apai  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    ApaI
    Description:
    ApaI 25 000 units
    Catalog Number:
    R0114L
    Price:
    290
    Category:
    Restriction Enzymes
    Size:
    25 000 units
    Buy from Supplier


    Structured Review

    New England Biolabs apai
    ApaI
    ApaI 25 000 units
    https://www.bioz.com/result/apai/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    apai - by Bioz Stars, 2021-05
    99/100 stars

    Images

    1) Product Images from "Loss of imprinting of insulin-like growth factor 2 is associated with increased risk of lymph node metastasis and gastric corpus cancer"

    Article Title: Loss of imprinting of insulin-like growth factor 2 is associated with increased risk of lymph node metastasis and gastric corpus cancer

    Journal: Journal of Experimental & Clinical Cancer Research : CR

    doi: 10.1186/1756-9966-28-125

    Imprinting analysis of IGF2 in gastric cancer . DNA (G1) and RT-PCR (G3) amplification using primers P1 and P3 and DNA amplification by PCR with primers P2 and P3 (G2) represented 1.4 kb, 1.12 kb and 292 bp respectively (see details in methods section). G1, G2 and G3 are PCR products of the same normal tissue. ApaI- and HinfI-digested normal tissue DNA PCR (Gn) from primers P2 and P3 displayed two bands of 256 and 231 bp indicating heterozygosity. The digested nested PCR product from primers P2 and P3 using the 1.12 kb RT-PCR product as a template showed monoallelic expression of IGF2 in normal (Rn1, Rn2) and biallelic expression in tumor (Rt1, Rt2) tissues.
    Figure Legend Snippet: Imprinting analysis of IGF2 in gastric cancer . DNA (G1) and RT-PCR (G3) amplification using primers P1 and P3 and DNA amplification by PCR with primers P2 and P3 (G2) represented 1.4 kb, 1.12 kb and 292 bp respectively (see details in methods section). G1, G2 and G3 are PCR products of the same normal tissue. ApaI- and HinfI-digested normal tissue DNA PCR (Gn) from primers P2 and P3 displayed two bands of 256 and 231 bp indicating heterozygosity. The digested nested PCR product from primers P2 and P3 using the 1.12 kb RT-PCR product as a template showed monoallelic expression of IGF2 in normal (Rn1, Rn2) and biallelic expression in tumor (Rt1, Rt2) tissues.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction, Nested PCR, Expressing

    2) Product Images from "Vitamin D Receptor Gene Polymorphisms and Prognosis of Breast Cancer among African-American and Hispanic Women"

    Article Title: Vitamin D Receptor Gene Polymorphisms and Prognosis of Breast Cancer among African-American and Hispanic Women

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0057967

    Five-year disease free survival (DFS) of breast cancer patients in relation to VDR gene polymorphisms. Kaplan-Meier survival curves were used to compare the 5-year DFS between the VDR gene polymorphisms in (a) VDR-FokI, (b) VDR-BsmI, (c) VDR-ApaI, and (d) VDR-TaqI. The differences between the curves were estimated by log-rank test, where P
    Figure Legend Snippet: Five-year disease free survival (DFS) of breast cancer patients in relation to VDR gene polymorphisms. Kaplan-Meier survival curves were used to compare the 5-year DFS between the VDR gene polymorphisms in (a) VDR-FokI, (b) VDR-BsmI, (c) VDR-ApaI, and (d) VDR-TaqI. The differences between the curves were estimated by log-rank test, where P

    Techniques Used:

    3) Product Images from "Effects of camptothecin on double-strand break repair by non-homologous end-joining in DNA mismatch repair-deficient human colorectal cancer cell lines"

    Article Title: Effects of camptothecin on double-strand break repair by non-homologous end-joining in DNA mismatch repair-deficient human colorectal cancer cell lines

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gki154

    Effect of CPT treatment on DSB repair efficiency in CRC cell lines. Cells were treated with 100 nM CPT just after transfection and until plasmid recovery. Histograms represent the mean percentage of repair efficiency established from a minimum of three independent experiments for plasmids linearized with ApaI ( A ), EcoRI ( B ) and ApaI-EcoRI ( C ). The numbers of independent experiments are marked above each histogram for each CRC cell line tested. Only P values statistically different are specified.
    Figure Legend Snippet: Effect of CPT treatment on DSB repair efficiency in CRC cell lines. Cells were treated with 100 nM CPT just after transfection and until plasmid recovery. Histograms represent the mean percentage of repair efficiency established from a minimum of three independent experiments for plasmids linearized with ApaI ( A ), EcoRI ( B ) and ApaI-EcoRI ( C ). The numbers of independent experiments are marked above each histogram for each CRC cell line tested. Only P values statistically different are specified.

    Techniques Used: Cycling Probe Technology, Transfection, Plasmid Preparation

    End-joining efficiency of DSB repair by NHEJ in MMR-deficient and MMR-proficient CRC cell lines. Histograms represent the mean percentage of repair efficiency established from a minimum of three independent experiments using plasmids linearized with ApaI ( A ), EcoRI ( B ) and ApaI-EcoRI ( C ). The number of independent experiments is shown above each histogram. The P values refer to the comparison of all cell lines.
    Figure Legend Snippet: End-joining efficiency of DSB repair by NHEJ in MMR-deficient and MMR-proficient CRC cell lines. Histograms represent the mean percentage of repair efficiency established from a minimum of three independent experiments using plasmids linearized with ApaI ( A ), EcoRI ( B ) and ApaI-EcoRI ( C ). The number of independent experiments is shown above each histogram. The P values refer to the comparison of all cell lines.

    Techniques Used: Non-Homologous End Joining

    End-joining fidelity of DSB repair by NHEJ in MMR-deficient and MMR-proficient CRC cell lines. Histograms represent the mean frequency in percentage of the error-free events after repair of DSB induced by ApaI ( A ) or EcoRI ( B ) established from a minimum of three independent experiments and a minimum of 250 bacterial colonies analyzed. The numbers of bacterial colonies analyzed are specified above the histograms for each CRC cell lines tested. The P values refer to the comparison of all cell lines.
    Figure Legend Snippet: End-joining fidelity of DSB repair by NHEJ in MMR-deficient and MMR-proficient CRC cell lines. Histograms represent the mean frequency in percentage of the error-free events after repair of DSB induced by ApaI ( A ) or EcoRI ( B ) established from a minimum of three independent experiments and a minimum of 250 bacterial colonies analyzed. The numbers of bacterial colonies analyzed are specified above the histograms for each CRC cell lines tested. The P values refer to the comparison of all cell lines.

    Techniques Used: Non-Homologous End Joining

    4) Product Images from "Interaction of Vitamin D Receptor with HLA DRB1*0301 in Type 1 Diabetes Patients from North India"

    Article Title: Interaction of Vitamin D Receptor with HLA DRB1*0301 in Type 1 Diabetes Patients from North India

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0008023

    The genotypes for the four SNPs were determined by PCR amplification and restriction digestion of the PCR products with enzymes FokI, BsmI, ApaI , and TaqI . A: Fok1 digestion: SNP C/T in exon 2 was studied by amplifying a 265 bp fragment using primers 5′AGCTGGCCCTGGCACTGACTCTTGCTCT 3′ and 5′ATGGAAACACCTTGCTTCTTCTCCCTC 3′ with 68°C as annealing temperature and digestion by fok1 at 37°C for 3 hours. Presence of restriction site is denoted by ‘f’ while absence of restriction is denoted by ‘F’. Results show FF (CC) i.e., a 265 bp band or Ff (CT) i.e., 265 bp, 196 bp and 69 bp, bands, ff (TT) i.e., 196 bp and 69 bp bands. M is the100 bp ladder. B: Bsm 1 digestion: SNP A/G in Intron 8 was studied by amplifying an 825 bp fragment using primers 5′CAACCAAGACTACAAGTACCGCGTCAGTGA 3′ and 5′AACCAGCGGGAAGAGGTCAAGGG 3′ with 65°C as annealing temperature and digestion by Bsm1 at 65°C for one hour. Presence of restriction site is denoted as ‘b’ and absence of restriction is denoted by ‘B’. The results show BB (AA) i.e., 825 bp band, Bb (AG) i.e., 825 bp, 650 bp and 175 bp and bands and bb (GG) 650 bp and 175 bp bands. M is 25 bp ladder. C: Apa 1 digestion: SNP T/G in Intron 8 was studied by amplifying an 740 bp fragment using primers 5′ CAGAGCATGGACAGGGAGCAAG 3′ and 5′ GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65°C as annealing temperature and digestion by Apa1 at 37°C for one hour. Presence of restriction site is denoted as ‘a; and absence of restriction is denoted by ‘A’. The results show AA (TT) i.e., 740 bp band, Aa (TG) i.e., 740 bp, 520 bp and 220 bp bands and aa (GG) 520 bp and 220 bp bands. M is 100 bp ladder. D: Taq 1 digestion: SNP T/C in exon 9 was studied by amplifying an 740 bp fragment using primers 5′CAGAGCATGGACAGGGAGCAAG 3′ and 5′GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65°C as annealing temperature and digestion by Taq1 at 65°C for one hour. Presence of restriction site is denoted as ‘t’ and absence of restriction is denoted by ‘T’. The results show TT (TT) i.e., 495 bp and 245 bp bands Tt (TC) i.e., 495 bp, 290 bp, 245 bp and 205 bp bands and tt (CC) 290 bp, 245 bp and 205 bp bands. M is 100 bp ladder.
    Figure Legend Snippet: The genotypes for the four SNPs were determined by PCR amplification and restriction digestion of the PCR products with enzymes FokI, BsmI, ApaI , and TaqI . A: Fok1 digestion: SNP C/T in exon 2 was studied by amplifying a 265 bp fragment using primers 5′AGCTGGCCCTGGCACTGACTCTTGCTCT 3′ and 5′ATGGAAACACCTTGCTTCTTCTCCCTC 3′ with 68°C as annealing temperature and digestion by fok1 at 37°C for 3 hours. Presence of restriction site is denoted by ‘f’ while absence of restriction is denoted by ‘F’. Results show FF (CC) i.e., a 265 bp band or Ff (CT) i.e., 265 bp, 196 bp and 69 bp, bands, ff (TT) i.e., 196 bp and 69 bp bands. M is the100 bp ladder. B: Bsm 1 digestion: SNP A/G in Intron 8 was studied by amplifying an 825 bp fragment using primers 5′CAACCAAGACTACAAGTACCGCGTCAGTGA 3′ and 5′AACCAGCGGGAAGAGGTCAAGGG 3′ with 65°C as annealing temperature and digestion by Bsm1 at 65°C for one hour. Presence of restriction site is denoted as ‘b’ and absence of restriction is denoted by ‘B’. The results show BB (AA) i.e., 825 bp band, Bb (AG) i.e., 825 bp, 650 bp and 175 bp and bands and bb (GG) 650 bp and 175 bp bands. M is 25 bp ladder. C: Apa 1 digestion: SNP T/G in Intron 8 was studied by amplifying an 740 bp fragment using primers 5′ CAGAGCATGGACAGGGAGCAAG 3′ and 5′ GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65°C as annealing temperature and digestion by Apa1 at 37°C for one hour. Presence of restriction site is denoted as ‘a; and absence of restriction is denoted by ‘A’. The results show AA (TT) i.e., 740 bp band, Aa (TG) i.e., 740 bp, 520 bp and 220 bp bands and aa (GG) 520 bp and 220 bp bands. M is 100 bp ladder. D: Taq 1 digestion: SNP T/C in exon 9 was studied by amplifying an 740 bp fragment using primers 5′CAGAGCATGGACAGGGAGCAAG 3′ and 5′GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65°C as annealing temperature and digestion by Taq1 at 65°C for one hour. Presence of restriction site is denoted as ‘t’ and absence of restriction is denoted by ‘T’. The results show TT (TT) i.e., 495 bp and 245 bp bands Tt (TC) i.e., 495 bp, 290 bp, 245 bp and 205 bp bands and tt (CC) 290 bp, 245 bp and 205 bp bands. M is 100 bp ladder.

    Techniques Used: Polymerase Chain Reaction, Amplification

    5) Product Images from "The Streptococcus milleri Population of a Cystic Fibrosis Clinic Reveals Patient Specificity and Intraspecies Diversity ▿"

    Article Title: The Streptococcus milleri Population of a Cystic Fibrosis Clinic Reveals Patient Specificity and Intraspecies Diversity ▿

    Journal: Journal of Clinical Microbiology

    doi: 10.1128/JCM.00414-10

    ApaI fingerprints of multiple isolates from two patients with closely related SmaI profiles reveal that the strains are genetically different enough to rule out patient-to-patient transmission. The multiple isolates were recovered at different times (shown
    Figure Legend Snippet: ApaI fingerprints of multiple isolates from two patients with closely related SmaI profiles reveal that the strains are genetically different enough to rule out patient-to-patient transmission. The multiple isolates were recovered at different times (shown

    Techniques Used: Transmission Assay

    6) Product Images from "The Composition of Human Milk and Infant Faecal Microbiota Over the First Three Months of Life: A Pilot Study"

    Article Title: The Composition of Human Milk and Infant Faecal Microbiota Over the First Three Months of Life: A Pilot Study

    Journal: Scientific Reports

    doi: 10.1038/srep40597

    Pulse-field gel electrophoresis patterns of ( a ) XbaI-digested genomic DNA of B. breve isolates and ( b ) ApaI-digested genomic DNA of L. plantarum isolates from human milk and infant faeces. The unedited versions of these images can be found as Supplementary Figures S3 and S4 .
    Figure Legend Snippet: Pulse-field gel electrophoresis patterns of ( a ) XbaI-digested genomic DNA of B. breve isolates and ( b ) ApaI-digested genomic DNA of L. plantarum isolates from human milk and infant faeces. The unedited versions of these images can be found as Supplementary Figures S3 and S4 .

    Techniques Used: Nucleic Acid Electrophoresis

    7) Product Images from "Discrimination between Onchocerca volvulus and O. ochengi filarial larvae in Simulium damnosum (s.l.) and their distribution throughout central Ghana using a versatile high-resolution speciation assay"

    Article Title: Discrimination between Onchocerca volvulus and O. ochengi filarial larvae in Simulium damnosum (s.l.) and their distribution throughout central Ghana using a versatile high-resolution speciation assay

    Journal: Parasites & Vectors

    doi: 10.1186/s13071-016-1832-7

    Genetic discrimination of O. volvulus and O. ochengi . a Sequence of the PCR 79-bp amplicon used to discriminate between O. volvulus and O. ochengi . Nucleotide differences between the two species are highlighted in bold, and the ApaI restriction site present in the O. volvulus sequence is underlined. b Normalised HRM melt curves from cloned positive control 79-bp products (pGem_Ov and pGem_Oo), adult O. volvulus and O. ochengi DNA, and 4 larvae samples from both species, each in duplicate. Curve colour of the larval samples is automatically determined based on the clustering of melt curves to the O. volvulus (green) and O. ochengi (red) adult samples. c The same samples are presented as in ( b ), showing HRM difference curves, which accentuate differences between the melt curve clusters in ( b ), normalised to the O. ochengi cluster. d Representative RFLP analysis of amplicons generated in the HRM assay for each species, showing digestion of the O. volvulus sequence, but not the O. ochengi sequence, with ApaI
    Figure Legend Snippet: Genetic discrimination of O. volvulus and O. ochengi . a Sequence of the PCR 79-bp amplicon used to discriminate between O. volvulus and O. ochengi . Nucleotide differences between the two species are highlighted in bold, and the ApaI restriction site present in the O. volvulus sequence is underlined. b Normalised HRM melt curves from cloned positive control 79-bp products (pGem_Ov and pGem_Oo), adult O. volvulus and O. ochengi DNA, and 4 larvae samples from both species, each in duplicate. Curve colour of the larval samples is automatically determined based on the clustering of melt curves to the O. volvulus (green) and O. ochengi (red) adult samples. c The same samples are presented as in ( b ), showing HRM difference curves, which accentuate differences between the melt curve clusters in ( b ), normalised to the O. ochengi cluster. d Representative RFLP analysis of amplicons generated in the HRM assay for each species, showing digestion of the O. volvulus sequence, but not the O. ochengi sequence, with ApaI

    Techniques Used: Sequencing, Polymerase Chain Reaction, Amplification, Clone Assay, Positive Control, Generated, HRM Assay

    8) Product Images from "Basement membrane collagen IV: Isolation of functional domains"

    Article Title: Basement membrane collagen IV: Isolation of functional domains

    Journal: Methods in cell biology

    doi: 10.1016/bs.mcb.2017.08.010

    Expression of recombinant α1–α6 NC1 domains. (A) Map of the pRc-X expression vector showing positions of BM40 signal peptide, FLAG tag and NheI, ApaI/SacII sites used for cloning human NC1 domains. (B) SDS-PAGE of purified α1–α6 NC1 proteins (2 µg/lane). Small variations of MW are due to the presence of short additional Gly-X-Y repeats from collagenous domain in the α1, α3, α4, and α5 NC1s.
    Figure Legend Snippet: Expression of recombinant α1–α6 NC1 domains. (A) Map of the pRc-X expression vector showing positions of BM40 signal peptide, FLAG tag and NheI, ApaI/SacII sites used for cloning human NC1 domains. (B) SDS-PAGE of purified α1–α6 NC1 proteins (2 µg/lane). Small variations of MW are due to the presence of short additional Gly-X-Y repeats from collagenous domain in the α1, α3, α4, and α5 NC1s.

    Techniques Used: Expressing, Recombinant, Plasmid Preparation, FLAG-tag, Clone Assay, SDS Page, Purification

    9) Product Images from "Diversity of Proteolytic Clostridium botulinum Strains, Determined by a Pulsed-Field Gel Electrophoresis Approach"

    Article Title: Diversity of Proteolytic Clostridium botulinum Strains, Determined by a Pulsed-Field Gel Electrophoresis Approach

    Journal:

    doi: 10.1128/AEM.71.3.1311-1317.2005

    Digestion patterns of type A (ATCC 3502) and type B (FT 243) proteolytic C. botulinum strains using the rare-cutting restriction enzymes ApaI, AscI, MluI, NruI, PmeI, and RsrII. The pulse time ramp was 1 to 22 s, and the running time was 20 h. The outermost
    Figure Legend Snippet: Digestion patterns of type A (ATCC 3502) and type B (FT 243) proteolytic C. botulinum strains using the rare-cutting restriction enzymes ApaI, AscI, MluI, NruI, PmeI, and RsrII. The pulse time ramp was 1 to 22 s, and the running time was 20 h. The outermost

    Techniques Used:

    10) Product Images from "Targeted gene disruption in Candida parapsilosis demonstrates a role for CPAR2_404800 in adhesion to a biotic surface and in a murine model of ascending urinary tract infection"

    Article Title: Targeted gene disruption in Candida parapsilosis demonstrates a role for CPAR2_404800 in adhesion to a biotic surface and in a murine model of ascending urinary tract infection

    Journal: Virulence

    doi: 10.1080/21505594.2015.1112491

    CpAls7 disruption strategy based on SAT1 flipper cassette ( A ). Upstream and downstream homology sequences from C. parapsilosis reference strain ATCC 22019 were amplified and inserted at the ApaI/XhoI and SacII/SacI sites surrounding the SAT1 flipper cassette.
    Figure Legend Snippet: CpAls7 disruption strategy based on SAT1 flipper cassette ( A ). Upstream and downstream homology sequences from C. parapsilosis reference strain ATCC 22019 were amplified and inserted at the ApaI/XhoI and SacII/SacI sites surrounding the SAT1 flipper cassette.

    Techniques Used: Amplification

    11) Product Images from "Targeted gene disruption in Candida parapsilosis demonstrates a role for CPAR2_404800 in adhesion to a biotic surface and in a murine model of ascending urinary tract infection"

    Article Title: Targeted gene disruption in Candida parapsilosis demonstrates a role for CPAR2_404800 in adhesion to a biotic surface and in a murine model of ascending urinary tract infection

    Journal: Virulence

    doi: 10.1080/21505594.2015.1112491

    CpAls7 disruption strategy based on SAT1 flipper cassette ( A ). Upstream and downstream homology sequences from C. parapsilosis reference strain ATCC 22019 were amplified and inserted at the ApaI/XhoI and SacII/SacI sites surrounding the SAT1 flipper cassette.
    Figure Legend Snippet: CpAls7 disruption strategy based on SAT1 flipper cassette ( A ). Upstream and downstream homology sequences from C. parapsilosis reference strain ATCC 22019 were amplified and inserted at the ApaI/XhoI and SacII/SacI sites surrounding the SAT1 flipper cassette.

    Techniques Used: Amplification

    12) Product Images from "A rapid method for assessing the RNA-binding potential of a protein"

    Article Title: A rapid method for assessing the RNA-binding potential of a protein

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gks285

    Schematic of ssRNA Pentaprobe production. pcDNA3.1 vector containing a dsDNA Pentaprobe sequence under the control of a T7 promoter site is linearized and the in vitro transcribed to produce a ssRNA sequence encoding the Pentaprobe sequence. Highlighted is the ApaI restriction site (purple), T7 promoter site (pink), the encoded DNA sequence (blue) and the resulting ssRNA probe sequence (blue).
    Figure Legend Snippet: Schematic of ssRNA Pentaprobe production. pcDNA3.1 vector containing a dsDNA Pentaprobe sequence under the control of a T7 promoter site is linearized and the in vitro transcribed to produce a ssRNA sequence encoding the Pentaprobe sequence. Highlighted is the ApaI restriction site (purple), T7 promoter site (pink), the encoded DNA sequence (blue) and the resulting ssRNA probe sequence (blue).

    Techniques Used: Plasmid Preparation, Sequencing, In Vitro

    13) Product Images from "Widespread inhibition, antagonism, and synergy in mouse olfactory sensory neurons in vivo"

    Article Title: Widespread inhibition, antagonism, and synergy in mouse olfactory sensory neurons in vivo

    Journal: bioRxiv

    doi: 10.1101/803908

    OSN-specific GABAR B1 and D2R knockout mice, Related to Figure 2 . (A) Gene targeting at Drd2 locus. We obtained germline transmission from one ES clone, HEPD064_5_D11. The Drd2 locus in Drd2 tm1a , Drd2 fl (= Drd tm1c ) and Drd cKO . Drd2 +/ tm1a mice were crossed with Flp mice to obtain Drd2 +/ fl . ( C ) Gene targeting at Gabbr1 locus. We obtained germline transmission from one ES clone, EPD0730_1_G04. ( D ) The Gabbr1 locus in Gabbr1 tm1a , Gabbr1 fl (= Gabbr1 tm1c ), and Gabbr1 cKO . Gabbr1 +/ tm1a mice were crossed with Flp mice to obtain Gabbr1 +/ fl . ( E-G ) Southern blot analysis on Drd2 +/+ and Drd2 tm1a /+ ( E , Drd2 probe), Gabbr1 +/+ and Gabbr1 tm1a /+ ( F , Gabbr1 probe); Drd2 tm1a /+ and Gabbr1 tm1a /+ ( G , neo r probe). ( H ) Immunostaining of D2R in the OB of OSN-specific Drd2 mutant mice. ( I ) Immunostaining of GABAR B1 in the OB of OSN-specific Gabbr1 mutant mice. Location of 5’ and 3’ arms for gene targeting and 5’ and 3’ DNA probes for southern blotting are shown in ( A ) and ( C ). KpnI (K), SpeI (S), XhoI (X) and ApaI (A).
    Figure Legend Snippet: OSN-specific GABAR B1 and D2R knockout mice, Related to Figure 2 . (A) Gene targeting at Drd2 locus. We obtained germline transmission from one ES clone, HEPD064_5_D11. The Drd2 locus in Drd2 tm1a , Drd2 fl (= Drd tm1c ) and Drd cKO . Drd2 +/ tm1a mice were crossed with Flp mice to obtain Drd2 +/ fl . ( C ) Gene targeting at Gabbr1 locus. We obtained germline transmission from one ES clone, EPD0730_1_G04. ( D ) The Gabbr1 locus in Gabbr1 tm1a , Gabbr1 fl (= Gabbr1 tm1c ), and Gabbr1 cKO . Gabbr1 +/ tm1a mice were crossed with Flp mice to obtain Gabbr1 +/ fl . ( E-G ) Southern blot analysis on Drd2 +/+ and Drd2 tm1a /+ ( E , Drd2 probe), Gabbr1 +/+ and Gabbr1 tm1a /+ ( F , Gabbr1 probe); Drd2 tm1a /+ and Gabbr1 tm1a /+ ( G , neo r probe). ( H ) Immunostaining of D2R in the OB of OSN-specific Drd2 mutant mice. ( I ) Immunostaining of GABAR B1 in the OB of OSN-specific Gabbr1 mutant mice. Location of 5’ and 3’ arms for gene targeting and 5’ and 3’ DNA probes for southern blotting are shown in ( A ) and ( C ). KpnI (K), SpeI (S), XhoI (X) and ApaI (A).

    Techniques Used: Knock-Out, Mouse Assay, Transmission Assay, Southern Blot, Immunostaining, Mutagenesis

    14) Product Images from "Sphingobacterium respiratory tract infection in patients with cystic fibrosis"

    Article Title: Sphingobacterium respiratory tract infection in patients with cystic fibrosis

    Journal: BMC Research Notes

    doi: 10.1186/1756-0500-2-262

    PFGE profiles of genomic DNA digested with ApaI of Sphingobacterium strains . From lanes 1 to 4: S. spiritovorum strains from A to D profiles, respectively. From lanes 5 to 7: S. multivorum strains from E to G profiles, respectively. Molecular size markers (a ladder of lambda phage DNA concatemers) were run in lanes St. Sizes are indicated in kilobases.
    Figure Legend Snippet: PFGE profiles of genomic DNA digested with ApaI of Sphingobacterium strains . From lanes 1 to 4: S. spiritovorum strains from A to D profiles, respectively. From lanes 5 to 7: S. multivorum strains from E to G profiles, respectively. Molecular size markers (a ladder of lambda phage DNA concatemers) were run in lanes St. Sizes are indicated in kilobases.

    Techniques Used:

    15) Product Images from "Improved Method for Rapid and Efficient Determination of Genome Replication and Protein Expression of Clinical Hepatitis B Virus Isolates ▿"

    Article Title: Improved Method for Rapid and Efficient Determination of Genome Replication and Protein Expression of Clinical Hepatitis B Virus Isolates ▿

    Journal: Journal of Clinical Microbiology

    doi: 10.1128/JCM.02340-10

    Replication capacity of the HBV genome linearized by ApaI and SphI restriction enzymes. The EcoRI dimer of clone 4B was digested with ApaI or SphI, with or without further treatment with T4 DNA ligase before transfection into Huh7 cells. The uncut dimer
    Figure Legend Snippet: Replication capacity of the HBV genome linearized by ApaI and SphI restriction enzymes. The EcoRI dimer of clone 4B was digested with ApaI or SphI, with or without further treatment with T4 DNA ligase before transfection into Huh7 cells. The uncut dimer

    Techniques Used: Transfection

    16) Product Images from "Lytic Myophage Abp53 Encodes Several Proteins Similar to Those Encoded by Host Acinetobacter baumannii and Phage phiKO2 ▿ and Phage phiKO2 ▿ †"

    Article Title: Lytic Myophage Abp53 Encodes Several Proteins Similar to Those Encoded by Host Acinetobacter baumannii and Phage phiKO2 ▿ and Phage phiKO2 ▿ †

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.05116-11

    Dendrogram based on PFGE patterns of ApaI-digested chromosomal DNAs from 10 different A. baumannii strains. Electrophoresis was performed with 0.8% agarose at 13°C (6 V/cm; high, 35 s; low, 2.2 s; in a linear manner for 18 h). The dendrogram was
    Figure Legend Snippet: Dendrogram based on PFGE patterns of ApaI-digested chromosomal DNAs from 10 different A. baumannii strains. Electrophoresis was performed with 0.8% agarose at 13°C (6 V/cm; high, 35 s; low, 2.2 s; in a linear manner for 18 h). The dendrogram was

    Techniques Used: Electrophoresis

    17) Product Images from "The Impact of Inadequate Terminal Disinfection on an Outbreak of Imipenem-Resistant Acinetobacter baumannii in an Intensive Care Unit"

    Article Title: The Impact of Inadequate Terminal Disinfection on an Outbreak of Imipenem-Resistant Acinetobacter baumannii in an Intensive Care Unit

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0107975

    Pulsed-field gel electrophoresis (PFGE) profiles of 48 imipenem-resistant A. baumannii isolates digested with ApaI. Red line indicated the 85% similarity values of PFGE profiles. P: clinical isolate from patient; E: environmental isolate.
    Figure Legend Snippet: Pulsed-field gel electrophoresis (PFGE) profiles of 48 imipenem-resistant A. baumannii isolates digested with ApaI. Red line indicated the 85% similarity values of PFGE profiles. P: clinical isolate from patient; E: environmental isolate.

    Techniques Used: Pulsed-Field Gel, Electrophoresis

    18) Product Images from "Lack of association between glutathione peroxidase1 (GPx1) activity, Pro198Leu polymorphism and stenosis of coronary arteries: A population-based prediction"

    Article Title: Lack of association between glutathione peroxidase1 (GPx1) activity, Pro198Leu polymorphism and stenosis of coronary arteries: A population-based prediction

    Journal: Meta Gene

    doi: 10.1016/j.mgene.2014.09.007

    Digestion of PCR product. The PCR products were digested with ApaI and were run on gel (3%). A; TT Homozygote (undigested fragment 1195 bp). B; CT Heterozygote (undigested and digested fragments 1195 bp, 1131 bp and 64 bp). C; CC Homozygote (digested fragments 1131 bp and 64 bp).
    Figure Legend Snippet: Digestion of PCR product. The PCR products were digested with ApaI and were run on gel (3%). A; TT Homozygote (undigested fragment 1195 bp). B; CT Heterozygote (undigested and digested fragments 1195 bp, 1131 bp and 64 bp). C; CC Homozygote (digested fragments 1131 bp and 64 bp).

    Techniques Used: Polymerase Chain Reaction

    19) Product Images from "Aspartoacylase-LacZ Knockin Mice: An Engineered Model of Canavan Disease"

    Article Title: Aspartoacylase-LacZ Knockin Mice: An Engineered Model of Canavan Disease

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0020336

    Generation of aspa lacZ mice by homologous recombination. A, Genomic structure of the murine aspa locus, which spans 6 exons (black boxes). Homologous recombination of the targeting vector inserts the βgeo cassette (blue box), encoding β-Galactosidase (lacZ), into intron 1 of the intact aspa gene. This cassette is flanked by frt-sites (green circles). Additional loxP sites flank exon 2 (red triangles). The vector includes a DTA cassette for negative selection. In the targeted allele, exon 1 is spliced to the splice acceptor site preceding βgeo, and transcription is terminated at the introduced pA site. The conditional aspa flox allele is produced by breeding aspa lacZ mutants to FLP-deleter mice [40] for recombination of the βgeo cassette in vivo . Note that frt and loxP sites are not drawn to scale. βgeo, β-galactosidase-neomycin resistance cassette; SA, splice acceptor; pA, polyadenylation site, DTA, Diphteria toxin gene. B, For Southern blot analysis genomic DNA was digested with SmaI/ApaI. The neo probe (white box in A) detected the expected 7.5 kb band in heterozygotes and homozygotes. C, Genomic PCR of littermates with primers 1 3 produces the expected amplicons in aspa +/+ (336 bp), aspa lacZ/+ (387 bp and 336 bp) and aspa lacZ/lacZ (387 bp) animals. The upstream loxP site was detected by PCR with primers 1 2 yielding a 307 bp band. D, Q-RT-PCR using a TaqMan probe for quantification of aspa mRNA levels in brains of aspa +/+ , aspa lacZ/+ , and aspa lacZ/lacZ mice (n = 3) confirms the attenuation of transcription downstream of exon 2 in the targeted allele. E, Representative Western blot of whole brain lysates of a spa +/+ , aspa lacZ/+ and aspa lacZ/lacZ mice (aged 4 months, n = 3). The 37 kD protein ASPA was detected in aspa +/+ and aspa lacZ/+ mice but not in aspa lacZ/lacZ mutants. β-Galactosidase is expressed in aspa lacZ/+ and aspa lacZ/lacZ brain but not controls. α-Tubulin was used as loading control. F. Representative picture of a male aspa lacZ/lacZ mutant (asterisk) and an aspa +/+ littermate at P70.
    Figure Legend Snippet: Generation of aspa lacZ mice by homologous recombination. A, Genomic structure of the murine aspa locus, which spans 6 exons (black boxes). Homologous recombination of the targeting vector inserts the βgeo cassette (blue box), encoding β-Galactosidase (lacZ), into intron 1 of the intact aspa gene. This cassette is flanked by frt-sites (green circles). Additional loxP sites flank exon 2 (red triangles). The vector includes a DTA cassette for negative selection. In the targeted allele, exon 1 is spliced to the splice acceptor site preceding βgeo, and transcription is terminated at the introduced pA site. The conditional aspa flox allele is produced by breeding aspa lacZ mutants to FLP-deleter mice [40] for recombination of the βgeo cassette in vivo . Note that frt and loxP sites are not drawn to scale. βgeo, β-galactosidase-neomycin resistance cassette; SA, splice acceptor; pA, polyadenylation site, DTA, Diphteria toxin gene. B, For Southern blot analysis genomic DNA was digested with SmaI/ApaI. The neo probe (white box in A) detected the expected 7.5 kb band in heterozygotes and homozygotes. C, Genomic PCR of littermates with primers 1 3 produces the expected amplicons in aspa +/+ (336 bp), aspa lacZ/+ (387 bp and 336 bp) and aspa lacZ/lacZ (387 bp) animals. The upstream loxP site was detected by PCR with primers 1 2 yielding a 307 bp band. D, Q-RT-PCR using a TaqMan probe for quantification of aspa mRNA levels in brains of aspa +/+ , aspa lacZ/+ , and aspa lacZ/lacZ mice (n = 3) confirms the attenuation of transcription downstream of exon 2 in the targeted allele. E, Representative Western blot of whole brain lysates of a spa +/+ , aspa lacZ/+ and aspa lacZ/lacZ mice (aged 4 months, n = 3). The 37 kD protein ASPA was detected in aspa +/+ and aspa lacZ/+ mice but not in aspa lacZ/lacZ mutants. β-Galactosidase is expressed in aspa lacZ/+ and aspa lacZ/lacZ brain but not controls. α-Tubulin was used as loading control. F. Representative picture of a male aspa lacZ/lacZ mutant (asterisk) and an aspa +/+ littermate at P70.

    Techniques Used: Mouse Assay, Homologous Recombination, Plasmid Preparation, Selection, Produced, In Vivo, Southern Blot, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Western Blot, Mutagenesis

    Related Articles

    Plasmid Preparation:

    Article Title: Effects of camptothecin on double-strand break repair by non-homologous end-joining in DNA mismatch repair-deficient human colorectal cancer cell lines
    Article Snippet: Plasmid preparation The pHRecSJ plasmid used in the in vivo cell end-joining assay contains the prokaryotic ColEI origin and the β-lactamase gene (AmpR), and was kindly given by Dora Papadopoulo ( ). .. The plasmid was linearized with restriction enzymes that recognize a unique site within the substrate: EcoRI [5′-protruding single stranded (PSS) cohesive ends], ApaI (3′-PSS cohesive ends) or both enzymes together (non-complementary ends) (New England Biolabs). ..

    Polymerase Chain Reaction:

    Article Title: Interaction of Vitamin D Receptor with HLA DRB1*0301 in Type 1 Diabetes Patients from North India
    Article Snippet: .. Genotypic Analysis of VDR Polymorphisms The genotypes for the four SNPs were determined by PCR amplification and restriction digestion of the PCR products with enzymes FokI, BsmI, ApaI , and TaqI as described earlier , Briefly, 500 ng of DNA was amplified in 5 µl of 10X Thermo Pol reaction buffer supplemented with 2 mM MgSO4 (New England Biolabs), 5 pm of each primers, 0.25 mM of dNTPs, and 1.25 U of Taq DNA Polymerase (New England Biolabs), under standard conditions for 35 cycles in Perkin Elmer 2700 thermocycler. ..

    Article Title: Loss of imprinting of insulin-like growth factor 2 is associated with increased risk of lymph node metastasis and gastric corpus cancer
    Article Snippet: Conditions for amplification were 94°C for 2 min followed by 30 cycles at 94°C for 30 sec, 54 c, 56°C and 58°C (for the LIT1, IGF2 and H19 respectively) for 1 min, and 72°C for 1 min. A final step was 72°C for 5 min. .. The PCR products were subject to RsaI, ApaI and HinfI and RsaI (New England Biolabs, Beverly, Mass, USA) enzyme digestion at 37°C overnight, run through 12% acrylamide gel and stained with ethidium bromide respectively. .. The expected size of the PCR fragment of the LIT1 gene is 410 bp.

    Article Title: Vitamin D Receptor Gene Polymorphisms and Prognosis of Breast Cancer among African-American and Hispanic Women
    Article Snippet: Annealing temperature for BsmI, ApaI/TaqI and FokI PCR are 63.5°C, 61°C and 59.5°C, respectively. .. Following PCR, aliquots of the amplified PCR products was digested with BsmI, ApaI, TaqI and FokI in accordance with the manufacturer's specifications (New England Biolabs, Beverly, MA, USA). .. The presence (lowercase) or absence (uppercase) of the enzyme recognition site was identified by ethidium bromide staining of fragments separated in a 2% agarose gel.

    Article Title: Discrimination between Onchocerca volvulus and O. ochengi filarial larvae in Simulium damnosum (s.l.) and their distribution throughout central Ghana using a versatile high-resolution speciation assay
    Article Snippet: .. A 20 μl reaction consisting of 10 μl PCR product together with 0.5 μl ApaI (50,000 U/ml; New England Biolabs, USA), 2 μl of CloneSmart buffer and 7.5 μl of HPLC-grade water was incubated for 3 h at 25 °C, after which the products were run on a 2 % agarose gel at 100 V for 50 mins and visualised using GelRed DNA stain (Biotum, Freemont, USA). .. Results and discussion Whole mitochondrial genome alignments of the O. volvulus (NC_001861; [ ]) and O. ochengi (obtained from genomic sequence available at http://www.nematodes.org/genomes/onchocerca_ochengi/ ; Blaxter Lab, University of Edinburgh) sequences was performed to identify a PCR compatible region that contained (i) a restriction site that was unique to one species, and (ii) additional polymorphism(s) that would result in a difference in the melting temperature between amplicons generated for each of the 2 species.

    Amplification:

    Article Title: Interaction of Vitamin D Receptor with HLA DRB1*0301 in Type 1 Diabetes Patients from North India
    Article Snippet: .. Genotypic Analysis of VDR Polymorphisms The genotypes for the four SNPs were determined by PCR amplification and restriction digestion of the PCR products with enzymes FokI, BsmI, ApaI , and TaqI as described earlier , Briefly, 500 ng of DNA was amplified in 5 µl of 10X Thermo Pol reaction buffer supplemented with 2 mM MgSO4 (New England Biolabs), 5 pm of each primers, 0.25 mM of dNTPs, and 1.25 U of Taq DNA Polymerase (New England Biolabs), under standard conditions for 35 cycles in Perkin Elmer 2700 thermocycler. ..

    Article Title: Vitamin D Receptor Gene Polymorphisms and Prognosis of Breast Cancer among African-American and Hispanic Women
    Article Snippet: Annealing temperature for BsmI, ApaI/TaqI and FokI PCR are 63.5°C, 61°C and 59.5°C, respectively. .. Following PCR, aliquots of the amplified PCR products was digested with BsmI, ApaI, TaqI and FokI in accordance with the manufacturer's specifications (New England Biolabs, Beverly, MA, USA). .. The presence (lowercase) or absence (uppercase) of the enzyme recognition site was identified by ethidium bromide staining of fragments separated in a 2% agarose gel.

    Acrylamide Gel Assay:

    Article Title: Loss of imprinting of insulin-like growth factor 2 is associated with increased risk of lymph node metastasis and gastric corpus cancer
    Article Snippet: Conditions for amplification were 94°C for 2 min followed by 30 cycles at 94°C for 30 sec, 54 c, 56°C and 58°C (for the LIT1, IGF2 and H19 respectively) for 1 min, and 72°C for 1 min. A final step was 72°C for 5 min. .. The PCR products were subject to RsaI, ApaI and HinfI and RsaI (New England Biolabs, Beverly, Mass, USA) enzyme digestion at 37°C overnight, run through 12% acrylamide gel and stained with ethidium bromide respectively. .. The expected size of the PCR fragment of the LIT1 gene is 410 bp.

    Staining:

    Article Title: Loss of imprinting of insulin-like growth factor 2 is associated with increased risk of lymph node metastasis and gastric corpus cancer
    Article Snippet: Conditions for amplification were 94°C for 2 min followed by 30 cycles at 94°C for 30 sec, 54 c, 56°C and 58°C (for the LIT1, IGF2 and H19 respectively) for 1 min, and 72°C for 1 min. A final step was 72°C for 5 min. .. The PCR products were subject to RsaI, ApaI and HinfI and RsaI (New England Biolabs, Beverly, Mass, USA) enzyme digestion at 37°C overnight, run through 12% acrylamide gel and stained with ethidium bromide respectively. .. The expected size of the PCR fragment of the LIT1 gene is 410 bp.

    Article Title: Discrimination between Onchocerca volvulus and O. ochengi filarial larvae in Simulium damnosum (s.l.) and their distribution throughout central Ghana using a versatile high-resolution speciation assay
    Article Snippet: .. A 20 μl reaction consisting of 10 μl PCR product together with 0.5 μl ApaI (50,000 U/ml; New England Biolabs, USA), 2 μl of CloneSmart buffer and 7.5 μl of HPLC-grade water was incubated for 3 h at 25 °C, after which the products were run on a 2 % agarose gel at 100 V for 50 mins and visualised using GelRed DNA stain (Biotum, Freemont, USA). .. Results and discussion Whole mitochondrial genome alignments of the O. volvulus (NC_001861; [ ]) and O. ochengi (obtained from genomic sequence available at http://www.nematodes.org/genomes/onchocerca_ochengi/ ; Blaxter Lab, University of Edinburgh) sequences was performed to identify a PCR compatible region that contained (i) a restriction site that was unique to one species, and (ii) additional polymorphism(s) that would result in a difference in the melting temperature between amplicons generated for each of the 2 species.

    High Performance Liquid Chromatography:

    Article Title: Discrimination between Onchocerca volvulus and O. ochengi filarial larvae in Simulium damnosum (s.l.) and their distribution throughout central Ghana using a versatile high-resolution speciation assay
    Article Snippet: .. A 20 μl reaction consisting of 10 μl PCR product together with 0.5 μl ApaI (50,000 U/ml; New England Biolabs, USA), 2 μl of CloneSmart buffer and 7.5 μl of HPLC-grade water was incubated for 3 h at 25 °C, after which the products were run on a 2 % agarose gel at 100 V for 50 mins and visualised using GelRed DNA stain (Biotum, Freemont, USA). .. Results and discussion Whole mitochondrial genome alignments of the O. volvulus (NC_001861; [ ]) and O. ochengi (obtained from genomic sequence available at http://www.nematodes.org/genomes/onchocerca_ochengi/ ; Blaxter Lab, University of Edinburgh) sequences was performed to identify a PCR compatible region that contained (i) a restriction site that was unique to one species, and (ii) additional polymorphism(s) that would result in a difference in the melting temperature between amplicons generated for each of the 2 species.

    Incubation:

    Article Title: Discrimination between Onchocerca volvulus and O. ochengi filarial larvae in Simulium damnosum (s.l.) and their distribution throughout central Ghana using a versatile high-resolution speciation assay
    Article Snippet: .. A 20 μl reaction consisting of 10 μl PCR product together with 0.5 μl ApaI (50,000 U/ml; New England Biolabs, USA), 2 μl of CloneSmart buffer and 7.5 μl of HPLC-grade water was incubated for 3 h at 25 °C, after which the products were run on a 2 % agarose gel at 100 V for 50 mins and visualised using GelRed DNA stain (Biotum, Freemont, USA). .. Results and discussion Whole mitochondrial genome alignments of the O. volvulus (NC_001861; [ ]) and O. ochengi (obtained from genomic sequence available at http://www.nematodes.org/genomes/onchocerca_ochengi/ ; Blaxter Lab, University of Edinburgh) sequences was performed to identify a PCR compatible region that contained (i) a restriction site that was unique to one species, and (ii) additional polymorphism(s) that would result in a difference in the melting temperature between amplicons generated for each of the 2 species.

    Agarose Gel Electrophoresis:

    Article Title: Discrimination between Onchocerca volvulus and O. ochengi filarial larvae in Simulium damnosum (s.l.) and their distribution throughout central Ghana using a versatile high-resolution speciation assay
    Article Snippet: .. A 20 μl reaction consisting of 10 μl PCR product together with 0.5 μl ApaI (50,000 U/ml; New England Biolabs, USA), 2 μl of CloneSmart buffer and 7.5 μl of HPLC-grade water was incubated for 3 h at 25 °C, after which the products were run on a 2 % agarose gel at 100 V for 50 mins and visualised using GelRed DNA stain (Biotum, Freemont, USA). .. Results and discussion Whole mitochondrial genome alignments of the O. volvulus (NC_001861; [ ]) and O. ochengi (obtained from genomic sequence available at http://www.nematodes.org/genomes/onchocerca_ochengi/ ; Blaxter Lab, University of Edinburgh) sequences was performed to identify a PCR compatible region that contained (i) a restriction site that was unique to one species, and (ii) additional polymorphism(s) that would result in a difference in the melting temperature between amplicons generated for each of the 2 species.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs apai
    Imprinting analysis of IGF2 in gastric cancer . DNA (G1) and <t>RT-PCR</t> (G3) amplification using primers P1 and P3 and DNA amplification by PCR with primers P2 and P3 (G2) represented 1.4 kb, 1.12 kb and 292 bp respectively (see details in methods section). G1, G2 and G3 are PCR products of the same normal tissue. <t>ApaI-</t> and HinfI-digested normal tissue DNA PCR (Gn) from primers P2 and P3 displayed two bands of 256 and 231 bp indicating heterozygosity. The digested nested PCR product from primers P2 and P3 using the 1.12 kb RT-PCR product as a template showed monoallelic expression of IGF2 in normal (Rn1, Rn2) and biallelic expression in tumor (Rt1, Rt2) tissues.
    Apai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/apai/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    apai - by Bioz Stars, 2021-05
    99/100 stars
      Buy from Supplier

    Image Search Results


    Imprinting analysis of IGF2 in gastric cancer . DNA (G1) and RT-PCR (G3) amplification using primers P1 and P3 and DNA amplification by PCR with primers P2 and P3 (G2) represented 1.4 kb, 1.12 kb and 292 bp respectively (see details in methods section). G1, G2 and G3 are PCR products of the same normal tissue. ApaI- and HinfI-digested normal tissue DNA PCR (Gn) from primers P2 and P3 displayed two bands of 256 and 231 bp indicating heterozygosity. The digested nested PCR product from primers P2 and P3 using the 1.12 kb RT-PCR product as a template showed monoallelic expression of IGF2 in normal (Rn1, Rn2) and biallelic expression in tumor (Rt1, Rt2) tissues.

    Journal: Journal of Experimental & Clinical Cancer Research : CR

    Article Title: Loss of imprinting of insulin-like growth factor 2 is associated with increased risk of lymph node metastasis and gastric corpus cancer

    doi: 10.1186/1756-9966-28-125

    Figure Lengend Snippet: Imprinting analysis of IGF2 in gastric cancer . DNA (G1) and RT-PCR (G3) amplification using primers P1 and P3 and DNA amplification by PCR with primers P2 and P3 (G2) represented 1.4 kb, 1.12 kb and 292 bp respectively (see details in methods section). G1, G2 and G3 are PCR products of the same normal tissue. ApaI- and HinfI-digested normal tissue DNA PCR (Gn) from primers P2 and P3 displayed two bands of 256 and 231 bp indicating heterozygosity. The digested nested PCR product from primers P2 and P3 using the 1.12 kb RT-PCR product as a template showed monoallelic expression of IGF2 in normal (Rn1, Rn2) and biallelic expression in tumor (Rt1, Rt2) tissues.

    Article Snippet: The PCR products were subject to RsaI, ApaI and HinfI and RsaI (New England Biolabs, Beverly, Mass, USA) enzyme digestion at 37°C overnight, run through 12% acrylamide gel and stained with ethidium bromide respectively.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction, Nested PCR, Expressing

    Five-year disease free survival (DFS) of breast cancer patients in relation to VDR gene polymorphisms. Kaplan-Meier survival curves were used to compare the 5-year DFS between the VDR gene polymorphisms in (a) VDR-FokI, (b) VDR-BsmI, (c) VDR-ApaI, and (d) VDR-TaqI. The differences between the curves were estimated by log-rank test, where P

    Journal: PLoS ONE

    Article Title: Vitamin D Receptor Gene Polymorphisms and Prognosis of Breast Cancer among African-American and Hispanic Women

    doi: 10.1371/journal.pone.0057967

    Figure Lengend Snippet: Five-year disease free survival (DFS) of breast cancer patients in relation to VDR gene polymorphisms. Kaplan-Meier survival curves were used to compare the 5-year DFS between the VDR gene polymorphisms in (a) VDR-FokI, (b) VDR-BsmI, (c) VDR-ApaI, and (d) VDR-TaqI. The differences between the curves were estimated by log-rank test, where P

    Article Snippet: Following PCR, aliquots of the amplified PCR products was digested with BsmI, ApaI, TaqI and FokI in accordance with the manufacturer's specifications (New England Biolabs, Beverly, MA, USA).

    Techniques:

    Effect of CPT treatment on DSB repair efficiency in CRC cell lines. Cells were treated with 100 nM CPT just after transfection and until plasmid recovery. Histograms represent the mean percentage of repair efficiency established from a minimum of three independent experiments for plasmids linearized with ApaI ( A ), EcoRI ( B ) and ApaI-EcoRI ( C ). The numbers of independent experiments are marked above each histogram for each CRC cell line tested. Only P values statistically different are specified.

    Journal: Nucleic Acids Research

    Article Title: Effects of camptothecin on double-strand break repair by non-homologous end-joining in DNA mismatch repair-deficient human colorectal cancer cell lines

    doi: 10.1093/nar/gki154

    Figure Lengend Snippet: Effect of CPT treatment on DSB repair efficiency in CRC cell lines. Cells were treated with 100 nM CPT just after transfection and until plasmid recovery. Histograms represent the mean percentage of repair efficiency established from a minimum of three independent experiments for plasmids linearized with ApaI ( A ), EcoRI ( B ) and ApaI-EcoRI ( C ). The numbers of independent experiments are marked above each histogram for each CRC cell line tested. Only P values statistically different are specified.

    Article Snippet: The plasmid was linearized with restriction enzymes that recognize a unique site within the substrate: EcoRI [5′-protruding single stranded (PSS) cohesive ends], ApaI (3′-PSS cohesive ends) or both enzymes together (non-complementary ends) (New England Biolabs).

    Techniques: Cycling Probe Technology, Transfection, Plasmid Preparation

    End-joining efficiency of DSB repair by NHEJ in MMR-deficient and MMR-proficient CRC cell lines. Histograms represent the mean percentage of repair efficiency established from a minimum of three independent experiments using plasmids linearized with ApaI ( A ), EcoRI ( B ) and ApaI-EcoRI ( C ). The number of independent experiments is shown above each histogram. The P values refer to the comparison of all cell lines.

    Journal: Nucleic Acids Research

    Article Title: Effects of camptothecin on double-strand break repair by non-homologous end-joining in DNA mismatch repair-deficient human colorectal cancer cell lines

    doi: 10.1093/nar/gki154

    Figure Lengend Snippet: End-joining efficiency of DSB repair by NHEJ in MMR-deficient and MMR-proficient CRC cell lines. Histograms represent the mean percentage of repair efficiency established from a minimum of three independent experiments using plasmids linearized with ApaI ( A ), EcoRI ( B ) and ApaI-EcoRI ( C ). The number of independent experiments is shown above each histogram. The P values refer to the comparison of all cell lines.

    Article Snippet: The plasmid was linearized with restriction enzymes that recognize a unique site within the substrate: EcoRI [5′-protruding single stranded (PSS) cohesive ends], ApaI (3′-PSS cohesive ends) or both enzymes together (non-complementary ends) (New England Biolabs).

    Techniques: Non-Homologous End Joining

    End-joining fidelity of DSB repair by NHEJ in MMR-deficient and MMR-proficient CRC cell lines. Histograms represent the mean frequency in percentage of the error-free events after repair of DSB induced by ApaI ( A ) or EcoRI ( B ) established from a minimum of three independent experiments and a minimum of 250 bacterial colonies analyzed. The numbers of bacterial colonies analyzed are specified above the histograms for each CRC cell lines tested. The P values refer to the comparison of all cell lines.

    Journal: Nucleic Acids Research

    Article Title: Effects of camptothecin on double-strand break repair by non-homologous end-joining in DNA mismatch repair-deficient human colorectal cancer cell lines

    doi: 10.1093/nar/gki154

    Figure Lengend Snippet: End-joining fidelity of DSB repair by NHEJ in MMR-deficient and MMR-proficient CRC cell lines. Histograms represent the mean frequency in percentage of the error-free events after repair of DSB induced by ApaI ( A ) or EcoRI ( B ) established from a minimum of three independent experiments and a minimum of 250 bacterial colonies analyzed. The numbers of bacterial colonies analyzed are specified above the histograms for each CRC cell lines tested. The P values refer to the comparison of all cell lines.

    Article Snippet: The plasmid was linearized with restriction enzymes that recognize a unique site within the substrate: EcoRI [5′-protruding single stranded (PSS) cohesive ends], ApaI (3′-PSS cohesive ends) or both enzymes together (non-complementary ends) (New England Biolabs).

    Techniques: Non-Homologous End Joining

    The genotypes for the four SNPs were determined by PCR amplification and restriction digestion of the PCR products with enzymes FokI, BsmI, ApaI , and TaqI . A: Fok1 digestion: SNP C/T in exon 2 was studied by amplifying a 265 bp fragment using primers 5′AGCTGGCCCTGGCACTGACTCTTGCTCT 3′ and 5′ATGGAAACACCTTGCTTCTTCTCCCTC 3′ with 68°C as annealing temperature and digestion by fok1 at 37°C for 3 hours. Presence of restriction site is denoted by ‘f’ while absence of restriction is denoted by ‘F’. Results show FF (CC) i.e., a 265 bp band or Ff (CT) i.e., 265 bp, 196 bp and 69 bp, bands, ff (TT) i.e., 196 bp and 69 bp bands. M is the100 bp ladder. B: Bsm 1 digestion: SNP A/G in Intron 8 was studied by amplifying an 825 bp fragment using primers 5′CAACCAAGACTACAAGTACCGCGTCAGTGA 3′ and 5′AACCAGCGGGAAGAGGTCAAGGG 3′ with 65°C as annealing temperature and digestion by Bsm1 at 65°C for one hour. Presence of restriction site is denoted as ‘b’ and absence of restriction is denoted by ‘B’. The results show BB (AA) i.e., 825 bp band, Bb (AG) i.e., 825 bp, 650 bp and 175 bp and bands and bb (GG) 650 bp and 175 bp bands. M is 25 bp ladder. C: Apa 1 digestion: SNP T/G in Intron 8 was studied by amplifying an 740 bp fragment using primers 5′ CAGAGCATGGACAGGGAGCAAG 3′ and 5′ GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65°C as annealing temperature and digestion by Apa1 at 37°C for one hour. Presence of restriction site is denoted as ‘a; and absence of restriction is denoted by ‘A’. The results show AA (TT) i.e., 740 bp band, Aa (TG) i.e., 740 bp, 520 bp and 220 bp bands and aa (GG) 520 bp and 220 bp bands. M is 100 bp ladder. D: Taq 1 digestion: SNP T/C in exon 9 was studied by amplifying an 740 bp fragment using primers 5′CAGAGCATGGACAGGGAGCAAG 3′ and 5′GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65°C as annealing temperature and digestion by Taq1 at 65°C for one hour. Presence of restriction site is denoted as ‘t’ and absence of restriction is denoted by ‘T’. The results show TT (TT) i.e., 495 bp and 245 bp bands Tt (TC) i.e., 495 bp, 290 bp, 245 bp and 205 bp bands and tt (CC) 290 bp, 245 bp and 205 bp bands. M is 100 bp ladder.

    Journal: PLoS ONE

    Article Title: Interaction of Vitamin D Receptor with HLA DRB1*0301 in Type 1 Diabetes Patients from North India

    doi: 10.1371/journal.pone.0008023

    Figure Lengend Snippet: The genotypes for the four SNPs were determined by PCR amplification and restriction digestion of the PCR products with enzymes FokI, BsmI, ApaI , and TaqI . A: Fok1 digestion: SNP C/T in exon 2 was studied by amplifying a 265 bp fragment using primers 5′AGCTGGCCCTGGCACTGACTCTTGCTCT 3′ and 5′ATGGAAACACCTTGCTTCTTCTCCCTC 3′ with 68°C as annealing temperature and digestion by fok1 at 37°C for 3 hours. Presence of restriction site is denoted by ‘f’ while absence of restriction is denoted by ‘F’. Results show FF (CC) i.e., a 265 bp band or Ff (CT) i.e., 265 bp, 196 bp and 69 bp, bands, ff (TT) i.e., 196 bp and 69 bp bands. M is the100 bp ladder. B: Bsm 1 digestion: SNP A/G in Intron 8 was studied by amplifying an 825 bp fragment using primers 5′CAACCAAGACTACAAGTACCGCGTCAGTGA 3′ and 5′AACCAGCGGGAAGAGGTCAAGGG 3′ with 65°C as annealing temperature and digestion by Bsm1 at 65°C for one hour. Presence of restriction site is denoted as ‘b’ and absence of restriction is denoted by ‘B’. The results show BB (AA) i.e., 825 bp band, Bb (AG) i.e., 825 bp, 650 bp and 175 bp and bands and bb (GG) 650 bp and 175 bp bands. M is 25 bp ladder. C: Apa 1 digestion: SNP T/G in Intron 8 was studied by amplifying an 740 bp fragment using primers 5′ CAGAGCATGGACAGGGAGCAAG 3′ and 5′ GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65°C as annealing temperature and digestion by Apa1 at 37°C for one hour. Presence of restriction site is denoted as ‘a; and absence of restriction is denoted by ‘A’. The results show AA (TT) i.e., 740 bp band, Aa (TG) i.e., 740 bp, 520 bp and 220 bp bands and aa (GG) 520 bp and 220 bp bands. M is 100 bp ladder. D: Taq 1 digestion: SNP T/C in exon 9 was studied by amplifying an 740 bp fragment using primers 5′CAGAGCATGGACAGGGAGCAAG 3′ and 5′GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65°C as annealing temperature and digestion by Taq1 at 65°C for one hour. Presence of restriction site is denoted as ‘t’ and absence of restriction is denoted by ‘T’. The results show TT (TT) i.e., 495 bp and 245 bp bands Tt (TC) i.e., 495 bp, 290 bp, 245 bp and 205 bp bands and tt (CC) 290 bp, 245 bp and 205 bp bands. M is 100 bp ladder.

    Article Snippet: Genotypic Analysis of VDR Polymorphisms The genotypes for the four SNPs were determined by PCR amplification and restriction digestion of the PCR products with enzymes FokI, BsmI, ApaI , and TaqI as described earlier , Briefly, 500 ng of DNA was amplified in 5 µl of 10X Thermo Pol reaction buffer supplemented with 2 mM MgSO4 (New England Biolabs), 5 pm of each primers, 0.25 mM of dNTPs, and 1.25 U of Taq DNA Polymerase (New England Biolabs), under standard conditions for 35 cycles in Perkin Elmer 2700 thermocycler.

    Techniques: Polymerase Chain Reaction, Amplification