foki  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    FokI
    Description:
    FokI 5 000 units
    Catalog Number:
    r0109l
    Price:
    282
    Size:
    5 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs foki
    FokI
    FokI 5 000 units
    https://www.bioz.com/result/foki/product/New England Biolabs
    Average 95 stars, based on 46 article reviews
    Price from $9.99 to $1999.99
    foki - by Bioz Stars, 2020-09
    95/100 stars

    Images

    1) Product Images from "Vitamin D Receptor Gene Polymorphisms and Prognosis of Breast Cancer among African-American and Hispanic Women"

    Article Title: Vitamin D Receptor Gene Polymorphisms and Prognosis of Breast Cancer among African-American and Hispanic Women

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0057967

    Five-year disease free survival (DFS) of breast cancer patients in relation to VDR gene polymorphisms. Kaplan-Meier survival curves were used to compare the 5-year DFS between the VDR gene polymorphisms in (a) VDR-FokI, (b) VDR-BsmI, (c) VDR-ApaI, and (d) VDR-TaqI. The differences between the curves were estimated by log-rank test, where P
    Figure Legend Snippet: Five-year disease free survival (DFS) of breast cancer patients in relation to VDR gene polymorphisms. Kaplan-Meier survival curves were used to compare the 5-year DFS between the VDR gene polymorphisms in (a) VDR-FokI, (b) VDR-BsmI, (c) VDR-ApaI, and (d) VDR-TaqI. The differences between the curves were estimated by log-rank test, where P

    Techniques Used:

    2) Product Images from "DNA looping by two-site restriction endonucleases: heterogeneous probability distributions for loop size and unbinding force"

    Article Title: DNA looping by two-site restriction endonucleases: heterogeneous probability distributions for loop size and unbinding force

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkl382

    Typical DNA force-extension plots. ( A ) The two-site enzyme BsgI tested on the LBAC-B template, which has four recognition sites. The one detected loop had a measured length of 946 bp, in excellent agreement with the separation between the binding sites at positions 8342 and 9287 bp (a distance of 945 bp). ( B ) Sau3AI on the LBAC-A template, which has 55 recognition sites. ( C ) Control experiments: (i) the two-site enzyme Sau3AI was tested on bacteriophage phiX174 DNA, which contains no copies of its recognition sequence; (ii) the one-site enzyme HaeIII was tested on LBAC-B DNA containing 36 copies of its recognition sequence; (iii) the two-site enzyme SfiI was tested on LBAC-B DNA containing one copy of its recognition sequence and (iv) LBAC-B DNA, containing 26 FokI binding sites, incubated in the FokI reaction buffer, but no FokI added.
    Figure Legend Snippet: Typical DNA force-extension plots. ( A ) The two-site enzyme BsgI tested on the LBAC-B template, which has four recognition sites. The one detected loop had a measured length of 946 bp, in excellent agreement with the separation between the binding sites at positions 8342 and 9287 bp (a distance of 945 bp). ( B ) Sau3AI on the LBAC-A template, which has 55 recognition sites. ( C ) Control experiments: (i) the two-site enzyme Sau3AI was tested on bacteriophage phiX174 DNA, which contains no copies of its recognition sequence; (ii) the one-site enzyme HaeIII was tested on LBAC-B DNA containing 36 copies of its recognition sequence; (iii) the two-site enzyme SfiI was tested on LBAC-B DNA containing one copy of its recognition sequence and (iv) LBAC-B DNA, containing 26 FokI binding sites, incubated in the FokI reaction buffer, but no FokI added.

    Techniques Used: Binding Assay, Sequencing, Incubation

    3) Product Images from "DNA base excision repair of uracil residues in reconstituted nucleosome core particles"

    Article Title: DNA base excision repair of uracil residues in reconstituted nucleosome core particles

    Journal: The EMBO Journal

    doi: 10.1093/emboj/cdf581

    Fig. 4. Stability of 146 bp nucleosome core particles. ( A ) The stability of core particles was analysed by incubating uracil-containing (U51) core particles alone (–), with UNG2 (U), SMUG1 and APE1 (S) or with BER enzymes (UNGΔ84 in combination with APE1, Polβ and LigIII; B) for 30 min at 37°C and loaded directly on a native 5% polyacrylamide gel. ( B ) An 8% polyacrylamide/7 M urea/20% formamide gel showing restriction enzyme digestion of naked 146 bp DNA (lanes 1–4), with Fok I (F), Alu I (A) or Mbo I (M). Core particles prior to uracil removal and repair (–), and after incubation with UNG2 (U), SMUG1/APE1 (S) or BER enzymes (B) were digested with Fok I (F), Alu I (A) or Mbo I (M). ( C ) Naked DNA (DNA) and nucleosome core particles (NCP) were subjected to DNase I footprinting prior to uracil removal and repair. Aliquots were removed from naked DNA after 0, 0.5, 1 and 3 min (lanes 1 and 3–5) and from core particles after 0, 0.5, 1, 3, 6 and 15 min (lanes 6–11). A Maxam–Gilbert T-reaction was included (lane 2). Core particles incubated in the presence of SMUG1/APE1 (S) or BER enzymes (B) were subjected to DNase I digestion. Aliquots were taken after 0.5, 1 and 3 min, denatured and analysed in 8% polyacrylamide/7 M urea/20% formamide gels.
    Figure Legend Snippet: Fig. 4. Stability of 146 bp nucleosome core particles. ( A ) The stability of core particles was analysed by incubating uracil-containing (U51) core particles alone (–), with UNG2 (U), SMUG1 and APE1 (S) or with BER enzymes (UNGΔ84 in combination with APE1, Polβ and LigIII; B) for 30 min at 37°C and loaded directly on a native 5% polyacrylamide gel. ( B ) An 8% polyacrylamide/7 M urea/20% formamide gel showing restriction enzyme digestion of naked 146 bp DNA (lanes 1–4), with Fok I (F), Alu I (A) or Mbo I (M). Core particles prior to uracil removal and repair (–), and after incubation with UNG2 (U), SMUG1/APE1 (S) or BER enzymes (B) were digested with Fok I (F), Alu I (A) or Mbo I (M). ( C ) Naked DNA (DNA) and nucleosome core particles (NCP) were subjected to DNase I footprinting prior to uracil removal and repair. Aliquots were removed from naked DNA after 0, 0.5, 1 and 3 min (lanes 1 and 3–5) and from core particles after 0, 0.5, 1, 3, 6 and 15 min (lanes 6–11). A Maxam–Gilbert T-reaction was included (lane 2). Core particles incubated in the presence of SMUG1/APE1 (S) or BER enzymes (B) were subjected to DNase I digestion. Aliquots were taken after 0.5, 1 and 3 min, denatured and analysed in 8% polyacrylamide/7 M urea/20% formamide gels.

    Techniques Used: Incubation, Footprinting

    4) Product Images from "Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease"

    Article Title: Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease

    Journal: BMC Nephrology

    doi: 10.1186/s12882-018-0831-7

    a - d Restriction endonuclease digestion for FokI, ApaI, Bsm I and TaqI polymorphisms, M = Marker
    Figure Legend Snippet: a - d Restriction endonuclease digestion for FokI, ApaI, Bsm I and TaqI polymorphisms, M = Marker

    Techniques Used: Marker

    5) Product Images from "Size Unbiased Representative Enzymatically Generated RNAi (SURER) Library and Application for RNAi Therapeutic Screens"

    Article Title: Size Unbiased Representative Enzymatically Generated RNAi (SURER) Library and Application for RNAi Therapeutic Screens

    Journal: Nucleic Acid Therapeutics

    doi: 10.1089/nat.2014.0514

    (A) Structures of loop-1 linkers (19–23 bp). Self-annealed loop-1 linkers contained EcoP15 I (CTGCTG) and Fok I (CATCC) sites followed by a universal PCR anchor. Different lengths of sRNAs can be generated by shifting the number of T/A pairs
    Figure Legend Snippet: (A) Structures of loop-1 linkers (19–23 bp). Self-annealed loop-1 linkers contained EcoP15 I (CTGCTG) and Fok I (CATCC) sites followed by a universal PCR anchor. Different lengths of sRNAs can be generated by shifting the number of T/A pairs

    Techniques Used: Polymerase Chain Reaction, Generated

    Schematic diagram of the RNA interference expression vector pRNAi-U6H1/Neo. The vector contains a multiple cloning sites with two BsmB I restriction sites to permit cloning of Fok I-digested sRNA fragments and an Sfi I site to assist in screening for recombinants.
    Figure Legend Snippet: Schematic diagram of the RNA interference expression vector pRNAi-U6H1/Neo. The vector contains a multiple cloning sites with two BsmB I restriction sites to permit cloning of Fok I-digested sRNA fragments and an Sfi I site to assist in screening for recombinants.

    Techniques Used: Expressing, Plasmid Preparation, Clone Assay

    6) Product Images from "A genetic variation of the p38? promoter region is correlated with an increased risk of sporadic colorectal cancer"

    Article Title: A genetic variation of the p38? promoter region is correlated with an increased risk of sporadic colorectal cancer

    Journal: Oncology Letters

    doi: 10.3892/ol.2013.1334

    Representative image for rs2235356 genotyping. Polymerase chain reaction (PCR) products were digested by FokI, followed by electrophoresis using 1% agarose gel. Lane 1, DNA ladder; lanes 2 and 3, -1628AG heterozygote genotype; lanes 4 and 5, -1628AA genotype; lanes 6 and 7, -1628GG genotype.
    Figure Legend Snippet: Representative image for rs2235356 genotyping. Polymerase chain reaction (PCR) products were digested by FokI, followed by electrophoresis using 1% agarose gel. Lane 1, DNA ladder; lanes 2 and 3, -1628AG heterozygote genotype; lanes 4 and 5, -1628AA genotype; lanes 6 and 7, -1628GG genotype.

    Techniques Used: Polymerase Chain Reaction, Electrophoresis, Agarose Gel Electrophoresis

    7) Product Images from "Interaction of Vitamin D Receptor with HLA DRB1*0301 in Type 1 Diabetes Patients from North India"

    Article Title: Interaction of Vitamin D Receptor with HLA DRB1*0301 in Type 1 Diabetes Patients from North India

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0008023

    The genotypes for the four SNPs were determined by PCR amplification and restriction digestion of the PCR products with enzymes FokI, BsmI, ApaI , and TaqI . A: Fok1 digestion: SNP C/T in exon 2 was studied by amplifying a 265 bp fragment using primers 5′AGCTGGCCCTGGCACTGACTCTTGCTCT 3′ and 5′ATGGAAACACCTTGCTTCTTCTCCCTC 3′ with 68°C as annealing temperature and digestion by fok1 at 37°C for 3 hours. Presence of restriction site is denoted by ‘f’ while absence of restriction is denoted by ‘F’. Results show FF (CC) i.e., a 265 bp band or Ff (CT) i.e., 265 bp, 196 bp and 69 bp, bands, ff (TT) i.e., 196 bp and 69 bp bands. M is the100 bp ladder. B: Bsm 1 digestion: SNP A/G in Intron 8 was studied by amplifying an 825 bp fragment using primers 5′CAACCAAGACTACAAGTACCGCGTCAGTGA 3′ and 5′AACCAGCGGGAAGAGGTCAAGGG 3′ with 65°C as annealing temperature and digestion by Bsm1 at 65°C for one hour. Presence of restriction site is denoted as ‘b’ and absence of restriction is denoted by ‘B’. The results show BB (AA) i.e., 825 bp band, Bb (AG) i.e., 825 bp, 650 bp and 175 bp and bands and bb (GG) 650 bp and 175 bp bands. M is 25 bp ladder. C: Apa 1 digestion: SNP T/G in Intron 8 was studied by amplifying an 740 bp fragment using primers 5′ CAGAGCATGGACAGGGAGCAAG 3′ and 5′ GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65°C as annealing temperature and digestion by Apa1 at 37°C for one hour. Presence of restriction site is denoted as ‘a; and absence of restriction is denoted by ‘A’. The results show AA (TT) i.e., 740 bp band, Aa (TG) i.e., 740 bp, 520 bp and 220 bp bands and aa (GG) 520 bp and 220 bp bands. M is 100 bp ladder. D: Taq 1 digestion: SNP T/C in exon 9 was studied by amplifying an 740 bp fragment using primers 5′CAGAGCATGGACAGGGAGCAAG 3′ and 5′GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65°C as annealing temperature and digestion by Taq1 at 65°C for one hour. Presence of restriction site is denoted as ‘t’ and absence of restriction is denoted by ‘T’. The results show TT (TT) i.e., 495 bp and 245 bp bands Tt (TC) i.e., 495 bp, 290 bp, 245 bp and 205 bp bands and tt (CC) 290 bp, 245 bp and 205 bp bands. M is 100 bp ladder.
    Figure Legend Snippet: The genotypes for the four SNPs were determined by PCR amplification and restriction digestion of the PCR products with enzymes FokI, BsmI, ApaI , and TaqI . A: Fok1 digestion: SNP C/T in exon 2 was studied by amplifying a 265 bp fragment using primers 5′AGCTGGCCCTGGCACTGACTCTTGCTCT 3′ and 5′ATGGAAACACCTTGCTTCTTCTCCCTC 3′ with 68°C as annealing temperature and digestion by fok1 at 37°C for 3 hours. Presence of restriction site is denoted by ‘f’ while absence of restriction is denoted by ‘F’. Results show FF (CC) i.e., a 265 bp band or Ff (CT) i.e., 265 bp, 196 bp and 69 bp, bands, ff (TT) i.e., 196 bp and 69 bp bands. M is the100 bp ladder. B: Bsm 1 digestion: SNP A/G in Intron 8 was studied by amplifying an 825 bp fragment using primers 5′CAACCAAGACTACAAGTACCGCGTCAGTGA 3′ and 5′AACCAGCGGGAAGAGGTCAAGGG 3′ with 65°C as annealing temperature and digestion by Bsm1 at 65°C for one hour. Presence of restriction site is denoted as ‘b’ and absence of restriction is denoted by ‘B’. The results show BB (AA) i.e., 825 bp band, Bb (AG) i.e., 825 bp, 650 bp and 175 bp and bands and bb (GG) 650 bp and 175 bp bands. M is 25 bp ladder. C: Apa 1 digestion: SNP T/G in Intron 8 was studied by amplifying an 740 bp fragment using primers 5′ CAGAGCATGGACAGGGAGCAAG 3′ and 5′ GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65°C as annealing temperature and digestion by Apa1 at 37°C for one hour. Presence of restriction site is denoted as ‘a; and absence of restriction is denoted by ‘A’. The results show AA (TT) i.e., 740 bp band, Aa (TG) i.e., 740 bp, 520 bp and 220 bp bands and aa (GG) 520 bp and 220 bp bands. M is 100 bp ladder. D: Taq 1 digestion: SNP T/C in exon 9 was studied by amplifying an 740 bp fragment using primers 5′CAGAGCATGGACAGGGAGCAAG 3′ and 5′GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65°C as annealing temperature and digestion by Taq1 at 65°C for one hour. Presence of restriction site is denoted as ‘t’ and absence of restriction is denoted by ‘T’. The results show TT (TT) i.e., 495 bp and 245 bp bands Tt (TC) i.e., 495 bp, 290 bp, 245 bp and 205 bp bands and tt (CC) 290 bp, 245 bp and 205 bp bands. M is 100 bp ladder.

    Techniques Used: Polymerase Chain Reaction, Amplification

    8) Product Images from "Analysis of GNAS1 and Overlapping Transcripts Identifies the Parental Origin of Mutations in Patients with Sporadic Albright Hereditary Osteodystrophy and Reveals a Model System in Which to Observe the Effects of Splicing Mutations on Translated and Untranslated Messenger RNA"

    Article Title: Analysis of GNAS1 and Overlapping Transcripts Identifies the Parental Origin of Mutations in Patients with Sporadic Albright Hereditary Osteodystrophy and Reveals a Model System in Which to Observe the Effects of Splicing Mutations on Translated and Untranslated Messenger RNA

    Journal: American Journal of Human Genetics

    doi:

    Imprinting of GNAS1 and overlapping transcripts in normal lymphoblast cell lines. The transcripts were amplified using an upstream primer in the unique exon and a downstream primer in exon 10 of GNAS1. Because of alternative splicing of exon 3 and multiple Fok I restriction-enzyme cut sites, nested amplification from exons 4–6 was performed on each transcript prior to Fok I digestion. The Fok I − allele (c.393T) gave a 195-bp product, and the Fok I + allele (c.393C) gave two products, of 122 and 73 bp (only the 122-bp product was visualized). An electropherogram demonstrating the fragments from one cell line (sized on an ABI 377 sequencer) is shown. a, Monoallelic expression of exon 1A, with only the + allele being present. b, Biallelic expression of Gsα, with − and + alleles being present. c, Monoallelic expression of NESP55 (opposite to exon 1A), with only the − allele being present.
    Figure Legend Snippet: Imprinting of GNAS1 and overlapping transcripts in normal lymphoblast cell lines. The transcripts were amplified using an upstream primer in the unique exon and a downstream primer in exon 10 of GNAS1. Because of alternative splicing of exon 3 and multiple Fok I restriction-enzyme cut sites, nested amplification from exons 4–6 was performed on each transcript prior to Fok I digestion. The Fok I − allele (c.393T) gave a 195-bp product, and the Fok I + allele (c.393C) gave two products, of 122 and 73 bp (only the 122-bp product was visualized). An electropherogram demonstrating the fragments from one cell line (sized on an ABI 377 sequencer) is shown. a, Monoallelic expression of exon 1A, with only the + allele being present. b, Biallelic expression of Gsα, with − and + alleles being present. c, Monoallelic expression of NESP55 (opposite to exon 1A), with only the − allele being present.

    Techniques Used: Amplification, Expressing

    9) Product Images from "Genetic Case-Control Study for Eight Polymorphisms Associated with Rheumatoid Arthritis"

    Article Title: Genetic Case-Control Study for Eight Polymorphisms Associated with Rheumatoid Arthritis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0131960

    Pairwise LD Plot for the VDR SNPs. The ID of each SNP was taken as reference. The rs731236, rs7975232, rs1544410, and rs2228570 correspond to TaqI, ApaI, BsmI, and FokI respectively. (a) D′ values. (b) r 2 values. The plot was generated using the Haploview 4 . 2 program.
    Figure Legend Snippet: Pairwise LD Plot for the VDR SNPs. The ID of each SNP was taken as reference. The rs731236, rs7975232, rs1544410, and rs2228570 correspond to TaqI, ApaI, BsmI, and FokI respectively. (a) D′ values. (b) r 2 values. The plot was generated using the Haploview 4 . 2 program.

    Techniques Used: Generated

    10) Product Images from "Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease"

    Article Title: Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease

    Journal: BMC Nephrology

    doi: 10.1186/s12882-018-0831-7

    a - d Restriction endonuclease digestion for FokI, ApaI, Bsm I and TaqI polymorphisms, M = Marker
    Figure Legend Snippet: a - d Restriction endonuclease digestion for FokI, ApaI, Bsm I and TaqI polymorphisms, M = Marker

    Techniques Used: Marker

    11) Product Images from "The human GNAS1 gene is imprinted and encodes distinct paternally and biallelically expressed G proteins"

    Article Title: The human GNAS1 gene is imprinted and encodes distinct paternally and biallelically expressed G proteins

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi:

    Organization of the XLαs region of GNAS1 . The map is not to scale, and not all restriction sites are shown, with the exception of Asc I and Not I. Grey lines above the exons represent the splicing patterns observed in the majority of XLαs-containing RT-PCR products and below the line the splicing pattern seen in the 359933 cDNA clone. Italic letters indicate restriction sites: S , Sac I; B , Bam HI; N , Not I; As , Asc I; Ng , Ngo MI; Bs , Bss HII; ( F ), Fok I (polymorphic site). Asterisks indicate those sites whose methylation status was assessed by Southern blotting (see text). The distance between the two Asc ). Small black arrows indicate approximate positions of primers used for RT-PCR.
    Figure Legend Snippet: Organization of the XLαs region of GNAS1 . The map is not to scale, and not all restriction sites are shown, with the exception of Asc I and Not I. Grey lines above the exons represent the splicing patterns observed in the majority of XLαs-containing RT-PCR products and below the line the splicing pattern seen in the 359933 cDNA clone. Italic letters indicate restriction sites: S , Sac I; B , Bam HI; N , Not I; As , Asc I; Ng , Ngo MI; Bs , Bss HII; ( F ), Fok I (polymorphic site). Asterisks indicate those sites whose methylation status was assessed by Southern blotting (see text). The distance between the two Asc ). Small black arrows indicate approximate positions of primers used for RT-PCR.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Methylation, Southern Blot

    Exclusively paternal expression of XLαs-containing GNAS1 transcripts. All experiments used a downstream PCR primer in exon 6; the location of the upstream primer is indicated (either in the XLαs exon, exon 1 or exon 2) above each pair of lanes. Each pair of lanes contains undigested ( Left ) or Fok I-digested ( Right ) RT-PCR product. The two bands seen in most undigested samples result from alternative splicing of exon 3. In fetuses DM0909 and HM1709, the paternal allele is lacking a Fok I site (genotype + m /− p ). The XLαs-derived RT-PCR products (XL) are completely Fok I-resistant. The total GNAS1 ), are partially cleaved by Fok I, indicating their biallelic origin. In fetus LR1907, the genotype is − m /+ p . The XLαs-derived products are digested to completion by Fok I, again demonstrating their exclusively paternal origin. Also, in this panel, exon 1-specific transcription has been analyzed separately, showing biallelic expression from the promoter upstream of exon 1. Fetuses SN3010 and MC2601 are again Fok I − m /+ p . RT-PCR products are digested to completion if XLαs-derived but only partly when the exon 2 primer is used. kb, 1-kb ladder: 1,018, 517/506, 396, 344, 298, 220, 201, 154, 134 bp.
    Figure Legend Snippet: Exclusively paternal expression of XLαs-containing GNAS1 transcripts. All experiments used a downstream PCR primer in exon 6; the location of the upstream primer is indicated (either in the XLαs exon, exon 1 or exon 2) above each pair of lanes. Each pair of lanes contains undigested ( Left ) or Fok I-digested ( Right ) RT-PCR product. The two bands seen in most undigested samples result from alternative splicing of exon 3. In fetuses DM0909 and HM1709, the paternal allele is lacking a Fok I site (genotype + m /− p ). The XLαs-derived RT-PCR products (XL) are completely Fok I-resistant. The total GNAS1 ), are partially cleaved by Fok I, indicating their biallelic origin. In fetus LR1907, the genotype is − m /+ p . The XLαs-derived products are digested to completion by Fok I, again demonstrating their exclusively paternal origin. Also, in this panel, exon 1-specific transcription has been analyzed separately, showing biallelic expression from the promoter upstream of exon 1. Fetuses SN3010 and MC2601 are again Fok I − m /+ p . RT-PCR products are digested to completion if XLαs-derived but only partly when the exon 2 primer is used. kb, 1-kb ladder: 1,018, 517/506, 396, 344, 298, 220, 201, 154, 134 bp.

    Techniques Used: Expressing, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Derivative Assay

    12) Product Images from "Non-CpG methylation is prevalent in embryonic stem cells and may be mediated by DNA methyltransferase 3a"

    Article Title: Non-CpG methylation is prevalent in embryonic stem cells and may be mediated by DNA methyltransferase 3a

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi:

    Dnmt3a induces CpG, CpA, and CpT methylation in Drosophila . NNA of genomic DNA extracted from wild-type ( A , C , and E ) and Dnmt3a -transgenic ( B , D , and F ) Drosophila . ( A and B ) Fok I-digested DNAs labeled with [α- 32 P]dGTP. ( C and D ) Fok I-digested DNA labeled with [α- 32 P]dATP. ( E and F ) Mva I-digested DNAs labeled with [α- 32 P]dATP. In the Mva I experiments ( E and F ), a small amount of labeling Ap, Tp, and Gp can also be seen. This finding is attributable to background labeling at nicks in the DNA. The identities of the labeled nucleotides are shown in B and F .
    Figure Legend Snippet: Dnmt3a induces CpG, CpA, and CpT methylation in Drosophila . NNA of genomic DNA extracted from wild-type ( A , C , and E ) and Dnmt3a -transgenic ( B , D , and F ) Drosophila . ( A and B ) Fok I-digested DNAs labeled with [α- 32 P]dGTP. ( C and D ) Fok I-digested DNA labeled with [α- 32 P]dATP. ( E and F ) Mva I-digested DNAs labeled with [α- 32 P]dATP. In the Mva I experiments ( E and F ), a small amount of labeling Ap, Tp, and Gp can also be seen. This finding is attributable to background labeling at nicks in the DNA. The identities of the labeled nucleotides are shown in B and F .

    Techniques Used: Cycling Probe Technology, Methylation, Transgenic Assay, Labeling

    13) Product Images from "Analysis of GNAS1 and Overlapping Transcripts Identifies the Parental Origin of Mutations in Patients with Sporadic Albright Hereditary Osteodystrophy and Reveals a Model System in Which to Observe the Effects of Splicing Mutations on Translated and Untranslated Messenger RNA"

    Article Title: Analysis of GNAS1 and Overlapping Transcripts Identifies the Parental Origin of Mutations in Patients with Sporadic Albright Hereditary Osteodystrophy and Reveals a Model System in Which to Observe the Effects of Splicing Mutations on Translated and Untranslated Messenger RNA

    Journal: American Journal of Human Genetics

    doi:

    Imprinting of GNAS1 and overlapping transcripts in normal lymphoblast cell lines. The transcripts were amplified using an upstream primer in the unique exon and a downstream primer in exon 10 of GNAS1. Because of alternative splicing of exon 3 and multiple Fok I restriction-enzyme cut sites, nested amplification from exons 4–6 was performed on each transcript prior to Fok I digestion. The Fok I − allele (c.393T) gave a 195-bp product, and the Fok I + allele (c.393C) gave two products, of 122 and 73 bp (only the 122-bp product was visualized). An electropherogram demonstrating the fragments from one cell line (sized on an ABI 377 sequencer) is shown. a, Monoallelic expression of exon 1A, with only the + allele being present. b, Biallelic expression of Gsα, with − and + alleles being present. c, Monoallelic expression of NESP55 (opposite to exon 1A), with only the − allele being present.
    Figure Legend Snippet: Imprinting of GNAS1 and overlapping transcripts in normal lymphoblast cell lines. The transcripts were amplified using an upstream primer in the unique exon and a downstream primer in exon 10 of GNAS1. Because of alternative splicing of exon 3 and multiple Fok I restriction-enzyme cut sites, nested amplification from exons 4–6 was performed on each transcript prior to Fok I digestion. The Fok I − allele (c.393T) gave a 195-bp product, and the Fok I + allele (c.393C) gave two products, of 122 and 73 bp (only the 122-bp product was visualized). An electropherogram demonstrating the fragments from one cell line (sized on an ABI 377 sequencer) is shown. a, Monoallelic expression of exon 1A, with only the + allele being present. b, Biallelic expression of Gsα, with − and + alleles being present. c, Monoallelic expression of NESP55 (opposite to exon 1A), with only the − allele being present.

    Techniques Used: Amplification, Expressing

    14) Product Images from "The vitamin D receptor polymorphism in the translation initiation codon is a risk factor for insulin resistance in glucose tolerant Caucasians"

    Article Title: The vitamin D receptor polymorphism in the translation initiation codon is a risk factor for insulin resistance in glucose tolerant Caucasians

    Journal: BMC Medical Genetics

    doi: 10.1186/1471-2350-2-2

    Adjusted insulin sensitivity (%S) by the Fok I polymorphism at the vitamin D receptor gene locus. They were logarithmically transformed before analysis and expressed as geometric mean ± standard error. Insulin sensitivity was adjusted for waist-hip ratio as described in the methods and results sections and in Table 2 .
    Figure Legend Snippet: Adjusted insulin sensitivity (%S) by the Fok I polymorphism at the vitamin D receptor gene locus. They were logarithmically transformed before analysis and expressed as geometric mean ± standard error. Insulin sensitivity was adjusted for waist-hip ratio as described in the methods and results sections and in Table 2 .

    Techniques Used: Transformation Assay

    Related Articles

    Amplification:

    Article Title: A genetic variation of the p38? promoter region is correlated with an increased risk of sporadic colorectal cancer
    Article Snippet: .. The PCR amplification was further digested with FokI (New England Biolabs, Inc., Ipswich, MA, USA) overnight at 37°C, followed by agarose gel electrophoresis to reveal the genotype of either -1628AA (two bands of 157 and 228 bp), -1628GG (one band of 385 bp) or the heterozygous -1628AG (three bands of 157, 228 and 385 bp) ( ). .. A GeneRuler Low Ranger DNA Ladder (100 bp; Thermo Scientific, Waltham, MA, USA) was used.

    Article Title: Vitamin D Receptor Gene Polymorphisms and Prognosis of Breast Cancer among African-American and Hispanic Women
    Article Snippet: .. Following PCR, aliquots of the amplified PCR products was digested with BsmI, ApaI, TaqI and FokI in accordance with the manufacturer's specifications (New England Biolabs, Beverly, MA, USA). .. The presence (lowercase) or absence (uppercase) of the enzyme recognition site was identified by ethidium bromide staining of fragments separated in a 2% agarose gel.

    Article Title: Interaction of Vitamin D Receptor with HLA DRB1*0301 in Type 1 Diabetes Patients from North India
    Article Snippet: .. Genotypic Analysis of VDR Polymorphisms The genotypes for the four SNPs were determined by PCR amplification and restriction digestion of the PCR products with enzymes FokI, BsmI, ApaI , and TaqI as described earlier , Briefly, 500 ng of DNA was amplified in 5 µl of 10X Thermo Pol reaction buffer supplemented with 2 mM MgSO4 (New England Biolabs), 5 pm of each primers, 0.25 mM of dNTPs, and 1.25 U of Taq DNA Polymerase (New England Biolabs), under standard conditions for 35 cycles in Perkin Elmer 2700 thermocycler. ..

    Agarose Gel Electrophoresis:

    Article Title: A genetic variation of the p38? promoter region is correlated with an increased risk of sporadic colorectal cancer
    Article Snippet: .. The PCR amplification was further digested with FokI (New England Biolabs, Inc., Ipswich, MA, USA) overnight at 37°C, followed by agarose gel electrophoresis to reveal the genotype of either -1628AA (two bands of 157 and 228 bp), -1628GG (one band of 385 bp) or the heterozygous -1628AG (three bands of 157, 228 and 385 bp) ( ). .. A GeneRuler Low Ranger DNA Ladder (100 bp; Thermo Scientific, Waltham, MA, USA) was used.

    Article Title: Analysis of GNAS1 and Overlapping Transcripts Identifies the Parental Origin of Mutations in Patients with Sporadic Albright Hereditary Osteodystrophy and Reveals a Model System in Which to Observe the Effects of Splicing Mutations on Translated and Untranslated Messenger RNA
    Article Snippet: .. The products were digested with Fok I (NEB) and were separated on a 2% agarose gel. .. Seven heterozygous normal control lymphoblast cDNA samples, two heterozygous fetal cDNAs (lung and kidney), and cDNA from patient AHO-33 were amplified for the NESP55, exon 1A, and Gsα transcripts, by using NESPF2/GNAS10R1, EX1ARNAF/GNAS10R1, and MET1F/GNAS10R1, respectively.

    Purification:

    Article Title: Size Unbiased Representative Enzymatically Generated RNAi (SURER) Library and Application for RNAi Therapeutic Screens
    Article Snippet: .. PCR-2 products were digested with Fok I enzyme; 50-μL reactions contained 20 μL purified PCR-2 products (from step 6), 2 μL Fok I (10 U, NEB), 5 μL NEBuffer-3 (NEB), and 23 μL ddH2 O, which was incubated at 37°C for 100 min. After digestion, 10 μL of products were analyzed on a 20% TBE polyacrylamide gel and appropriate bands purified by PAGE as described above. .. Fok I-digested fragments were ligated into linearized pRNAi-U6H1/Neo. pRNAi-U6H1/Neo was digested with BsmB I and dephosphorylated with calf intestinal alkaline phosphatase according to manufacturer's (NEB) protocols.

    Incubation:

    Article Title: Size Unbiased Representative Enzymatically Generated RNAi (SURER) Library and Application for RNAi Therapeutic Screens
    Article Snippet: .. PCR-2 products were digested with Fok I enzyme; 50-μL reactions contained 20 μL purified PCR-2 products (from step 6), 2 μL Fok I (10 U, NEB), 5 μL NEBuffer-3 (NEB), and 23 μL ddH2 O, which was incubated at 37°C for 100 min. After digestion, 10 μL of products were analyzed on a 20% TBE polyacrylamide gel and appropriate bands purified by PAGE as described above. .. Fok I-digested fragments were ligated into linearized pRNAi-U6H1/Neo. pRNAi-U6H1/Neo was digested with BsmB I and dephosphorylated with calf intestinal alkaline phosphatase according to manufacturer's (NEB) protocols.

    other:

    Article Title: DNA looping by two-site restriction endonucleases: heterogeneous probability distributions for loop size and unbinding force
    Article Snippet: Endonucleases BamHI, BpmI, BsgI, BspMI, BstNI, EcoRI, EcoRV, FokI, HaeIII, HpaII, MboII, MspI, NarI, NaeI, SacII, Sau3AI, SfiI and SgrAI were obtained from New England Biolabs (NEB).

    Polyacrylamide Gel Electrophoresis:

    Article Title: Size Unbiased Representative Enzymatically Generated RNAi (SURER) Library and Application for RNAi Therapeutic Screens
    Article Snippet: .. PCR-2 products were digested with Fok I enzyme; 50-μL reactions contained 20 μL purified PCR-2 products (from step 6), 2 μL Fok I (10 U, NEB), 5 μL NEBuffer-3 (NEB), and 23 μL ddH2 O, which was incubated at 37°C for 100 min. After digestion, 10 μL of products were analyzed on a 20% TBE polyacrylamide gel and appropriate bands purified by PAGE as described above. .. Fok I-digested fragments were ligated into linearized pRNAi-U6H1/Neo. pRNAi-U6H1/Neo was digested with BsmB I and dephosphorylated with calf intestinal alkaline phosphatase according to manufacturer's (NEB) protocols.

    Polymerase Chain Reaction:

    Article Title: Size Unbiased Representative Enzymatically Generated RNAi (SURER) Library and Application for RNAi Therapeutic Screens
    Article Snippet: .. PCR-2 products were digested with Fok I enzyme; 50-μL reactions contained 20 μL purified PCR-2 products (from step 6), 2 μL Fok I (10 U, NEB), 5 μL NEBuffer-3 (NEB), and 23 μL ddH2 O, which was incubated at 37°C for 100 min. After digestion, 10 μL of products were analyzed on a 20% TBE polyacrylamide gel and appropriate bands purified by PAGE as described above. .. Fok I-digested fragments were ligated into linearized pRNAi-U6H1/Neo. pRNAi-U6H1/Neo was digested with BsmB I and dephosphorylated with calf intestinal alkaline phosphatase according to manufacturer's (NEB) protocols.

    Article Title: A genetic variation of the p38? promoter region is correlated with an increased risk of sporadic colorectal cancer
    Article Snippet: .. The PCR amplification was further digested with FokI (New England Biolabs, Inc., Ipswich, MA, USA) overnight at 37°C, followed by agarose gel electrophoresis to reveal the genotype of either -1628AA (two bands of 157 and 228 bp), -1628GG (one band of 385 bp) or the heterozygous -1628AG (three bands of 157, 228 and 385 bp) ( ). .. A GeneRuler Low Ranger DNA Ladder (100 bp; Thermo Scientific, Waltham, MA, USA) was used.

    Article Title: Vitamin D Receptor Gene Polymorphisms and Prognosis of Breast Cancer among African-American and Hispanic Women
    Article Snippet: .. Following PCR, aliquots of the amplified PCR products was digested with BsmI, ApaI, TaqI and FokI in accordance with the manufacturer's specifications (New England Biolabs, Beverly, MA, USA). .. The presence (lowercase) or absence (uppercase) of the enzyme recognition site was identified by ethidium bromide staining of fragments separated in a 2% agarose gel.

    Article Title: Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease
    Article Snippet: .. The PCR products were then digested with enzymes ApaI, BsmI, FokI, and TaqI (New England Biolabs, Beverly, MA, USA) according to the supplier’s protocol. .. Digestions for BsmI and TaqI were at 65 °C left overnight, and 3 h at 25 °C for ApaI , while FokI was incubated at 37 °C for 3 h. Restricted products were electrophoresed on either 10% polyacrylamide or 1.5% agarose gels and then visualized by the Gel Doc TM EZ imager (Bio-Rad systems, USA).

    Article Title: Interaction of Vitamin D Receptor with HLA DRB1*0301 in Type 1 Diabetes Patients from North India
    Article Snippet: .. Genotypic Analysis of VDR Polymorphisms The genotypes for the four SNPs were determined by PCR amplification and restriction digestion of the PCR products with enzymes FokI, BsmI, ApaI , and TaqI as described earlier , Briefly, 500 ng of DNA was amplified in 5 µl of 10X Thermo Pol reaction buffer supplemented with 2 mM MgSO4 (New England Biolabs), 5 pm of each primers, 0.25 mM of dNTPs, and 1.25 U of Taq DNA Polymerase (New England Biolabs), under standard conditions for 35 cycles in Perkin Elmer 2700 thermocycler. ..

    Inhibition:

    Article Title: DNA base excision repair of uracil residues in reconstituted nucleosome core particles
    Article Snippet: .. Translational positioning was determined by monitoring the degree of inhibition of restriction enzyme cleavage along the length of the nucleosome by treating ∼1 pmol of substrate with 5–10 U of restriction enzymes Xmn I, Fok I, Dra I, Alu I, Mbo I and Sca I (New England Biolabs) in buffers provided by the manufacturer. .. After incubation at 37°C for 30 min, the reactions were stopped by the addition of 95% formamide loading buffer before separation in an 8% polyacrylamide/7 M urea/ 20% formamide/1× TBE gel.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs foki
    Five-year disease free survival (DFS) of breast cancer patients in relation to VDR gene polymorphisms. Kaplan-Meier survival curves were used to compare the 5-year DFS between the VDR gene polymorphisms in (a) <t>VDR-FokI,</t> (b) <t>VDR-BsmI,</t> (c) VDR-ApaI, and (d) VDR-TaqI. The differences between the curves were estimated by log-rank test, where P
    Foki, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 29 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/foki/product/New England Biolabs
    Average 95 stars, based on 29 article reviews
    Price from $9.99 to $1999.99
    foki - by Bioz Stars, 2020-09
    95/100 stars
      Buy from Supplier

    Image Search Results


    Five-year disease free survival (DFS) of breast cancer patients in relation to VDR gene polymorphisms. Kaplan-Meier survival curves were used to compare the 5-year DFS between the VDR gene polymorphisms in (a) VDR-FokI, (b) VDR-BsmI, (c) VDR-ApaI, and (d) VDR-TaqI. The differences between the curves were estimated by log-rank test, where P

    Journal: PLoS ONE

    Article Title: Vitamin D Receptor Gene Polymorphisms and Prognosis of Breast Cancer among African-American and Hispanic Women

    doi: 10.1371/journal.pone.0057967

    Figure Lengend Snippet: Five-year disease free survival (DFS) of breast cancer patients in relation to VDR gene polymorphisms. Kaplan-Meier survival curves were used to compare the 5-year DFS between the VDR gene polymorphisms in (a) VDR-FokI, (b) VDR-BsmI, (c) VDR-ApaI, and (d) VDR-TaqI. The differences between the curves were estimated by log-rank test, where P

    Article Snippet: Following PCR, aliquots of the amplified PCR products was digested with BsmI, ApaI, TaqI and FokI in accordance with the manufacturer's specifications (New England Biolabs, Beverly, MA, USA).

    Techniques:

    Typical DNA force-extension plots. ( A ) The two-site enzyme BsgI tested on the LBAC-B template, which has four recognition sites. The one detected loop had a measured length of 946 bp, in excellent agreement with the separation between the binding sites at positions 8342 and 9287 bp (a distance of 945 bp). ( B ) Sau3AI on the LBAC-A template, which has 55 recognition sites. ( C ) Control experiments: (i) the two-site enzyme Sau3AI was tested on bacteriophage phiX174 DNA, which contains no copies of its recognition sequence; (ii) the one-site enzyme HaeIII was tested on LBAC-B DNA containing 36 copies of its recognition sequence; (iii) the two-site enzyme SfiI was tested on LBAC-B DNA containing one copy of its recognition sequence and (iv) LBAC-B DNA, containing 26 FokI binding sites, incubated in the FokI reaction buffer, but no FokI added.

    Journal: Nucleic Acids Research

    Article Title: DNA looping by two-site restriction endonucleases: heterogeneous probability distributions for loop size and unbinding force

    doi: 10.1093/nar/gkl382

    Figure Lengend Snippet: Typical DNA force-extension plots. ( A ) The two-site enzyme BsgI tested on the LBAC-B template, which has four recognition sites. The one detected loop had a measured length of 946 bp, in excellent agreement with the separation between the binding sites at positions 8342 and 9287 bp (a distance of 945 bp). ( B ) Sau3AI on the LBAC-A template, which has 55 recognition sites. ( C ) Control experiments: (i) the two-site enzyme Sau3AI was tested on bacteriophage phiX174 DNA, which contains no copies of its recognition sequence; (ii) the one-site enzyme HaeIII was tested on LBAC-B DNA containing 36 copies of its recognition sequence; (iii) the two-site enzyme SfiI was tested on LBAC-B DNA containing one copy of its recognition sequence and (iv) LBAC-B DNA, containing 26 FokI binding sites, incubated in the FokI reaction buffer, but no FokI added.

    Article Snippet: Endonucleases BamHI, BpmI, BsgI, BspMI, BstNI, EcoRI, EcoRV, FokI, HaeIII, HpaII, MboII, MspI, NarI, NaeI, SacII, Sau3AI, SfiI and SgrAI were obtained from New England Biolabs (NEB).

    Techniques: Binding Assay, Sequencing, Incubation

    Fig. 4. Stability of 146 bp nucleosome core particles. ( A ) The stability of core particles was analysed by incubating uracil-containing (U51) core particles alone (–), with UNG2 (U), SMUG1 and APE1 (S) or with BER enzymes (UNGΔ84 in combination with APE1, Polβ and LigIII; B) for 30 min at 37°C and loaded directly on a native 5% polyacrylamide gel. ( B ) An 8% polyacrylamide/7 M urea/20% formamide gel showing restriction enzyme digestion of naked 146 bp DNA (lanes 1–4), with Fok I (F), Alu I (A) or Mbo I (M). Core particles prior to uracil removal and repair (–), and after incubation with UNG2 (U), SMUG1/APE1 (S) or BER enzymes (B) were digested with Fok I (F), Alu I (A) or Mbo I (M). ( C ) Naked DNA (DNA) and nucleosome core particles (NCP) were subjected to DNase I footprinting prior to uracil removal and repair. Aliquots were removed from naked DNA after 0, 0.5, 1 and 3 min (lanes 1 and 3–5) and from core particles after 0, 0.5, 1, 3, 6 and 15 min (lanes 6–11). A Maxam–Gilbert T-reaction was included (lane 2). Core particles incubated in the presence of SMUG1/APE1 (S) or BER enzymes (B) were subjected to DNase I digestion. Aliquots were taken after 0.5, 1 and 3 min, denatured and analysed in 8% polyacrylamide/7 M urea/20% formamide gels.

    Journal: The EMBO Journal

    Article Title: DNA base excision repair of uracil residues in reconstituted nucleosome core particles

    doi: 10.1093/emboj/cdf581

    Figure Lengend Snippet: Fig. 4. Stability of 146 bp nucleosome core particles. ( A ) The stability of core particles was analysed by incubating uracil-containing (U51) core particles alone (–), with UNG2 (U), SMUG1 and APE1 (S) or with BER enzymes (UNGΔ84 in combination with APE1, Polβ and LigIII; B) for 30 min at 37°C and loaded directly on a native 5% polyacrylamide gel. ( B ) An 8% polyacrylamide/7 M urea/20% formamide gel showing restriction enzyme digestion of naked 146 bp DNA (lanes 1–4), with Fok I (F), Alu I (A) or Mbo I (M). Core particles prior to uracil removal and repair (–), and after incubation with UNG2 (U), SMUG1/APE1 (S) or BER enzymes (B) were digested with Fok I (F), Alu I (A) or Mbo I (M). ( C ) Naked DNA (DNA) and nucleosome core particles (NCP) were subjected to DNase I footprinting prior to uracil removal and repair. Aliquots were removed from naked DNA after 0, 0.5, 1 and 3 min (lanes 1 and 3–5) and from core particles after 0, 0.5, 1, 3, 6 and 15 min (lanes 6–11). A Maxam–Gilbert T-reaction was included (lane 2). Core particles incubated in the presence of SMUG1/APE1 (S) or BER enzymes (B) were subjected to DNase I digestion. Aliquots were taken after 0.5, 1 and 3 min, denatured and analysed in 8% polyacrylamide/7 M urea/20% formamide gels.

    Article Snippet: Translational positioning was determined by monitoring the degree of inhibition of restriction enzyme cleavage along the length of the nucleosome by treating ∼1 pmol of substrate with 5–10 U of restriction enzymes Xmn I, Fok I, Dra I, Alu I, Mbo I and Sca I (New England Biolabs) in buffers provided by the manufacturer.

    Techniques: Incubation, Footprinting

    a - d Restriction endonuclease digestion for FokI, ApaI, Bsm I and TaqI polymorphisms, M = Marker

    Journal: BMC Nephrology

    Article Title: Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease

    doi: 10.1186/s12882-018-0831-7

    Figure Lengend Snippet: a - d Restriction endonuclease digestion for FokI, ApaI, Bsm I and TaqI polymorphisms, M = Marker

    Article Snippet: The PCR products were then digested with enzymes ApaI, BsmI, FokI, and TaqI (New England Biolabs, Beverly, MA, USA) according to the supplier’s protocol.

    Techniques: Marker