foki  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Name:
    FokI
    Description:
    FokI 5 000 units
    Catalog Number:
    R0109L
    Price:
    282
    Category:
    Restriction Enzymes
    Size:
    5 000 units
    Buy from Supplier


    Structured Review

    New England Biolabs foki
    FokI
    FokI 5 000 units
    https://www.bioz.com/result/foki/product/New England Biolabs
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    foki - by Bioz Stars, 2021-05
    93/100 stars

    Images

    1) Product Images from "Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease"

    Article Title: Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease

    Journal: BMC Nephrology

    doi: 10.1186/s12882-018-0831-7

    a - d Restriction endonuclease digestion for FokI, ApaI, Bsm I and TaqI polymorphisms, M = Marker
    Figure Legend Snippet: a - d Restriction endonuclease digestion for FokI, ApaI, Bsm I and TaqI polymorphisms, M = Marker

    Techniques Used: Marker

    2) Product Images from "Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease"

    Article Title: Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease

    Journal: BMC Nephrology

    doi: 10.1186/s12882-018-0831-7

    a - d Restriction endonuclease digestion for FokI, ApaI, Bsm I and TaqI polymorphisms, M = Marker
    Figure Legend Snippet: a - d Restriction endonuclease digestion for FokI, ApaI, Bsm I and TaqI polymorphisms, M = Marker

    Techniques Used: Marker

    3) Product Images from "Genetic Case-Control Study for Eight Polymorphisms Associated with Rheumatoid Arthritis"

    Article Title: Genetic Case-Control Study for Eight Polymorphisms Associated with Rheumatoid Arthritis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0131960

    Pairwise LD Plot for the VDR SNPs. The ID of each SNP was taken as reference. The rs731236, rs7975232, rs1544410, and rs2228570 correspond to TaqI, ApaI, BsmI, and FokI respectively. (a) D′ values. (b) r 2 values. The plot was generated using the Haploview 4 . 2 program.
    Figure Legend Snippet: Pairwise LD Plot for the VDR SNPs. The ID of each SNP was taken as reference. The rs731236, rs7975232, rs1544410, and rs2228570 correspond to TaqI, ApaI, BsmI, and FokI respectively. (a) D′ values. (b) r 2 values. The plot was generated using the Haploview 4 . 2 program.

    Techniques Used: Generated

    4) Product Images from "DNA looping by two-site restriction endonucleases: heterogeneous probability distributions for loop size and unbinding force"

    Article Title: DNA looping by two-site restriction endonucleases: heterogeneous probability distributions for loop size and unbinding force

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkl382

    Typical DNA force-extension plots. ( A ) The two-site enzyme BsgI tested on the LBAC-B template, which has four recognition sites. The one detected loop had a measured length of 946 bp, in excellent agreement with the separation between the binding sites at positions 8342 and 9287 bp (a distance of 945 bp). ( B ) Sau3AI on the LBAC-A template, which has 55 recognition sites. ( C ) Control experiments: (i) the two-site enzyme Sau3AI was tested on bacteriophage phiX174 DNA, which contains no copies of its recognition sequence; (ii) the one-site enzyme HaeIII was tested on LBAC-B DNA containing 36 copies of its recognition sequence; (iii) the two-site enzyme SfiI was tested on LBAC-B DNA containing one copy of its recognition sequence and (iv) LBAC-B DNA, containing 26 FokI binding sites, incubated in the FokI reaction buffer, but no FokI added.
    Figure Legend Snippet: Typical DNA force-extension plots. ( A ) The two-site enzyme BsgI tested on the LBAC-B template, which has four recognition sites. The one detected loop had a measured length of 946 bp, in excellent agreement with the separation between the binding sites at positions 8342 and 9287 bp (a distance of 945 bp). ( B ) Sau3AI on the LBAC-A template, which has 55 recognition sites. ( C ) Control experiments: (i) the two-site enzyme Sau3AI was tested on bacteriophage phiX174 DNA, which contains no copies of its recognition sequence; (ii) the one-site enzyme HaeIII was tested on LBAC-B DNA containing 36 copies of its recognition sequence; (iii) the two-site enzyme SfiI was tested on LBAC-B DNA containing one copy of its recognition sequence and (iv) LBAC-B DNA, containing 26 FokI binding sites, incubated in the FokI reaction buffer, but no FokI added.

    Techniques Used: Binding Assay, Sequencing, Incubation

    5) Product Images from "Vitamin D Receptor Gene Polymorphisms and Prognosis of Breast Cancer among African-American and Hispanic Women"

    Article Title: Vitamin D Receptor Gene Polymorphisms and Prognosis of Breast Cancer among African-American and Hispanic Women

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0057967

    Five-year disease free survival (DFS) of breast cancer patients in relation to VDR gene polymorphisms. Kaplan-Meier survival curves were used to compare the 5-year DFS between the VDR gene polymorphisms in (a) VDR-FokI, (b) VDR-BsmI, (c) VDR-ApaI, and (d) VDR-TaqI. The differences between the curves were estimated by log-rank test, where P
    Figure Legend Snippet: Five-year disease free survival (DFS) of breast cancer patients in relation to VDR gene polymorphisms. Kaplan-Meier survival curves were used to compare the 5-year DFS between the VDR gene polymorphisms in (a) VDR-FokI, (b) VDR-BsmI, (c) VDR-ApaI, and (d) VDR-TaqI. The differences between the curves were estimated by log-rank test, where P

    Techniques Used:

    6) Product Images from "A genetic variation of the p38? promoter region is correlated with an increased risk of sporadic colorectal cancer"

    Article Title: A genetic variation of the p38? promoter region is correlated with an increased risk of sporadic colorectal cancer

    Journal: Oncology Letters

    doi: 10.3892/ol.2013.1334

    Representative image for rs2235356 genotyping. Polymerase chain reaction (PCR) products were digested by FokI, followed by electrophoresis using 1% agarose gel. Lane 1, DNA ladder; lanes 2 and 3, -1628AG heterozygote genotype; lanes 4 and 5, -1628AA genotype; lanes 6 and 7, -1628GG genotype.
    Figure Legend Snippet: Representative image for rs2235356 genotyping. Polymerase chain reaction (PCR) products were digested by FokI, followed by electrophoresis using 1% agarose gel. Lane 1, DNA ladder; lanes 2 and 3, -1628AG heterozygote genotype; lanes 4 and 5, -1628AA genotype; lanes 6 and 7, -1628GG genotype.

    Techniques Used: Polymerase Chain Reaction, Electrophoresis, Agarose Gel Electrophoresis

    Related Articles

    Polymerase Chain Reaction:

    Article Title: The vitamin D receptor polymorphism in the translation initiation codon is a risk factor for insulin resistance in glucose tolerant Caucasians
    Article Snippet: Polymerase chain reaction (PCR) was carried out in a total volume of 11 μl containing 0.5 pM of each primer, 0.2 mM dNTP, 2 mM MgCl2 , 5% dimethysulphoxide (DMSO), 0.275 U Taq polymerase, 50 mM KCl, 10 mM Tris-HCl pH 8.3, and 0.001% gelatin. .. Then, 5 μl of the PCR product (265 base pairs) was digested in 15-μl of reaction volume containing 1 U of Fok I (New England Biolabs Inc., Beverly, Massachusetts, USA) with the buffer supplied by the vender. .. The digested PCR products were resolved on 2.0% agarose gels.

    Article Title: Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease
    Article Snippet: Using appropriate primers obtained DNA products were amplified for ApaI (Foward: 5’ CAGAGCATGGACAGGGAGCAAG 3′ and Reverse: 5’ GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65 °C annealing temperature), BsmI (Forward: 5’ CAACCAAGACTACAAGTACCGCGTCAGTGA 3′ and Reverse: 5’ AACCAGCGGGAAGAGGTCAAGGG 3 ‘with 65 °C as an annealing temperature), FokI (Forward: 5’ AGCTGGCCCTGGCACTGACTCTTGCTCT 3′ and Reverse: 5’ ATGGAAACACCTTGCTTCTTCTCCCTC 3′ with 67 °C annealing temperature), and TaqI (Forward: 5’ CAGAGCATGGACAGGGAGCAAG 3′ and Reverse: 5’GCAACTCCTCATGGCTGAGGTCTCA 3′ at an annealing temperature of 65 °C) VDR polymorphisms. .. The PCR products were then digested with enzymes ApaI, BsmI, FokI, and TaqI (New England Biolabs, Beverly, MA, USA) according to the supplier’s protocol. .. Digestions for BsmI and TaqI were at 65 °C left overnight, and 3 h at 25 °C for ApaI , while FokI was incubated at 37 °C for 3 h. Restricted products were electrophoresed on either 10% polyacrylamide or 1.5% agarose gels and then visualized by the Gel Doc TM EZ imager (Bio-Rad systems, USA).

    Article Title: Interaction of Vitamin D Receptor with HLA DRB1*0301 in Type 1 Diabetes Patients from North India
    Article Snippet: .. Genotypic Analysis of VDR Polymorphisms The genotypes for the four SNPs were determined by PCR amplification and restriction digestion of the PCR products with enzymes FokI, BsmI, ApaI , and TaqI as described earlier , Briefly, 500 ng of DNA was amplified in 5 µl of 10X Thermo Pol reaction buffer supplemented with 2 mM MgSO4 (New England Biolabs), 5 pm of each primers, 0.25 mM of dNTPs, and 1.25 U of Taq DNA Polymerase (New England Biolabs), under standard conditions for 35 cycles in Perkin Elmer 2700 thermocycler. ..

    Article Title: Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease
    Article Snippet: Using appropriate primers obtained DNA products were amplified for ApaI (Foward: 5’ CAGAGCATGGACAGGGAGCAAG 3′ and Reverse: 5’ GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65 °C annealing temperature), BsmI (Forward: 5’ CAACCAAGACTACAAGTACCGCGTCAGTGA 3′ and Reverse: 5’ AACCAGCGGGAAGAGGTCAAGGG 3 ‘with 65 °C as an annealing temperature), FokI (Forward: 5’ AGCTGGCCCTGGCACTGACTCTTGCTCT 3′ and Reverse: 5’ ATGGAAACACCTTGCTTCTTCTCCCTC 3′ with 67 °C annealing temperature), and TaqI (Forward: 5’ CAGAGCATGGACAGGGAGCAAG 3′ and Reverse: 5’GCAACTCCTCATGGCTGAGGTCTCA 3′ at an annealing temperature of 65 °C) VDR polymorphisms. .. The PCR products were then digested with enzymes ApaI, BsmI, FokI, and TaqI (New England Biolabs, Beverly, MA, USA) according to the supplier’s protocol. .. Digestions for BsmI and TaqI were at 65 °C left overnight, and 3 h at 25 °C for ApaI , while FokI was incubated at 37 °C for 3 h. Restricted products were electrophoresed on either 10% polyacrylamide or 1.5% agarose gels and then visualized by the Gel Doc TM EZ imager (Bio-Rad systems, USA).

    Article Title: Size Unbiased Representative Enzymatically Generated RNAi (SURER) Library and Application for RNAi Therapeutic Screens
    Article Snippet: Reactions were preheated at 95°C for 1 min and amplified using 28 cycles of 95°C for 15 sec and 68°C for 1 min. After amplification, 10 μL of PCR products were analyzed on a 20% TBE polyacrylamide gel, and the remaining fragments purified using phenol–chloroform extraction and ethanol precipitation as described above; DNA pellets were resuspended in 20 μL ddH2 O. .. PCR-2 products were digested with Fok I enzyme; 50-μL reactions contained 20 μL purified PCR-2 products (from step 6), 2 μL Fok I (10 U, NEB), 5 μL NEBuffer-3 (NEB), and 23 μL ddH2 O, which was incubated at 37°C for 100 min. After digestion, 10 μL of products were analyzed on a 20% TBE polyacrylamide gel and appropriate bands purified by PAGE as described above. .. Fok I-digested fragments were ligated into linearized pRNAi-U6H1/Neo. pRNAi-U6H1/Neo was digested with BsmB I and dephosphorylated with calf intestinal alkaline phosphatase according to manufacturer's (NEB) protocols.

    Article Title: Genetic Case-Control Study for Eight Polymorphisms Associated with Rheumatoid Arthritis
    Article Snippet: .. VDR (ApaI, BsmI, FokI, and TaqI) genotyping The VDR ApaI (rs7975232), the BsmI (rs1544410), the FokI (rs2228570), and the TaqI (rs731236) SNPs were detected by PCR–RFLP according to the manufacturer’s instructions (New England BioLabs, Ipswich, USA). .. DNA digested fragments were separated in 3% agarose gels and visualized by ethidium bromide staining.

    Inhibition:

    Article Title: DNA base excision repair of uracil residues in reconstituted nucleosome core particles
    Article Snippet: .. Translational positioning was determined by monitoring the degree of inhibition of restriction enzyme cleavage along the length of the nucleosome by treating ∼1 pmol of substrate with 5–10 U of restriction enzymes Xmn I, Fok I, Dra I, Alu I, Mbo I and Sca I (New England Biolabs) in buffers provided by the manufacturer. .. After incubation at 37°C for 30 min, the reactions were stopped by the addition of 95% formamide loading buffer before separation in an 8% polyacrylamide/7 M urea/ 20% formamide/1× TBE gel.

    Amplification:

    Article Title: Interaction of Vitamin D Receptor with HLA DRB1*0301 in Type 1 Diabetes Patients from North India
    Article Snippet: .. Genotypic Analysis of VDR Polymorphisms The genotypes for the four SNPs were determined by PCR amplification and restriction digestion of the PCR products with enzymes FokI, BsmI, ApaI , and TaqI as described earlier , Briefly, 500 ng of DNA was amplified in 5 µl of 10X Thermo Pol reaction buffer supplemented with 2 mM MgSO4 (New England Biolabs), 5 pm of each primers, 0.25 mM of dNTPs, and 1.25 U of Taq DNA Polymerase (New England Biolabs), under standard conditions for 35 cycles in Perkin Elmer 2700 thermocycler. ..

    Purification:

    Article Title: Size Unbiased Representative Enzymatically Generated RNAi (SURER) Library and Application for RNAi Therapeutic Screens
    Article Snippet: Reactions were preheated at 95°C for 1 min and amplified using 28 cycles of 95°C for 15 sec and 68°C for 1 min. After amplification, 10 μL of PCR products were analyzed on a 20% TBE polyacrylamide gel, and the remaining fragments purified using phenol–chloroform extraction and ethanol precipitation as described above; DNA pellets were resuspended in 20 μL ddH2 O. .. PCR-2 products were digested with Fok I enzyme; 50-μL reactions contained 20 μL purified PCR-2 products (from step 6), 2 μL Fok I (10 U, NEB), 5 μL NEBuffer-3 (NEB), and 23 μL ddH2 O, which was incubated at 37°C for 100 min. After digestion, 10 μL of products were analyzed on a 20% TBE polyacrylamide gel and appropriate bands purified by PAGE as described above. .. Fok I-digested fragments were ligated into linearized pRNAi-U6H1/Neo. pRNAi-U6H1/Neo was digested with BsmB I and dephosphorylated with calf intestinal alkaline phosphatase according to manufacturer's (NEB) protocols.

    Incubation:

    Article Title: Size Unbiased Representative Enzymatically Generated RNAi (SURER) Library and Application for RNAi Therapeutic Screens
    Article Snippet: Reactions were preheated at 95°C for 1 min and amplified using 28 cycles of 95°C for 15 sec and 68°C for 1 min. After amplification, 10 μL of PCR products were analyzed on a 20% TBE polyacrylamide gel, and the remaining fragments purified using phenol–chloroform extraction and ethanol precipitation as described above; DNA pellets were resuspended in 20 μL ddH2 O. .. PCR-2 products were digested with Fok I enzyme; 50-μL reactions contained 20 μL purified PCR-2 products (from step 6), 2 μL Fok I (10 U, NEB), 5 μL NEBuffer-3 (NEB), and 23 μL ddH2 O, which was incubated at 37°C for 100 min. After digestion, 10 μL of products were analyzed on a 20% TBE polyacrylamide gel and appropriate bands purified by PAGE as described above. .. Fok I-digested fragments were ligated into linearized pRNAi-U6H1/Neo. pRNAi-U6H1/Neo was digested with BsmB I and dephosphorylated with calf intestinal alkaline phosphatase according to manufacturer's (NEB) protocols.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Size Unbiased Representative Enzymatically Generated RNAi (SURER) Library and Application for RNAi Therapeutic Screens
    Article Snippet: Reactions were preheated at 95°C for 1 min and amplified using 28 cycles of 95°C for 15 sec and 68°C for 1 min. After amplification, 10 μL of PCR products were analyzed on a 20% TBE polyacrylamide gel, and the remaining fragments purified using phenol–chloroform extraction and ethanol precipitation as described above; DNA pellets were resuspended in 20 μL ddH2 O. .. PCR-2 products were digested with Fok I enzyme; 50-μL reactions contained 20 μL purified PCR-2 products (from step 6), 2 μL Fok I (10 U, NEB), 5 μL NEBuffer-3 (NEB), and 23 μL ddH2 O, which was incubated at 37°C for 100 min. After digestion, 10 μL of products were analyzed on a 20% TBE polyacrylamide gel and appropriate bands purified by PAGE as described above. .. Fok I-digested fragments were ligated into linearized pRNAi-U6H1/Neo. pRNAi-U6H1/Neo was digested with BsmB I and dephosphorylated with calf intestinal alkaline phosphatase according to manufacturer's (NEB) protocols.

    Agarose Gel Electrophoresis:

    Article Title: Analysis of GNAS1 and Overlapping Transcripts Identifies the Parental Origin of Mutations in Patients with Sporadic Albright Hereditary Osteodystrophy and Reveals a Model System in Which to Observe the Effects of Splicing Mutations on Translated and Untranslated Messenger RNA
    Article Snippet: For the detection of heterozygotes for the exon 5 Fok I polymorphism (c.393T/C), DNA extracted from normal lymphoblast cells and cDNA from fetal tissue samples was amplified using primers GNAS4F/GNAS5R, for the DNA samples, and GNAS4F1/GNAS6R1, for the cDNA samples, and Megamix PCR premix (Microzone) ( and ). .. The products were digested with Fok I (NEB) and were separated on a 2% agarose gel. .. Seven heterozygous normal control lymphoblast cDNA samples, two heterozygous fetal cDNAs (lung and kidney), and cDNA from patient AHO-33 were amplified for the NESP55, exon 1A, and Gsα transcripts, by using NESPF2/GNAS10R1, EX1ARNAF/GNAS10R1, and MET1F/GNAS10R1, respectively.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    New England Biolabs foki
    a - d Restriction endonuclease digestion for <t>FokI,</t> <t>ApaI,</t> Bsm I and TaqI polymorphisms, M = Marker
    Foki, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/foki/product/New England Biolabs
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    foki - by Bioz Stars, 2021-05
    93/100 stars
      Buy from Supplier

    Image Search Results


    a - d Restriction endonuclease digestion for FokI, ApaI, Bsm I and TaqI polymorphisms, M = Marker

    Journal: BMC Nephrology

    Article Title: Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease

    doi: 10.1186/s12882-018-0831-7

    Figure Lengend Snippet: a - d Restriction endonuclease digestion for FokI, ApaI, Bsm I and TaqI polymorphisms, M = Marker

    Article Snippet: The PCR products were then digested with enzymes ApaI, BsmI, FokI, and TaqI (New England Biolabs, Beverly, MA, USA) according to the supplier’s protocol.

    Techniques: Marker

    a - d Restriction endonuclease digestion for FokI, ApaI, Bsm I and TaqI polymorphisms, M = Marker

    Journal: BMC Nephrology

    Article Title: Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease

    doi: 10.1186/s12882-018-0831-7

    Figure Lengend Snippet: a - d Restriction endonuclease digestion for FokI, ApaI, Bsm I and TaqI polymorphisms, M = Marker

    Article Snippet: The PCR products were then digested with enzymes ApaI, BsmI, FokI, and TaqI (New England Biolabs, Beverly, MA, USA) according to the supplier’s protocol.

    Techniques: Marker

    Imprinting of GNAS1 and overlapping transcripts in normal lymphoblast cell lines. The transcripts were amplified using an upstream primer in the unique exon and a downstream primer in exon 10 of GNAS1. Because of alternative splicing of exon 3 and multiple Fok I restriction-enzyme cut sites, nested amplification from exons 4–6 was performed on each transcript prior to Fok I digestion. The Fok I − allele (c.393T) gave a 195-bp product, and the Fok I + allele (c.393C) gave two products, of 122 and 73 bp (only the 122-bp product was visualized). An electropherogram demonstrating the fragments from one cell line (sized on an ABI 377 sequencer) is shown. a, Monoallelic expression of exon 1A, with only the + allele being present. b, Biallelic expression of Gsα, with − and + alleles being present. c, Monoallelic expression of NESP55 (opposite to exon 1A), with only the − allele being present.

    Journal: American Journal of Human Genetics

    Article Title: Analysis of GNAS1 and Overlapping Transcripts Identifies the Parental Origin of Mutations in Patients with Sporadic Albright Hereditary Osteodystrophy and Reveals a Model System in Which to Observe the Effects of Splicing Mutations on Translated and Untranslated Messenger RNA

    doi:

    Figure Lengend Snippet: Imprinting of GNAS1 and overlapping transcripts in normal lymphoblast cell lines. The transcripts were amplified using an upstream primer in the unique exon and a downstream primer in exon 10 of GNAS1. Because of alternative splicing of exon 3 and multiple Fok I restriction-enzyme cut sites, nested amplification from exons 4–6 was performed on each transcript prior to Fok I digestion. The Fok I − allele (c.393T) gave a 195-bp product, and the Fok I + allele (c.393C) gave two products, of 122 and 73 bp (only the 122-bp product was visualized). An electropherogram demonstrating the fragments from one cell line (sized on an ABI 377 sequencer) is shown. a, Monoallelic expression of exon 1A, with only the + allele being present. b, Biallelic expression of Gsα, with − and + alleles being present. c, Monoallelic expression of NESP55 (opposite to exon 1A), with only the − allele being present.

    Article Snippet: The products were digested with Fok I (NEB) and were separated on a 2% agarose gel.

    Techniques: Amplification, Expressing

    (A) Structures of loop-1 linkers (19–23 bp). Self-annealed loop-1 linkers contained EcoP15 I (CTGCTG) and Fok I (CATCC) sites followed by a universal PCR anchor. Different lengths of sRNAs can be generated by shifting the number of T/A pairs

    Journal: Nucleic Acid Therapeutics

    Article Title: Size Unbiased Representative Enzymatically Generated RNAi (SURER) Library and Application for RNAi Therapeutic Screens

    doi: 10.1089/nat.2014.0514

    Figure Lengend Snippet: (A) Structures of loop-1 linkers (19–23 bp). Self-annealed loop-1 linkers contained EcoP15 I (CTGCTG) and Fok I (CATCC) sites followed by a universal PCR anchor. Different lengths of sRNAs can be generated by shifting the number of T/A pairs

    Article Snippet: PCR-2 products were digested with Fok I enzyme; 50-μL reactions contained 20 μL purified PCR-2 products (from step 6), 2 μL Fok I (10 U, NEB), 5 μL NEBuffer-3 (NEB), and 23 μL ddH2 O, which was incubated at 37°C for 100 min. After digestion, 10 μL of products were analyzed on a 20% TBE polyacrylamide gel and appropriate bands purified by PAGE as described above.

    Techniques: Polymerase Chain Reaction, Generated

    Schematic diagram of the RNA interference expression vector pRNAi-U6H1/Neo. The vector contains a multiple cloning sites with two BsmB I restriction sites to permit cloning of Fok I-digested sRNA fragments and an Sfi I site to assist in screening for recombinants.

    Journal: Nucleic Acid Therapeutics

    Article Title: Size Unbiased Representative Enzymatically Generated RNAi (SURER) Library and Application for RNAi Therapeutic Screens

    doi: 10.1089/nat.2014.0514

    Figure Lengend Snippet: Schematic diagram of the RNA interference expression vector pRNAi-U6H1/Neo. The vector contains a multiple cloning sites with two BsmB I restriction sites to permit cloning of Fok I-digested sRNA fragments and an Sfi I site to assist in screening for recombinants.

    Article Snippet: PCR-2 products were digested with Fok I enzyme; 50-μL reactions contained 20 μL purified PCR-2 products (from step 6), 2 μL Fok I (10 U, NEB), 5 μL NEBuffer-3 (NEB), and 23 μL ddH2 O, which was incubated at 37°C for 100 min. After digestion, 10 μL of products were analyzed on a 20% TBE polyacrylamide gel and appropriate bands purified by PAGE as described above.

    Techniques: Expressing, Plasmid Preparation, Clone Assay