 100 mg of acetylated bovine serum albumin and 12 U of Spe I (New England Biolabs, Beverly, Mass.) and incubated overnight at 37°C.

    Article Title: vLIP, a Viral Lipase Homologue, Is a Virulence Factor of Marek's Disease Virus
    Article Snippet: The resulting PCR products were purified by agarose gel electrophoresis and combined in an overlap extension PCR performed using the external primers (LIPFLAGS2 and LIPF2). .. In order to construct a shuttle vector to incorporate an in-frame deletion of amino acids 256 to 428 of the vLIP open reading frame, a 519-bp fragment was released from the pEco4.268 plasmid using MluI and SpeI, and overhangs were filled in using T4 DNA polymerase (NEB).

    Sequencing:

    Article Title: Seven novel mutations in the long isoform of the USH2A gene in Chinese families with nonsyndromic retinitis pigmentosa and Usher syndrome Type II
    Article Snippet: .. Restriction fragment length polymorphism analysis Variations (c.2802T > G, c.8232G > C, c.3788G > A, and c.14403C > G) found in the sequencing were confirmed with the restriction endonucleases Hinc II (TaKaRa, Dalian, China), HpyCH4V, BsaI, and SpeI (New England Biolabs, Ipswich, MA), respectively, which were used in all available family members and in the100 normal controls. .. Single strand conformation polymorphism To validate the variations (c. 1876C > T and c.7123delG) found in the sequencing, a single strand conformation polymorphism (SSCP) analysis was performed in all available family members and in the 100 normal controls.

    Article Title: vLIP, a Viral Lipase Homologue, Is a Virulence Factor of Marek's Disease Virus
    Article Snippet: A sequence-verified clone was digested with BsiWI and ClaI to release a FLAG-tagged fragment of the vLIP cDNA. .. In order to construct a shuttle vector to incorporate an in-frame deletion of amino acids 256 to 428 of the vLIP open reading frame, a 519-bp fragment was released from the pEco4.268 plasmid using MluI and SpeI, and overhangs were filled in using T4 DNA polymerase (NEB).

    Article Title: A Nucleolus-Predominant piggyBac Transposase, NP-mPB, Mediates Elevated Transposition Efficiency in Mammalian Cells
    Article Snippet: .. To generate the pTriEx-NP-mPB transposase construct, the coding sequence of the mPB was cloned into the pTriEX-HTNC plasmid by replacing the Cre-encoding sequence restricted by Spe I and Xho I (New England Biolabs Inc., Ipswich, MA, USA). .. The pTriEX-mPB vector was constructed by removing the NP-encoding sequence from pTriEX-NP-mPB .

    Article Title: Chromosomal Integration of a Cephalosporinase Gene from Acinetobacter baumannii into Oligella urethralis as a Source of Acquired Resistance to ?-Lactams
    Article Snippet: Macrorestriction analysis of whole-cell DNA of O. urethralis COH-1 was done by the pulsed-field gel electrophoresis (PFGE) technique with Xba I, Spe I, Dra I, Apa I, and Sfi I (New England Biolabs), as reported previously ( , ). .. To search for the chromosomal integration of the β-lactamase genes, whole-cell DNA of O. urethralis COH-1 was restricted with Ceu I fragment (New England Biolabs), which recognizes a 26-bp sequence in rrn genes coding for the 23S large-subunit rRNA ( ).

    Article Title: Soluble L1CAM promotes breast cancer cell adhesion and migration in vitro, but not invasion
    Article Snippet: .. The following primers with SpeI or XhoI (NEB, Ipswich, MA) cleavage sites were used to amplify the sequence: sense, 5'-GAAACTAGTCGCCGGGAAAG-3'; antisense, 5'- GCCTCGAGGAGGGAGCC- 3'. .. The resulting 3350bp L1ED was then inserted into a lentivirus vector (Lvv 1879; provided by Dr. John C. Kappes, Univ. of Alabama, Birmingham) containing a CMV promoter.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Comparison between single and multi-locus approaches for specimen identification in Mytilus mussels
    Article Snippet: Triple digestion with EcoR V, Nhe I and Spe I (New England Biolabs) was performed in the same reaction using 10, 5 and 5 units of each enzyme, respectively, with 1x NEB2 buffer. .. The size of amplified fragments resolved in PAGE was obtained by log-linear interpolation of the 10 bp DNA ladder (Invitrogen® ) or HyperLadder V (Bioline® ) on the gel.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: .. DNA from selected recombinant clones was digested with the restriction enzyme, Spe I (NEB Cat:R0133) and homologous recombination was confirmed by Southern hybridization. ..

    Plasmid Preparation:

    Article Title: vLIP, a Viral Lipase Homologue, Is a Virulence Factor of Marek's Disease Virus
    Article Snippet: .. In order to construct a shuttle vector to incorporate an in-frame deletion of amino acids 256 to 428 of the vLIP open reading frame, a 519-bp fragment was released from the pEco4.268 plasmid using MluI and SpeI, and overhangs were filled in using T4 DNA polymerase (NEB). .. Finally, the plasmid was closed using T4 DNA ligase (NEB) and transformed into Escherichia coli .

    Article Title: Mobilizable Plasmids for Tunable Gene Expression in Francisella novicida
    Article Snippet: .. The next day, colonies were grown in liquid LB supplemented with 50 μg/ml kanamycin, plasmid DNA was isolated and 250 ng of each plasmid was digested with SacI-HF and SpeI restriction enzymes (New England BioLabs) for 1 h. As control, both plasmids were additionally isolated from E. coli directly, without passaging in F. novicida , and digested identically. .. After heat inactivation of the enzymes (80°C for 20 min), the digested plasmids were loaded on a 1% agarose gel (BioConcept) together with a 1 kb ladder (New England BioLabs).

    Article Title: A Nucleolus-Predominant piggyBac Transposase, NP-mPB, Mediates Elevated Transposition Efficiency in Mammalian Cells
    Article Snippet: .. To generate the pTriEx-NP-mPB transposase construct, the coding sequence of the mPB was cloned into the pTriEX-HTNC plasmid by replacing the Cre-encoding sequence restricted by Spe I and Xho I (New England Biolabs Inc., Ipswich, MA, USA). .. The pTriEX-mPB vector was constructed by removing the NP-encoding sequence from pTriEX-NP-mPB .

    Article Title: Soluble L1CAM promotes breast cancer cell adhesion and migration in vitro, but not invasion
    Article Snippet: Paragraph title: Vector construction and lentivirus infection ... The following primers with SpeI or XhoI (NEB, Ipswich, MA) cleavage sites were used to amplify the sequence: sense, 5'-GAAACTAGTCGCCGGGAAAG-3'; antisense, 5'- GCCTCGAGGAGGGAGCC- 3'.

    Negative Control:

    Article Title: Comparison between single and multi-locus approaches for specimen identification in Mytilus mussels
    Article Snippet: All experiments included a negative control (with no template DNA added) and a positive control consisting of template DNA that was previously extracted and successfully amplified by conventional PCR with Me15-16 . .. Triple digestion with EcoR V, Nhe I and Spe I (New England Biolabs) was performed in the same reaction using 10, 5 and 5 units of each enzyme, respectively, with 1x NEB2 buffer.

    Article Title: Soluble L1CAM promotes breast cancer cell adhesion and migration in vitro, but not invasion
    Article Snippet: The following primers with SpeI or XhoI (NEB, Ipswich, MA) cleavage sites were used to amplify the sequence: sense, 5'-GAAACTAGTCGCCGGGAAAG-3'; antisense, 5'- GCCTCGAGGAGGGAGCC- 3'. .. Empty Lvv 1879 vector served as a negative control.

    Agarose Gel Electrophoresis:

    Article Title: Gluconobacter as Well as Asaia Species, Newly Emerging Opportunistic Human Pathogens among Acetic Acid Bacteria ▿ Species, Newly Emerging Opportunistic Human Pathogens among Acetic Acid Bacteria ▿ †
    Article Snippet: Genomic DNAs were prepared in agarose plugs and submitted to SpeI (New England Biolabs, Hertfordshire, United Kingdom) restriction, as described previously ( ). .. SpeI fragments were separated by PFGE using a contour-clamped homogeneous electric field apparatus (CHEF-DRII; Bio-Rad, Hercules, CA) in a 1% agarose gel in 0.5× Tris-borate-EDTA buffer (TBE) at 10°C.

    Article Title: vLIP, a Viral Lipase Homologue, Is a Virulence Factor of Marek's Disease Virus
    Article Snippet: The resulting PCR products were purified by agarose gel electrophoresis and combined in an overlap extension PCR performed using the external primers (LIPFLAGS2 and LIPF2). .. In order to construct a shuttle vector to incorporate an in-frame deletion of amino acids 256 to 428 of the vLIP open reading frame, a 519-bp fragment was released from the pEco4.268 plasmid using MluI and SpeI, and overhangs were filled in using T4 DNA polymerase (NEB).

    Article Title: Mobilizable Plasmids for Tunable Gene Expression in Francisella novicida
    Article Snippet: The next day, colonies were grown in liquid LB supplemented with 50 μg/ml kanamycin, plasmid DNA was isolated and 250 ng of each plasmid was digested with SacI-HF and SpeI restriction enzymes (New England BioLabs) for 1 h. As control, both plasmids were additionally isolated from E. coli directly, without passaging in F. novicida , and digested identically. .. After heat inactivation of the enzymes (80°C for 20 min), the digested plasmids were loaded on a 1% agarose gel (BioConcept) together with a 1 kb ladder (New England BioLabs).

    Article Title: Inducible ?-Lactam Resistance in Aeromonas hydrophila: Therapeutic Challenge for Antimicrobial Therapy
    Article Snippet: .. The agarose beads were digested with 10 U of Spe I (New Englands Biolabs) for 18 h and were electrophoresed through a 1% agarose gel in TBE buffer at 8°C by using the contour-clamped homogeneous electric field system (Pulsaphor plus; Pharmacia LKB Biotechnology, Uppsala, Sweden). .. The conditions for electrophoresis were 150 V for 30 h, with pulse times ranging from 5 to 35 s. The DNA bands were visualized by staining the gel with ethidium bromide and were photographed.

    Article Title: A streamlined method for the design and cloning of shRNAs into an optimized Dox-inducible lentiviral vector
    Article Snippet: DNA was digested using the SpeI restriction enzyme (NEB). .. Digest reaction (10–20 μL) was then run out on a 2% agarose gel.

    Knock-Out:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: DNA from selected recombinant clones was digested with the restriction enzyme, Spe I (NEB Cat:R0133) and homologous recombination was confirmed by Southern hybridization. .. The expected band sizes for wild type and conditional knockout alleles are 18,162 bps and 14,333 bps, respectively.

    Alkaline Lysis:

    Article Title: A streamlined method for the design and cloning of shRNAs into an optimized Dox-inducible lentiviral vector
    Article Snippet: Restriction enzyme digest screen Clones were minipreped by alkaline lysis. .. DNA was digested using the SpeI restriction enzyme (NEB).

    Multiple Displacement Amplification:

    Article Title: Soluble L1CAM promotes breast cancer cell adhesion and migration in vitro, but not invasion
    Article Snippet: The following primers with SpeI or XhoI (NEB, Ipswich, MA) cleavage sites were used to amplify the sequence: sense, 5'-GAAACTAGTCGCCGGGAAAG-3'; antisense, 5'- GCCTCGAGGAGGGAGCC- 3'. .. Constructs obtained were both confirmed by DNA sequencing and used to make virus to infect MDA-MB-468 cells.

    Pulsed-Field Gel:

    Article Title: Gluconobacter as Well as Asaia Species, Newly Emerging Opportunistic Human Pathogens among Acetic Acid Bacteria ▿ Species, Newly Emerging Opportunistic Human Pathogens among Acetic Acid Bacteria ▿ †
    Article Snippet: The five Gluconobacter sp. strains isolated from patients 1, 2, and 3 were submitted to pulsed-field gel electrophoresis (PFGE) in order to assess whether there was an epidemiological link between the strains. .. Genomic DNAs were prepared in agarose plugs and submitted to SpeI (New England Biolabs, Hertfordshire, United Kingdom) restriction, as described previously ( ).

    Article Title: Identification and Detection of Stenotrophomonas maltophilia by rRNA-Directed PCR
    Article Snippet: Paragraph title: Pulsed-field gel electrophoresis (PFGE). ... A 5-mm slice of each plug was digested with 40 U of Spe I (New England Biolabs, Inc., Beverly, Mass.) in 150 μl of reaction buffer at 37°C for 24 h prior to loading in to a 1.0% Pulse Field Certified Agarose (Bio-Rad Laboratories) gel in 0.5× TBE.

    Article Title: Metallo-?-Lactamases in Clinical Pseudomonas Isolates in Taiwan and Identification of VIM-3, a Novel Variant of the VIM-2 Enzyme
    Article Snippet: .. Genomic DNAs prepared by the procedure of Piggot et al. ( ) were digested overnight with 10 U of Spe I (New England Biolabs, Beverly, Mass.) and subjected to pulsed-field gel electrophoresis (PFGE) as described elsewhere ( , ). .. The samples were electrophoresed with the Pulsaphor plus system (Amersham Pharmacia Biotech) at 200 V for 30 h, with pulse times ranging from 5 to 30 s.

    Article Title: Chromosomal Integration of a Cephalosporinase Gene from Acinetobacter baumannii into Oligella urethralis as a Source of Acquired Resistance to ?-Lactams
    Article Snippet: .. Macrorestriction analysis of whole-cell DNA of O. urethralis COH-1 was done by the pulsed-field gel electrophoresis (PFGE) technique with Xba I, Spe I, Dra I, Apa I, and Sfi I (New England Biolabs), as reported previously ( , ). .. To search for the chromosomal integration of the β-lactamase genes, whole-cell DNA of O. urethralis COH-1 was restricted with Ceu I fragment (New England Biolabs), which recognizes a 26-bp sequence in rrn genes coding for the 23S large-subunit rRNA ( ).

    Marker:

    Article Title: Genetic Diversity among Strains of Moraxella catarrhalis: Analysis Using Multiple DNA Probes and a Single-Locus PCR-Restriction Fragment Length Polymorphism Method
    Article Snippet: For restriction endonuclease digestion, an 80-μl agarose plug containing DNA was placed into restriction enzyme buffer containing 100 mg of acetylated bovine serum albumin and 12 U of Spe I (New England Biolabs, Beverly, Mass.) and incubated overnight at 37°C. .. Lambda concatamers (Lambda Ladder PFG marker; New England Biolabs) were used as a molecular weight standard.

    Article Title: Chromosomal Integration of a Cephalosporinase Gene from Acinetobacter baumannii into Oligella urethralis as a Source of Acquired Resistance to ?-Lactams
    Article Snippet: Macrorestriction analysis of whole-cell DNA of O. urethralis COH-1 was done by the pulsed-field gel electrophoresis (PFGE) technique with Xba I, Spe I, Dra I, Apa I, and Sfi I (New England Biolabs), as reported previously ( , ). .. The sizes of the fragments generated with Ceu I fragment I were determined by comparison with those of a bacteriophage lambda DNA molecular weight marker (Bio-Rad).

    Article Title: Comparison between single and multi-locus approaches for specimen identification in Mytilus mussels
    Article Snippet: Details regarding the PCR reaction conditions and amplification profiles for each marker are shown in Table . .. Triple digestion with EcoR V, Nhe I and Spe I (New England Biolabs) was performed in the same reaction using 10, 5 and 5 units of each enzyme, respectively, with 1x NEB2 buffer.

    Staining:

    Article Title: Mobilizable Plasmids for Tunable Gene Expression in Francisella novicida
    Article Snippet: The next day, colonies were grown in liquid LB supplemented with 50 μg/ml kanamycin, plasmid DNA was isolated and 250 ng of each plasmid was digested with SacI-HF and SpeI restriction enzymes (New England BioLabs) for 1 h. As control, both plasmids were additionally isolated from E. coli directly, without passaging in F. novicida , and digested identically. .. DNA was stained with RedSafe (iNtRON Biotechnology) and a Red imaging system (Alpha Innotech) was used for imaging.

    Article Title: Inducible ?-Lactam Resistance in Aeromonas hydrophila: Therapeutic Challenge for Antimicrobial Therapy
    Article Snippet: The agarose beads were digested with 10 U of Spe I (New Englands Biolabs) for 18 h and were electrophoresed through a 1% agarose gel in TBE buffer at 8°C by using the contour-clamped homogeneous electric field system (Pulsaphor plus; Pharmacia LKB Biotechnology, Uppsala, Sweden). .. The conditions for electrophoresis were 150 V for 30 h, with pulse times ranging from 5 to 35 s. The DNA bands were visualized by staining the gel with ethidium bromide and were photographed.

    Homologous Recombination:

    Article Title: Trans-differentiation of outer hair cells into inner hair cells in the absence of INSM1
    Article Snippet: .. DNA from selected recombinant clones was digested with the restriction enzyme, Spe I (NEB Cat:R0133) and homologous recombination was confirmed by Southern hybridization. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs bani
    Bani, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bani/product/New England Biolabs
    Average 99 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    bani - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results