apai restriction site  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    ApaI
    Description:
    ApaI 25 000 units
    Catalog Number:
    r0114l
    Price:
    290
    Size:
    25 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs apai restriction site
    ApaI
    ApaI 25 000 units
    https://www.bioz.com/result/apai restriction site/product/New England Biolabs
    Average 90 stars, based on 64 article reviews
    Price from $9.99 to $1999.99
    apai restriction site - by Bioz Stars, 2020-04
    90/100 stars

    Images

    1) Product Images from "Expression and Differentiation between OCT4A and Its Pseudogenes in Human ESCs and Differentiated Adult Somatic Cells"

    Article Title: Expression and Differentiation between OCT4A and Its Pseudogenes in Human ESCs and Differentiated Adult Somatic Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0089546

    RT-PCR for expression of embryonic stem cell specific genes. OCT4, NANOG and CRIPTO1 in human ESCs during culture (A), during 21 days after induction of hESC differentiation (B), and in adult human dermal fibroblasts cultured in 2% oxygen with FGF2 supplementation (C). Restriction digest of 646 bp OCT4 amplicon from human embryonic stem cells (D), control fibroblasts (E), and iPSCs (F). ApaI restriction digest of OCT4 amplicon in fibroblasts grown in 2% oxygen and FGF2 supplementation (G), and various transformed, multipotent and differentiated cells (H). NCCIT – teratocarcinoma, NTERA2– teratocarcinoma, SHSY – neuroblastoma, SMCs – smooth muscle cells, HUVECs – human umbilical vein endothelial cells, hMSCs – human mesenchymal stem cells. Only the embryonic OCT4A contains ApaI restriction site.
    Figure Legend Snippet: RT-PCR for expression of embryonic stem cell specific genes. OCT4, NANOG and CRIPTO1 in human ESCs during culture (A), during 21 days after induction of hESC differentiation (B), and in adult human dermal fibroblasts cultured in 2% oxygen with FGF2 supplementation (C). Restriction digest of 646 bp OCT4 amplicon from human embryonic stem cells (D), control fibroblasts (E), and iPSCs (F). ApaI restriction digest of OCT4 amplicon in fibroblasts grown in 2% oxygen and FGF2 supplementation (G), and various transformed, multipotent and differentiated cells (H). NCCIT – teratocarcinoma, NTERA2– teratocarcinoma, SHSY – neuroblastoma, SMCs – smooth muscle cells, HUVECs – human umbilical vein endothelial cells, hMSCs – human mesenchymal stem cells. Only the embryonic OCT4A contains ApaI restriction site.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Cell Culture, Amplification, Transformation Assay

    Schematic representation of restriction sites in 646-PCR amplicon. Specific restriction sites were used to distinguish between embryonic OCT4A transcript and different pseudogenes. Red arrows show restriction sites. ApaI restriction site is present only in embryonic OCT4A and can be used to distinguish embryonic form from all six pseudogenes; after restriction, a 146 bp and 500 bp long fragments are produced. HinfI digestion results in several smaller fragments among which the 434 bp fragment is specific only for OCT4-pg1. BglI digests only OCT4-pg3 into two fragments of 412 bp and 232 bp. XhoI does not digest OCT4-pg4.
    Figure Legend Snippet: Schematic representation of restriction sites in 646-PCR amplicon. Specific restriction sites were used to distinguish between embryonic OCT4A transcript and different pseudogenes. Red arrows show restriction sites. ApaI restriction site is present only in embryonic OCT4A and can be used to distinguish embryonic form from all six pseudogenes; after restriction, a 146 bp and 500 bp long fragments are produced. HinfI digestion results in several smaller fragments among which the 434 bp fragment is specific only for OCT4-pg1. BglI digests only OCT4-pg3 into two fragments of 412 bp and 232 bp. XhoI does not digest OCT4-pg4.

    Techniques Used: Polymerase Chain Reaction, Amplification, Produced

    2) Product Images from "Sequencing and Diversity Analyses Reveal Extensive Similarities between Some Epsilon-Toxin-Encoding Plasmids and the pCPF5603 Clostridium perfringens Enterotoxin Plasmid ▿ Enterotoxin Plasmid ▿ †"

    Article Title: Sequencing and Diversity Analyses Reveal Extensive Similarities between Some Epsilon-Toxin-Encoding Plasmids and the pCPF5603 Clostridium perfringens Enterotoxin Plasmid ▿ Enterotoxin Plasmid ▿ †

    Journal:

    doi: 10.1128/JB.00939-08

    PFGE of type B isolates. Agarose plugs containing DNA from each specified isolate were digested with KpnI (A) or ApaI (B) and then subjected to PFGE and staining with ethidium bromide. Numbers at right of each blot indicate migration of size markers in
    Figure Legend Snippet: PFGE of type B isolates. Agarose plugs containing DNA from each specified isolate were digested with KpnI (A) or ApaI (B) and then subjected to PFGE and staining with ethidium bromide. Numbers at right of each blot indicate migration of size markers in

    Techniques Used: Staining, Migration

    Related Articles

    Clone Assay:

    Article Title: Improved Method for Rapid and Efficient Determination of Genome Replication and Protein Expression of Clinical Hepatitis B Virus Isolates ▿
    Article Snippet: .. A single copy of the full-length HBV genome was released by the EcoRI digestion of the EcoRI monomer, ApaI or SphI digestion of the EcoRI dimer, and digestion of the monomeric PCR clones or clone pools at 50°C with BspQI (New England BioLabs). .. The digested DNA was purified through QIAquick PCR purification columns (Qiagen) and resuspended in endotoxin-free Tris-EDTA buffer.

    Amplification:

    Article Title: Ruminant Rhombencephalitis-Associated Listeria monocytogenes Strains Constitute a Genetically Homogeneous Group Related to Human Outbreak Strains
    Article Snippet: PFGE was performed by including genomic DNA in agarose plugs prior to digestion with the AscI and ApaI restriction enzymes (New England BioLabs), followed by PFGE with a Chef DR III system (Bio-Rad, Hercules, CA) , and pulsotypes were analyzed as described elsewhere ( ). .. Intragenic regions of six virulence genes ( clpP , dal , inlB , inlC , lisR , and prfA ) were amplified, resolved, purified, and sequenced as previously described ( ).

    Article Title: Vitamin D Receptor Gene Polymorphisms and Prognosis of Breast Cancer among African-American and Hispanic Women
    Article Snippet: .. Following PCR, aliquots of the amplified PCR products was digested with BsmI, ApaI, TaqI and FokI in accordance with the manufacturer's specifications (New England Biolabs, Beverly, MA, USA). .. The presence (lowercase) or absence (uppercase) of the enzyme recognition site was identified by ethidium bromide staining of fragments separated in a 2% agarose gel.

    Article Title: Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease
    Article Snippet: Using appropriate primers obtained DNA products were amplified for ApaI (Foward: 5’ CAGAGCATGGACAGGGAGCAAG 3′ and Reverse: 5’ GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65 °C annealing temperature), BsmI (Forward: 5’ CAACCAAGACTACAAGTACCGCGTCAGTGA 3′ and Reverse: 5’ AACCAGCGGGAAGAGGTCAAGGG 3 ‘with 65 °C as an annealing temperature), FokI (Forward: 5’ AGCTGGCCCTGGCACTGACTCTTGCTCT 3′ and Reverse: 5’ ATGGAAACACCTTGCTTCTTCTCCCTC 3′ with 67 °C annealing temperature), and TaqI (Forward: 5’ CAGAGCATGGACAGGGAGCAAG 3′ and Reverse: 5’GCAACTCCTCATGGCTGAGGTCTCA 3′ at an annealing temperature of 65 °C) VDR polymorphisms. .. The PCR products were then digested with enzymes ApaI, BsmI, FokI, and TaqI (New England Biolabs, Beverly, MA, USA) according to the supplier’s protocol.

    Article Title: Interaction of Vitamin D Receptor with HLA DRB1*0301 in Type 1 Diabetes Patients from North India
    Article Snippet: .. Genotypic Analysis of VDR Polymorphisms The genotypes for the four SNPs were determined by PCR amplification and restriction digestion of the PCR products with enzymes FokI, BsmI, ApaI , and TaqI as described earlier , Briefly, 500 ng of DNA was amplified in 5 µl of 10X Thermo Pol reaction buffer supplemented with 2 mM MgSO4 (New England Biolabs), 5 pm of each primers, 0.25 mM of dNTPs, and 1.25 U of Taq DNA Polymerase (New England Biolabs), under standard conditions for 35 cycles in Perkin Elmer 2700 thermocycler. ..

    Article Title: Lack of association between glutathione peroxidase1 (GPx1) activity, Pro198Leu polymorphism and stenosis of coronary arteries: A population-based prediction
    Article Snippet: Genotyping For genotyping rs1050450 (Pro(C)/Leu(T)) site, a fragment 1195 bp was amplified by two primers; 5′-AGACAGCAGCACTGCAACTGCCAA-3′ (1 μM) and 5′-AGACCAGACATGCCTGCTGCTCCTT-3′ (1 μM). .. The PCR product (1195 bp) was digested with ApaI (NEB) when the C allele was within rs1050450 position so that; we observed two fragments 1131 bp and 64 bp on agarose gel (3 %).

    In Vivo:

    Article Title: Effects of camptothecin on double-strand break repair by non-homologous end-joining in DNA mismatch repair-deficient human colorectal cancer cell lines
    Article Snippet: Plasmid preparation The pHRecSJ plasmid used in the in vivo cell end-joining assay contains the prokaryotic ColEI origin and the β-lactamase gene (AmpR), and was kindly given by Dora Papadopoulo ( ). .. The plasmid was linearized with restriction enzymes that recognize a unique site within the substrate: EcoRI [5′-protruding single stranded (PSS) cohesive ends], ApaI (3′-PSS cohesive ends) or both enzymes together (non-complementary ends) (New England Biolabs).

    End-sequence Profiling:

    Article Title: The Streptococcus milleri Population of a Cystic Fibrosis Clinic Reveals Patient Specificity and Intraspecies Diversity ▿
    Article Snippet: Plugs were cast at room temperature and then transferred to 1.5 ml of lysis solution (0.25 M EDTA [pH 9.0], 0.5% Brij 58, 2 g/liter sodium deoxycholate, 5 g/liter lauroyl sarcosine, 100 U/ml mutanolysin) and incubated at 37°C for 2 h. The lysis solution was replaced with 1.5 ml ESP solution (0.25 M EDTA [pH 9.5], 1% sodium lauroyl sarcosine, 0.5 mg/ml proteinase K) and incubated at 55°C for 2 h. The plugs were rinsed with 1 ml of distilled water and then washed for 10-min intervals, once with distilled water and three times with 1× Tris-EDTA (TE; 10 mM Tris-Hcl, 1 mM EDTA [pH 8.0]) at room temperature. .. For restriction digestion, the plugs were preincubated in 300 μl of 1× reaction buffer (Invitrogen, Carlsbad, CA) at room temperature for 15 min and then replaced with fresh 1× reaction buffer supplemented with 90 U of SmaI or ApaI (New England BioLabs, Beverly, MA).

    Real-time Polymerase Chain Reaction:

    Article Title: Vitamin D deficiency in girls from South Brazil: a cross-sectional study on prevalence and association with vitamin D receptor gene variants
    Article Snippet: Protocol conditions consisted of denaturation at 95°C for 2 min followed by 35 cycles (95°C, 30sec; 59.2°C, 30sec; 72°C, 80sec) and final extension at 72°C for 5 min. PCR products were digested overnight by the restriction enzymes ApaI or TaqI (New England Biolabs, USA) at 37°C or 65°C, respectively. .. BsmI (rs1544410) SNP (change of the G → A) genotyping was performed through real-time PCR (7500 Fast Applied Biosystems, California, USA) with allelic discrimination assays (Taqman MGB Probes®) according to the manufacturer’s instructions (Applied Biosystems, California, USA).

    Incubation:

    Article Title: The Streptococcus milleri Population of a Cystic Fibrosis Clinic Reveals Patient Specificity and Intraspecies Diversity ▿
    Article Snippet: Plugs were cast at room temperature and then transferred to 1.5 ml of lysis solution (0.25 M EDTA [pH 9.0], 0.5% Brij 58, 2 g/liter sodium deoxycholate, 5 g/liter lauroyl sarcosine, 100 U/ml mutanolysin) and incubated at 37°C for 2 h. The lysis solution was replaced with 1.5 ml ESP solution (0.25 M EDTA [pH 9.5], 1% sodium lauroyl sarcosine, 0.5 mg/ml proteinase K) and incubated at 55°C for 2 h. The plugs were rinsed with 1 ml of distilled water and then washed for 10-min intervals, once with distilled water and three times with 1× Tris-EDTA (TE; 10 mM Tris-Hcl, 1 mM EDTA [pH 8.0]) at room temperature. .. For restriction digestion, the plugs were preincubated in 300 μl of 1× reaction buffer (Invitrogen, Carlsbad, CA) at room temperature for 15 min and then replaced with fresh 1× reaction buffer supplemented with 90 U of SmaI or ApaI (New England BioLabs, Beverly, MA).

    Article Title: Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease
    Article Snippet: The PCR products were then digested with enzymes ApaI, BsmI, FokI, and TaqI (New England Biolabs, Beverly, MA, USA) according to the supplier’s protocol. .. Digestions for BsmI and TaqI were at 65 °C left overnight, and 3 h at 25 °C for ApaI , while FokI was incubated at 37 °C for 3 h. Restricted products were electrophoresed on either 10% polyacrylamide or 1.5% agarose gels and then visualized by the Gel Doc TM EZ imager (Bio-Rad systems, USA).

    Article Title: Lack of association between glutathione peroxidase1 (GPx1) activity, Pro198Leu polymorphism and stenosis of coronary arteries: A population-based prediction
    Article Snippet: The cycling condition was followed after initial incubation at 94 °C for 1 min by 60 cycles (94 °C for 30 s, 59 °C for 30 s, and 72 °C for 60 s) and a final elongation at 72 °C for 5 min. .. The PCR product (1195 bp) was digested with ApaI (NEB) when the C allele was within rs1050450 position so that; we observed two fragments 1131 bp and 64 bp on agarose gel (3 %).

    Article Title: Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease
    Article Snippet: The PCR products were then digested with enzymes ApaI, BsmI, FokI, and TaqI (New England Biolabs, Beverly, MA, USA) according to the supplier’s protocol. .. Digestions for BsmI and TaqI were at 65 °C left overnight, and 3 h at 25 °C for ApaI , while FokI was incubated at 37 °C for 3 h. Restricted products were electrophoresed on either 10% polyacrylamide or 1.5% agarose gels and then visualized by the Gel Doc TM EZ imager (Bio-Rad systems, USA).

    Modification:

    Article Title: The Streptococcus milleri Population of a Cystic Fibrosis Clinic Reveals Patient Specificity and Intraspecies Diversity ▿
    Article Snippet: PFGE was performed by modification of a protocol described by Bartie et al. ( ). .. For restriction digestion, the plugs were preincubated in 300 μl of 1× reaction buffer (Invitrogen, Carlsbad, CA) at room temperature for 15 min and then replaced with fresh 1× reaction buffer supplemented with 90 U of SmaI or ApaI (New England BioLabs, Beverly, MA).

    Transformation Assay:

    Article Title: Effects of camptothecin on double-strand break repair by non-homologous end-joining in DNA mismatch repair-deficient human colorectal cancer cell lines
    Article Snippet: The plasmid was linearized with restriction enzymes that recognize a unique site within the substrate: EcoRI [5′-protruding single stranded (PSS) cohesive ends], ApaI (3′-PSS cohesive ends) or both enzymes together (non-complementary ends) (New England Biolabs). .. The pEGFP-C1 (Clontech) plasmid containing a bacterial replication origin and the gene that confers the resistance to kanamycin was used as a control to monitor the transfection and transformation efficiencies.

    Transfection:

    Article Title: Effects of camptothecin on double-strand break repair by non-homologous end-joining in DNA mismatch repair-deficient human colorectal cancer cell lines
    Article Snippet: The plasmid was linearized with restriction enzymes that recognize a unique site within the substrate: EcoRI [5′-protruding single stranded (PSS) cohesive ends], ApaI (3′-PSS cohesive ends) or both enzymes together (non-complementary ends) (New England Biolabs). .. The pEGFP-C1 (Clontech) plasmid containing a bacterial replication origin and the gene that confers the resistance to kanamycin was used as a control to monitor the transfection and transformation efficiencies.

    Article Title: Improved Method for Rapid and Efficient Determination of Genome Replication and Protein Expression of Clinical Hepatitis B Virus Isolates ▿
    Article Snippet: Paragraph title: DNA preparation prior to transfection. ... A single copy of the full-length HBV genome was released by the EcoRI digestion of the EcoRI monomer, ApaI or SphI digestion of the EcoRI dimer, and digestion of the monomeric PCR clones or clone pools at 50°C with BspQI (New England BioLabs).

    Ligation:

    Article Title: Improved Method for Rapid and Efficient Determination of Genome Replication and Protein Expression of Clinical Hepatitis B Virus Isolates ▿
    Article Snippet: A single copy of the full-length HBV genome was released by the EcoRI digestion of the EcoRI monomer, ApaI or SphI digestion of the EcoRI dimer, and digestion of the monomeric PCR clones or clone pools at 50°C with BspQI (New England BioLabs). .. To circularize the HBV genome with minimum intermolecular ligation, 1.5 μg of the digest or gel-purified HBV DNA was ligated at 16°C overnight with 1,600 U (4 μl) of T4 DNA ligase (New England BioLabs) in a total volume of 1.5 ml.

    Cell Culture:

    Article Title: The Streptococcus milleri Population of a Cystic Fibrosis Clinic Reveals Patient Specificity and Intraspecies Diversity ▿
    Article Snippet: The isolates were cultured at 37°C for 48 h on brain heart infusion agar supplemented with colistin sulfate (10 μg/ml) and oxolinic acid (5 μg/ml) under anaerobic conditions. .. For restriction digestion, the plugs were preincubated in 300 μl of 1× reaction buffer (Invitrogen, Carlsbad, CA) at room temperature for 15 min and then replaced with fresh 1× reaction buffer supplemented with 90 U of SmaI or ApaI (New England BioLabs, Beverly, MA).

    Sequencing:

    Article Title: Targeted gene disruption in Candida parapsilosis demonstrates a role for CPAR2_404800 in adhesion to a biotic surface and in a murine model of ascending urinary tract infection
    Article Snippet: .. Primers 5COM3F and 5COM3R ( Table S2 ), containing ApaI and SacI sites respectively were used in order to amplify the entire coding sequence of CpALS7 (+4439 bp, comprehensive of −26 upstream and +261 downstream bp) using Q5® High-Fidelity DNA Polymerases by New England Biolabs Inc.. .. The PCR product and p3ALS7 were digested with ApaI and SacI restriction enzymes and ligated together.

    Pulsed-Field Gel:

    Article Title: The Composition of Human Milk and Infant Faecal Microbiota Over the First Three Months of Life: A Pilot Study
    Article Snippet: Paragraph title: Genetic Typing by Pulsed-Field Gel Electrophoresis (PFGE) ... The restriction enzyme XbaI was used to cleave bifidobacterial chromosomal DNA and ApaI (New England Biolabs, MA, United States) was used for Lactobacillus .

    Screening Assay:

    Article Title: Ruminant Rhombencephalitis-Associated Listeria monocytogenes Strains Constitute a Genetically Homogeneous Group Related to Human Outbreak Strains
    Article Snippet: Ruminant isolates were also analyzed with an mSNP typing screening assay able to identify five ECs (ECI, ECII, ECIII, ECIV, and ECV) of L. monocytogenes ( ). .. PFGE was performed by including genomic DNA in agarose plugs prior to digestion with the AscI and ApaI restriction enzymes (New England BioLabs), followed by PFGE with a Chef DR III system (Bio-Rad, Hercules, CA) , and pulsotypes were analyzed as described elsewhere ( ).

    Mutagenesis:

    Article Title: Targeted gene disruption in Candida parapsilosis demonstrates a role for CPAR2_404800 in adhesion to a biotic surface and in a murine model of ascending urinary tract infection
    Article Snippet: To show that the mutant phenotype was caused by the CpALS7 gene deletion, a wild type copy of CpALS7 gene was reintroduced into the als7△/als7△ null mutant strain. p3ALS7 plasmid was used as backbone for the construction of the reintegration cassette. .. Primers 5COM3F and 5COM3R ( Table S2 ), containing ApaI and SacI sites respectively were used in order to amplify the entire coding sequence of CpALS7 (+4439 bp, comprehensive of −26 upstream and +261 downstream bp) using Q5® High-Fidelity DNA Polymerases by New England Biolabs Inc..

    Isolation:

    Article Title: Ruminant Rhombencephalitis-Associated Listeria monocytogenes Strains Constitute a Genetically Homogeneous Group Related to Human Outbreak Strains
    Article Snippet: PFGE was performed by including genomic DNA in agarose plugs prior to digestion with the AscI and ApaI restriction enzymes (New England BioLabs), followed by PFGE with a Chef DR III system (Bio-Rad, Hercules, CA) , and pulsotypes were analyzed as described elsewhere ( ). .. PFGE profiles were subsequently compared with a set of 311 well-characterized L. monocytogenes strains isolated from environmental, food, and human clinical samples ( ).

    Article Title: The Composition of Human Milk and Infant Faecal Microbiota Over the First Three Months of Life: A Pilot Study
    Article Snippet: Genetic Typing by Pulsed-Field Gel Electrophoresis (PFGE) High-molecular-weight DNA fragments were isolated from stationary phase cultures by a previously described method . .. The restriction enzyme XbaI was used to cleave bifidobacterial chromosomal DNA and ApaI (New England Biolabs, MA, United States) was used for Lactobacillus .

    Purification:

    Article Title: Improved Method for Rapid and Efficient Determination of Genome Replication and Protein Expression of Clinical Hepatitis B Virus Isolates ▿
    Article Snippet: A single copy of the full-length HBV genome was released by the EcoRI digestion of the EcoRI monomer, ApaI or SphI digestion of the EcoRI dimer, and digestion of the monomeric PCR clones or clone pools at 50°C with BspQI (New England BioLabs). .. The digested DNA was purified through QIAquick PCR purification columns (Qiagen) and resuspended in endotoxin-free Tris-EDTA buffer.

    Article Title: Ruminant Rhombencephalitis-Associated Listeria monocytogenes Strains Constitute a Genetically Homogeneous Group Related to Human Outbreak Strains
    Article Snippet: PFGE was performed by including genomic DNA in agarose plugs prior to digestion with the AscI and ApaI restriction enzymes (New England BioLabs), followed by PFGE with a Chef DR III system (Bio-Rad, Hercules, CA) , and pulsotypes were analyzed as described elsewhere ( ). .. Intragenic regions of six virulence genes ( clpP , dal , inlB , inlC , lisR , and prfA ) were amplified, resolved, purified, and sequenced as previously described ( ).

    Polymerase Chain Reaction:

    Article Title: Improved Method for Rapid and Efficient Determination of Genome Replication and Protein Expression of Clinical Hepatitis B Virus Isolates ▿
    Article Snippet: .. A single copy of the full-length HBV genome was released by the EcoRI digestion of the EcoRI monomer, ApaI or SphI digestion of the EcoRI dimer, and digestion of the monomeric PCR clones or clone pools at 50°C with BspQI (New England BioLabs). .. The digested DNA was purified through QIAquick PCR purification columns (Qiagen) and resuspended in endotoxin-free Tris-EDTA buffer.

    Article Title: Ruminant Rhombencephalitis-Associated Listeria monocytogenes Strains Constitute a Genetically Homogeneous Group Related to Human Outbreak Strains
    Article Snippet: Paragraph title: Duplex PCR, mSNP typing, PFGE, and MVLST. ... PFGE was performed by including genomic DNA in agarose plugs prior to digestion with the AscI and ApaI restriction enzymes (New England BioLabs), followed by PFGE with a Chef DR III system (Bio-Rad, Hercules, CA) , and pulsotypes were analyzed as described elsewhere ( ).

    Article Title: Vitamin D Receptor Gene Polymorphisms and Prognosis of Breast Cancer among African-American and Hispanic Women
    Article Snippet: .. Following PCR, aliquots of the amplified PCR products was digested with BsmI, ApaI, TaqI and FokI in accordance with the manufacturer's specifications (New England Biolabs, Beverly, MA, USA). .. The presence (lowercase) or absence (uppercase) of the enzyme recognition site was identified by ethidium bromide staining of fragments separated in a 2% agarose gel.

    Article Title: Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease
    Article Snippet: .. The PCR products were then digested with enzymes ApaI, BsmI, FokI, and TaqI (New England Biolabs, Beverly, MA, USA) according to the supplier’s protocol. .. Digestions for BsmI and TaqI were at 65 °C left overnight, and 3 h at 25 °C for ApaI , while FokI was incubated at 37 °C for 3 h. Restricted products were electrophoresed on either 10% polyacrylamide or 1.5% agarose gels and then visualized by the Gel Doc TM EZ imager (Bio-Rad systems, USA).

    Article Title: Vitamin D deficiency in girls from South Brazil: a cross-sectional study on prevalence and association with vitamin D receptor gene variants
    Article Snippet: .. Protocol conditions consisted of denaturation at 95°C for 2 min followed by 35 cycles (95°C, 30sec; 59.2°C, 30sec; 72°C, 80sec) and final extension at 72°C for 5 min. PCR products were digested overnight by the restriction enzymes ApaI or TaqI (New England Biolabs, USA) at 37°C or 65°C, respectively. .. ApaI digestion revealed genotypes TT (740 bp), TG (740, 559, and 181 bp) or GG (559 and 181 pb), while TaqI digestion denoted genotypes TT (740 bp), TC (740, 635 and 105 pb) or CC (635 and 105 pb) at 2% agarose gel electrophoresis.

    Article Title: Interaction of Vitamin D Receptor with HLA DRB1*0301 in Type 1 Diabetes Patients from North India
    Article Snippet: .. Genotypic Analysis of VDR Polymorphisms The genotypes for the four SNPs were determined by PCR amplification and restriction digestion of the PCR products with enzymes FokI, BsmI, ApaI , and TaqI as described earlier , Briefly, 500 ng of DNA was amplified in 5 µl of 10X Thermo Pol reaction buffer supplemented with 2 mM MgSO4 (New England Biolabs), 5 pm of each primers, 0.25 mM of dNTPs, and 1.25 U of Taq DNA Polymerase (New England Biolabs), under standard conditions for 35 cycles in Perkin Elmer 2700 thermocycler. ..

    Article Title: Lack of association between glutathione peroxidase1 (GPx1) activity, Pro198Leu polymorphism and stenosis of coronary arteries: A population-based prediction
    Article Snippet: .. The PCR product (1195 bp) was digested with ApaI (NEB) when the C allele was within rs1050450 position so that; we observed two fragments 1131 bp and 64 bp on agarose gel (3 %). ..

    Article Title: Targeted gene disruption in Candida parapsilosis demonstrates a role for CPAR2_404800 in adhesion to a biotic surface and in a murine model of ascending urinary tract infection
    Article Snippet: Primers 5COM3F and 5COM3R ( Table S2 ), containing ApaI and SacI sites respectively were used in order to amplify the entire coding sequence of CpALS7 (+4439 bp, comprehensive of −26 upstream and +261 downstream bp) using Q5® High-Fidelity DNA Polymerases by New England Biolabs Inc.. .. The PCR product and p3ALS7 were digested with ApaI and SacI restriction enzymes and ligated together.

    Article Title: Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease
    Article Snippet: .. The PCR products were then digested with enzymes ApaI, BsmI, FokI, and TaqI (New England Biolabs, Beverly, MA, USA) according to the supplier’s protocol. .. Digestions for BsmI and TaqI were at 65 °C left overnight, and 3 h at 25 °C for ApaI , while FokI was incubated at 37 °C for 3 h. Restricted products were electrophoresed on either 10% polyacrylamide or 1.5% agarose gels and then visualized by the Gel Doc TM EZ imager (Bio-Rad systems, USA).

    Staining:

    Article Title: Vitamin D Receptor Gene Polymorphisms and Prognosis of Breast Cancer among African-American and Hispanic Women
    Article Snippet: Following PCR, aliquots of the amplified PCR products was digested with BsmI, ApaI, TaqI and FokI in accordance with the manufacturer's specifications (New England Biolabs, Beverly, MA, USA). .. The presence (lowercase) or absence (uppercase) of the enzyme recognition site was identified by ethidium bromide staining of fragments separated in a 2% agarose gel.

    Plasmid Preparation:

    Article Title: Effects of camptothecin on double-strand break repair by non-homologous end-joining in DNA mismatch repair-deficient human colorectal cancer cell lines
    Article Snippet: .. The plasmid was linearized with restriction enzymes that recognize a unique site within the substrate: EcoRI [5′-protruding single stranded (PSS) cohesive ends], ApaI (3′-PSS cohesive ends) or both enzymes together (non-complementary ends) (New England Biolabs). ..

    Article Title: Targeted gene disruption in Candida parapsilosis demonstrates a role for CPAR2_404800 in adhesion to a biotic surface and in a murine model of ascending urinary tract infection
    Article Snippet: To show that the mutant phenotype was caused by the CpALS7 gene deletion, a wild type copy of CpALS7 gene was reintroduced into the als7△/als7△ null mutant strain. p3ALS7 plasmid was used as backbone for the construction of the reintegration cassette. .. Primers 5COM3F and 5COM3R ( Table S2 ), containing ApaI and SacI sites respectively were used in order to amplify the entire coding sequence of CpALS7 (+4439 bp, comprehensive of −26 upstream and +261 downstream bp) using Q5® High-Fidelity DNA Polymerases by New England Biolabs Inc..

    Agarose Gel Electrophoresis:

    Article Title: The Streptococcus milleri Population of a Cystic Fibrosis Clinic Reveals Patient Specificity and Intraspecies Diversity ▿
    Article Snippet: For restriction digestion, the plugs were preincubated in 300 μl of 1× reaction buffer (Invitrogen, Carlsbad, CA) at room temperature for 15 min and then replaced with fresh 1× reaction buffer supplemented with 90 U of SmaI or ApaI (New England BioLabs, Beverly, MA). .. Following a 5-min wash in 1× TE, the plugs were loaded into a 1% SeaKem Gold agarose gel, prepared in 0.5× TBE (1× TBE is 89 mM Tris-HCl [pH 7.4], 89 mM boric acid, 25 mM EDTA [pH 8.0]).

    Article Title: Improved Method for Rapid and Efficient Determination of Genome Replication and Protein Expression of Clinical Hepatitis B Virus Isolates ▿
    Article Snippet: A single copy of the full-length HBV genome was released by the EcoRI digestion of the EcoRI monomer, ApaI or SphI digestion of the EcoRI dimer, and digestion of the monomeric PCR clones or clone pools at 50°C with BspQI (New England BioLabs). .. Alternatively, the 3.2-kb HBV DNA was eluted from the agarose gel.

    Article Title: Vitamin D Receptor Gene Polymorphisms and Prognosis of Breast Cancer among African-American and Hispanic Women
    Article Snippet: Following PCR, aliquots of the amplified PCR products was digested with BsmI, ApaI, TaqI and FokI in accordance with the manufacturer's specifications (New England Biolabs, Beverly, MA, USA). .. The presence (lowercase) or absence (uppercase) of the enzyme recognition site was identified by ethidium bromide staining of fragments separated in a 2% agarose gel.

    Article Title: Vitamin D deficiency in girls from South Brazil: a cross-sectional study on prevalence and association with vitamin D receptor gene variants
    Article Snippet: Protocol conditions consisted of denaturation at 95°C for 2 min followed by 35 cycles (95°C, 30sec; 59.2°C, 30sec; 72°C, 80sec) and final extension at 72°C for 5 min. PCR products were digested overnight by the restriction enzymes ApaI or TaqI (New England Biolabs, USA) at 37°C or 65°C, respectively. .. ApaI digestion revealed genotypes TT (740 bp), TG (740, 559, and 181 bp) or GG (559 and 181 pb), while TaqI digestion denoted genotypes TT (740 bp), TC (740, 635 and 105 pb) or CC (635 and 105 pb) at 2% agarose gel electrophoresis.

    Article Title: Lack of association between glutathione peroxidase1 (GPx1) activity, Pro198Leu polymorphism and stenosis of coronary arteries: A population-based prediction
    Article Snippet: .. The PCR product (1195 bp) was digested with ApaI (NEB) when the C allele was within rs1050450 position so that; we observed two fragments 1131 bp and 64 bp on agarose gel (3 %). ..

    DNA Purification:

    Article Title: Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease
    Article Snippet: DNA was extracted from whole blood using the Maxwell DNA purification kit (Promega AS1010, USA). .. The PCR products were then digested with enzymes ApaI, BsmI, FokI, and TaqI (New England Biolabs, Beverly, MA, USA) according to the supplier’s protocol.

    Article Title: Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease
    Article Snippet: Genotyping DNA was extracted from whole blood using the Maxwell DNA purification kit (Promega AS1010, USA). .. The PCR products were then digested with enzymes ApaI, BsmI, FokI, and TaqI (New England Biolabs, Beverly, MA, USA) according to the supplier’s protocol.

    Lysis:

    Article Title: The Streptococcus milleri Population of a Cystic Fibrosis Clinic Reveals Patient Specificity and Intraspecies Diversity ▿
    Article Snippet: Plugs were cast at room temperature and then transferred to 1.5 ml of lysis solution (0.25 M EDTA [pH 9.0], 0.5% Brij 58, 2 g/liter sodium deoxycholate, 5 g/liter lauroyl sarcosine, 100 U/ml mutanolysin) and incubated at 37°C for 2 h. The lysis solution was replaced with 1.5 ml ESP solution (0.25 M EDTA [pH 9.5], 1% sodium lauroyl sarcosine, 0.5 mg/ml proteinase K) and incubated at 55°C for 2 h. The plugs were rinsed with 1 ml of distilled water and then washed for 10-min intervals, once with distilled water and three times with 1× Tris-EDTA (TE; 10 mM Tris-Hcl, 1 mM EDTA [pH 8.0]) at room temperature. .. For restriction digestion, the plugs were preincubated in 300 μl of 1× reaction buffer (Invitrogen, Carlsbad, CA) at room temperature for 15 min and then replaced with fresh 1× reaction buffer supplemented with 90 U of SmaI or ApaI (New England BioLabs, Beverly, MA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs apai restriction site
    RT-PCR for expression of embryonic stem cell specific genes. OCT4, NANOG and CRIPTO1 in human ESCs during culture (A), during 21 days after induction of hESC differentiation (B), and in adult human dermal fibroblasts cultured in 2% oxygen with FGF2 supplementation (C). Restriction digest of 646 bp OCT4 amplicon from human embryonic stem cells (D), control fibroblasts (E), and iPSCs (F). <t>ApaI</t> restriction digest of OCT4 amplicon in fibroblasts grown in 2% oxygen and FGF2 supplementation (G), and various transformed, multipotent and differentiated cells (H). NCCIT – teratocarcinoma, NTERA2– teratocarcinoma, SHSY – neuroblastoma, SMCs – smooth muscle cells, HUVECs – human umbilical vein endothelial cells, hMSCs – human mesenchymal stem cells. Only the embryonic <t>OCT4A</t> contains ApaI restriction site.
    Apai Restriction Site, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 62 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/apai restriction site/product/New England Biolabs
    Average 90 stars, based on 62 article reviews
    Price from $9.99 to $1999.99
    apai restriction site - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    Image Search Results


    RT-PCR for expression of embryonic stem cell specific genes. OCT4, NANOG and CRIPTO1 in human ESCs during culture (A), during 21 days after induction of hESC differentiation (B), and in adult human dermal fibroblasts cultured in 2% oxygen with FGF2 supplementation (C). Restriction digest of 646 bp OCT4 amplicon from human embryonic stem cells (D), control fibroblasts (E), and iPSCs (F). ApaI restriction digest of OCT4 amplicon in fibroblasts grown in 2% oxygen and FGF2 supplementation (G), and various transformed, multipotent and differentiated cells (H). NCCIT – teratocarcinoma, NTERA2– teratocarcinoma, SHSY – neuroblastoma, SMCs – smooth muscle cells, HUVECs – human umbilical vein endothelial cells, hMSCs – human mesenchymal stem cells. Only the embryonic OCT4A contains ApaI restriction site.

    Journal: PLoS ONE

    Article Title: Expression and Differentiation between OCT4A and Its Pseudogenes in Human ESCs and Differentiated Adult Somatic Cells

    doi: 10.1371/journal.pone.0089546

    Figure Lengend Snippet: RT-PCR for expression of embryonic stem cell specific genes. OCT4, NANOG and CRIPTO1 in human ESCs during culture (A), during 21 days after induction of hESC differentiation (B), and in adult human dermal fibroblasts cultured in 2% oxygen with FGF2 supplementation (C). Restriction digest of 646 bp OCT4 amplicon from human embryonic stem cells (D), control fibroblasts (E), and iPSCs (F). ApaI restriction digest of OCT4 amplicon in fibroblasts grown in 2% oxygen and FGF2 supplementation (G), and various transformed, multipotent and differentiated cells (H). NCCIT – teratocarcinoma, NTERA2– teratocarcinoma, SHSY – neuroblastoma, SMCs – smooth muscle cells, HUVECs – human umbilical vein endothelial cells, hMSCs – human mesenchymal stem cells. Only the embryonic OCT4A contains ApaI restriction site.

    Article Snippet: A previously described ApaI restriction site specific for embryonic OCT4A and three novel restriction sites for pseudogenes were selected (HinfI for OCT4-pg1; BglI for OCT4-pg3, XhoI for OCT4-pg4; all from NEBiolabs).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Expressing, Cell Culture, Amplification, Transformation Assay

    Schematic representation of restriction sites in 646-PCR amplicon. Specific restriction sites were used to distinguish between embryonic OCT4A transcript and different pseudogenes. Red arrows show restriction sites. ApaI restriction site is present only in embryonic OCT4A and can be used to distinguish embryonic form from all six pseudogenes; after restriction, a 146 bp and 500 bp long fragments are produced. HinfI digestion results in several smaller fragments among which the 434 bp fragment is specific only for OCT4-pg1. BglI digests only OCT4-pg3 into two fragments of 412 bp and 232 bp. XhoI does not digest OCT4-pg4.

    Journal: PLoS ONE

    Article Title: Expression and Differentiation between OCT4A and Its Pseudogenes in Human ESCs and Differentiated Adult Somatic Cells

    doi: 10.1371/journal.pone.0089546

    Figure Lengend Snippet: Schematic representation of restriction sites in 646-PCR amplicon. Specific restriction sites were used to distinguish between embryonic OCT4A transcript and different pseudogenes. Red arrows show restriction sites. ApaI restriction site is present only in embryonic OCT4A and can be used to distinguish embryonic form from all six pseudogenes; after restriction, a 146 bp and 500 bp long fragments are produced. HinfI digestion results in several smaller fragments among which the 434 bp fragment is specific only for OCT4-pg1. BglI digests only OCT4-pg3 into two fragments of 412 bp and 232 bp. XhoI does not digest OCT4-pg4.

    Article Snippet: A previously described ApaI restriction site specific for embryonic OCT4A and three novel restriction sites for pseudogenes were selected (HinfI for OCT4-pg1; BglI for OCT4-pg3, XhoI for OCT4-pg4; all from NEBiolabs).

    Techniques: Polymerase Chain Reaction, Amplification, Produced

    PFGE of type B isolates. Agarose plugs containing DNA from each specified isolate were digested with KpnI (A) or ApaI (B) and then subjected to PFGE and staining with ethidium bromide. Numbers at right of each blot indicate migration of size markers in

    Journal:

    Article Title: Sequencing and Diversity Analyses Reveal Extensive Similarities between Some Epsilon-Toxin-Encoding Plasmids and the pCPF5603 Clostridium perfringens Enterotoxin Plasmid ▿ Enterotoxin Plasmid ▿ †

    doi: 10.1128/JB.00939-08

    Figure Lengend Snippet: PFGE of type B isolates. Agarose plugs containing DNA from each specified isolate were digested with KpnI (A) or ApaI (B) and then subjected to PFGE and staining with ethidium bromide. Numbers at right of each blot indicate migration of size markers in

    Article Snippet: In some experiments, DNA plugs from each of nine type B isolates were digested with the rare-cutting restriction enzyme ApaI, AvaI, or KpnI, according to manufacturer's instructions (New England Biolabs, Massachusetts).

    Techniques: Staining, Migration