haeii restriction enzyme  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    HaeII
    Description:
    HaeII 10 000 units
    Catalog Number:
    r0107l
    Price:
    257
    Size:
    10 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs haeii restriction enzyme
    HaeII
    HaeII 10 000 units
    https://www.bioz.com/result/haeii restriction enzyme/product/New England Biolabs
    Average 90 stars, based on 12627 article reviews
    Price from $9.99 to $1999.99
    haeii restriction enzyme - by Bioz Stars, 2020-04
    90/100 stars

    Images

    1) Product Images from "Molecular Typing of Methicillin Resistant Staphylococcus aureus Clinical Isolates on the Basis of Protein A and Coagulase Gene Polymorphisms"

    Article Title: Molecular Typing of Methicillin Resistant Staphylococcus aureus Clinical Isolates on the Basis of Protein A and Coagulase Gene Polymorphisms

    Journal: International Journal of Microbiology

    doi: 10.1155/2014/650328

    Representative 2% agarose gel electrophoresis of spa gene HaeII restriction enzyme digestion PCR products, where M is DNA molecular size marker (100 bp ladder). (a) isolate 64 showing 2 bands spa gene PCR products (A) that remained uncut after (B) restriction, (b) isolate 1 showing single band spa gene PCR products (A) and the corresponding 3 bands HaeII restriction digestion pattern (B), and (c) isolate 62 showing 2 bands spa gene PCR products (A) and its corresponding 4 bands HaeII restriction digestion products (B).
    Figure Legend Snippet: Representative 2% agarose gel electrophoresis of spa gene HaeII restriction enzyme digestion PCR products, where M is DNA molecular size marker (100 bp ladder). (a) isolate 64 showing 2 bands spa gene PCR products (A) that remained uncut after (B) restriction, (b) isolate 1 showing single band spa gene PCR products (A) and the corresponding 3 bands HaeII restriction digestion pattern (B), and (c) isolate 62 showing 2 bands spa gene PCR products (A) and its corresponding 4 bands HaeII restriction digestion products (B).

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Marker

    Related Articles

    Clone Assay:

    Article Title: Inactivation and Inducible Oncogenic Mutation of p53 in Gene Targeted Pigs
    Article Snippet: Paragraph title: PCR and RT-PCR analysis of targeted MSC clones ... Wild-type p53 and mutant p53-R167H RT-PCR products containing the G to A substitution mutation were distinguished by HaeII (NEB) digestion.

    Article Title: The Axon Guidance Receptor Gene ROBO1 Is a Candidate Gene for Developmental Dyslexia
    Article Snippet: YAC clones A136E9 (Washington University, St. Louis, Missouri, United States), 34FC9, 15AC10, 39F13, 2DG9, 25DH8, 35AH8 (ICI/Zeneca), 912A11, 934E8, 422A6, 959F5, 650C2, 938D4, and BAC RP11-143B12 were used as probes in fluorescence in situ hybridization experiments. .. Southern blotting and hybridizations were performed by standard protocols with seven μg of DNA from the translocation patient and a healthy control individual digested in separate reactions with BamHI, BglII, EarI, EcoRI, HaeII, HindIII, NcoI, and PstI (New England Biolabs, Beverly, Massachusetts, United States).

    Amplification:

    Article Title: Inactivation and Inducible Oncogenic Mutation of p53 in Gene Targeted Pigs
    Article Snippet: Thermal cycling parameters were: 5 min, 95°C; then 30 cycles of: 30 sec, 95°C; 30 sec, 58°C; 1:30 min, 72°C; followed by 5 min, 72°C. mRNAs expressed from wild type TP53 and the Cre-recombined TP53LR167H allele were detected by RT-PCR amplification of a 1.313 kb fragment from exon 1 to exon 11 by two step RT-PCR with Superscript III RT according to the manufacturer's instructions, using primers ex1F ( 5′ GCAGGTAGCTGCTGGTCTC 3′ ) and ex11R ( 5′ AGGGACTTCAAAAGGGGATG 3′ ) with GoTaq polymerase. .. Wild-type p53 and mutant p53-R167H RT-PCR products containing the G to A substitution mutation were distinguished by HaeII (NEB) digestion.

    Article Title: Extraction of amplifiable DNA from embalmed human cadaver tissue
    Article Snippet: .. Amplified DNA was digested with HaeII and AflIII (NEB cat#R0107S and R0541S) for 2 h at 37 °C and resolved on a 4% agarose gel. ..

    Article Title: Frequencies of mtDNA mutations in primary tissue of colorectal adenopolyps
    Article Snippet: Extracted genomic DNA from each tissue sample was Polymerase Chain Reaction (PCR) amplified with mtDNA specific primers according to Aikhionbare et al . .. Restriction Fragment Length Polymorphisms (RFLP) was performed with HaeIII, HaeII, and HinfI according to the manufacturer's protocols (New England Biolab).

    Article Title: The Role of Apolipoprotein E as a Risk Factor for an Earlier Age at Onset for Machado-Joseph Disease Is Doubtful
    Article Snippet: .. The amplification products were then incubated with the endonucleases AflIII (1 U) and HaeII (1 U) (New England Biolabs, Beverly, MA, USA), respectively, according to the manufacturer's recommendations. .. Finally, the corresponding digestion products and a pair of control fragments were collectively detected using automated capillary electrophoresis in an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems).

    Article Title: Apolipoprotein-E forms dimers in human frontal cortex and hippocampus
    Article Snippet: Briefly, each reaction (50 μL) contained 200 nM of each primer (Invitrogen, Carlsbad, CA) 5'-TCCAAGGAGCTGCAGGCGGCGCA-3' (forward) and 5'-ACAGAATTCGCCCCGGCCTGGTACACTGCCA-3' (reverse), 2 mM dNTPs, 2 mM MgCl2, 2 U Taq polymerase (PCR reagents supplied by Promega, Madison, WI) and 400 ng DNA, all combined in nuclease free H2 O. Amplification was carried out with 38 cycles of denaturation (95°C, 30 sec), annealing (60°C, 30 sec) and extension (70°C, 30 sec). .. The 244 bp PCR product was purified using the QIAquick PCR purification kit (Qiagen, Venlo, Netherlands), following the manufacturer's protocol, and eluted in 40 μL H2 O. Endonuclease restriction digests (25 μL) were performed on 15 μL of eluted DNA using either AflIII (5 U) or HaeII (20 U) in the presence of BSA (100 μg/mL) and the supplied buffer (New England Biolabs, Ipswich, MA) at 37°C for 16 h. The ε3 allele is resistant to both enzymes while ε4 is cleaved by AflIII (producing a 190 bp product) and ε2 is cleaved by HaeII (producing a 191 bp product) assessed using ethidium bromide stained 8% polyacrylamide gels.

    Filtration:

    Article Title: The Fourth Apolipoprotein E Haplotype Found in the Yoruba of Ibadan
    Article Snippet: Lipoproteins were fractionated by gel filtration or agarose electrophoresis [ ]. .. Since the rare CT haplotype in combination with the frequent APOE ε3 TC haplotype would give an APOE ε2/ε4 HhaI digestion pattern and would not be distinguished by direct sequencing, all samples resulting in a ε2/ε4 genotype were digested with restriction enzymes AflIII and HaeII (New England Biolabs, Beverly, MA) [ ].

    Electrophoresis:

    Article Title: The Fourth Apolipoprotein E Haplotype Found in the Yoruba of Ibadan
    Article Snippet: Lipoproteins were fractionated by gel filtration or agarose electrophoresis [ ]. .. Since the rare CT haplotype in combination with the frequent APOE ε3 TC haplotype would give an APOE ε2/ε4 HhaI digestion pattern and would not be distinguished by direct sequencing, all samples resulting in a ε2/ε4 genotype were digested with restriction enzymes AflIII and HaeII (New England Biolabs, Beverly, MA) [ ].

    Article Title: The Role of Apolipoprotein E as a Risk Factor for an Earlier Age at Onset for Machado-Joseph Disease Is Doubtful
    Article Snippet: The amplification products were then incubated with the endonucleases AflIII (1 U) and HaeII (1 U) (New England Biolabs, Beverly, MA, USA), respectively, according to the manufacturer's recommendations. .. Finally, the corresponding digestion products and a pair of control fragments were collectively detected using automated capillary electrophoresis in an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems).

    Incubation:

    Article Title: The Role of Apolipoprotein E as a Risk Factor for an Earlier Age at Onset for Machado-Joseph Disease Is Doubtful
    Article Snippet: .. The amplification products were then incubated with the endonucleases AflIII (1 U) and HaeII (1 U) (New England Biolabs, Beverly, MA, USA), respectively, according to the manufacturer's recommendations. .. Finally, the corresponding digestion products and a pair of control fragments were collectively detected using automated capillary electrophoresis in an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems).

    Activated Clotting Time Assay:

    Article Title: The Role of Apolipoprotein E as a Risk Factor for an Earlier Age at Onset for Machado-Joseph Disease Is Doubtful
    Article Snippet: Primer pairs were designed to genotype rs429358 (fluorescence-labeled forward primer: 5′-[FAM] AGG GCG CTG ATG GAC GAG AC-3′ and reverse primer 5′- GCC CCG GCC TGG TAC ACT-3′ ) and rs7412 (fluorescence-labeled forward primer 5′-[FAM] GGC GCG GAC ATG GAG GAC-3′ and reverse primer 5′-GCC CCG GCC TGG TAC ACT-3′ ). .. The amplification products were then incubated with the endonucleases AflIII (1 U) and HaeII (1 U) (New England Biolabs, Beverly, MA, USA), respectively, according to the manufacturer's recommendations.

    Derivative Assay:

    Article Title: Frequencies of mtDNA mutations in primary tissue of colorectal adenopolyps
    Article Snippet: Restriction Fragment Length Polymorphisms (RFLP) was performed with HaeIII, HaeII, and HinfI according to the manufacturer's protocols (New England Biolab). .. Sequences of both sense and anti-sense strands were derived with ABI 3130xl Gene Analyzer.

    Hybridization:

    Article Title: The Axon Guidance Receptor Gene ROBO1 Is a Candidate Gene for Developmental Dyslexia
    Article Snippet: Paragraph title: Fluorescence in situ and Southern hybridization. ... Southern blotting and hybridizations were performed by standard protocols with seven μg of DNA from the translocation patient and a healthy control individual digested in separate reactions with BamHI, BglII, EarI, EcoRI, HaeII, HindIII, NcoI, and PstI (New England Biolabs, Beverly, Massachusetts, United States).

    Sequencing:

    Article Title: The Fourth Apolipoprotein E Haplotype Found in the Yoruba of Ibadan
    Article Snippet: .. Since the rare CT haplotype in combination with the frequent APOE ε3 TC haplotype would give an APOE ε2/ε4 HhaI digestion pattern and would not be distinguished by direct sequencing, all samples resulting in a ε2/ε4 genotype were digested with restriction enzymes AflIII and HaeII (New England Biolabs, Beverly, MA) [ ]. ..

    Article Title: Inactivation and Inducible Oncogenic Mutation of p53 in Gene Targeted Pigs
    Article Snippet: Cre-mediated excision of the LSL cassette was detected by PCR across the LSL insertion site using primers int1F ( 5′ TGAGGAATTTGTATGCCAAGG 3′ ) and int1R (sequence above) with GoTaq polymerase. .. Wild-type p53 and mutant p53-R167H RT-PCR products containing the G to A substitution mutation were distinguished by HaeII (NEB) digestion.

    Article Title: In vitro centromere and kinetochore assembly on defined chromatin templates
    Article Snippet: .. Preparation of biotinylated array DNA A tandem array of 19 copies of the high affinity nucleosome positioning sequence (19×601) , was digested with EcoRI, XbaI, DraI and HaeII (NEB) overnight to excise the 19mer array and to digest the remaining backbone DNA to smaller DNA fragments. .. The array DNA was then purified by PEG precipitation and dialyzed against 10mM Tris-HCl pH 8.0, 0.25mM EDTA as previously described .

    Article Title: The Axon Guidance Receptor Gene ROBO1 Is a Candidate Gene for Developmental Dyslexia
    Article Snippet: The repeats in the clone sequence were detected by RepeatMasker ( http://repeatmasker.genome.washington.edu/cgi-bin/RepeatMasker ) and PCR primers were designed by Primer3 ( http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi ) to encompass non-repetitive segments of 700–1,000 bp (primer sequences available from authors on request). .. Southern blotting and hybridizations were performed by standard protocols with seven μg of DNA from the translocation patient and a healthy control individual digested in separate reactions with BamHI, BglII, EarI, EcoRI, HaeII, HindIII, NcoI, and PstI (New England Biolabs, Beverly, Massachusetts, United States).

    Article Title: The Role of Apolipoprotein E as a Risk Factor for an Earlier Age at Onset for Machado-Joseph Disease Is Doubtful
    Article Snippet: Molecular analysis of ATXN3 was performed as previously reported , and the lengths of the expanded and normal CAG repeats were determined using Sanger sequencing. .. The amplification products were then incubated with the endonucleases AflIII (1 U) and HaeII (1 U) (New England Biolabs, Beverly, MA, USA), respectively, according to the manufacturer's recommendations.

    Southern Blot:

    Article Title: The Axon Guidance Receptor Gene ROBO1 Is a Candidate Gene for Developmental Dyslexia
    Article Snippet: .. Southern blotting and hybridizations were performed by standard protocols with seven μg of DNA from the translocation patient and a healthy control individual digested in separate reactions with BamHI, BglII, EarI, EcoRI, HaeII, HindIII, NcoI, and PstI (New England Biolabs, Beverly, Massachusetts, United States). .. Polymorphism screening of ROBO1 and expression analysis.

    Translocation Assay:

    Article Title: The Axon Guidance Receptor Gene ROBO1 Is a Candidate Gene for Developmental Dyslexia
    Article Snippet: .. Southern blotting and hybridizations were performed by standard protocols with seven μg of DNA from the translocation patient and a healthy control individual digested in separate reactions with BamHI, BglII, EarI, EcoRI, HaeII, HindIII, NcoI, and PstI (New England Biolabs, Beverly, Massachusetts, United States). .. Polymorphism screening of ROBO1 and expression analysis.

    DNA Labeling:

    Article Title: The Axon Guidance Receptor Gene ROBO1 Is a Candidate Gene for Developmental Dyslexia
    Article Snippet: PCR assays were performed under standard conditions and 10 ng of the purified PCR products (Qiagen PCR purification kit) (Qiagen, Valencia, California, United States) and 10 ng of the purified probes were labeled with [a-32P] dCTP (Rediprime DNA Labeling System, Amersham Biosciences, Little Chalfont, United Kingdom). .. Southern blotting and hybridizations were performed by standard protocols with seven μg of DNA from the translocation patient and a healthy control individual digested in separate reactions with BamHI, BglII, EarI, EcoRI, HaeII, HindIII, NcoI, and PstI (New England Biolabs, Beverly, Massachusetts, United States).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Inactivation and Inducible Oncogenic Mutation of p53 in Gene Targeted Pigs
    Article Snippet: .. Wild-type p53 and mutant p53-R167H RT-PCR products containing the G to A substitution mutation were distinguished by HaeII (NEB) digestion. ..

    Molecular Cloning:

    Article Title: OsGPAT3 Plays a Critical Role in Anther Wall Programmed Cell Death and Pollen Development in Rice
    Article Snippet: Paragraph title: 4.4. Molecular Cloning of Osgpat3-2 ... A total of 100 µL of this reaction system contained 3 µL of HaeII (20 units per 1 µL), 10 µL of NEBuffer (1×), 60 µL of purified DNA template (3 µg), and 27 µL of distilled deionized H2 O (ddH2 O).

    Fluorescence:

    Article Title: The Axon Guidance Receptor Gene ROBO1 Is a Candidate Gene for Developmental Dyslexia
    Article Snippet: Paragraph title: Fluorescence in situ and Southern hybridization. ... Southern blotting and hybridizations were performed by standard protocols with seven μg of DNA from the translocation patient and a healthy control individual digested in separate reactions with BamHI, BglII, EarI, EcoRI, HaeII, HindIII, NcoI, and PstI (New England Biolabs, Beverly, Massachusetts, United States).

    Article Title: The Role of Apolipoprotein E as a Risk Factor for an Earlier Age at Onset for Machado-Joseph Disease Is Doubtful
    Article Snippet: Primer pairs were designed to genotype rs429358 (fluorescence-labeled forward primer: 5′-[FAM] AGG GCG CTG ATG GAC GAG AC-3′ and reverse primer 5′- GCC CCG GCC TGG TAC ACT-3′ ) and rs7412 (fluorescence-labeled forward primer 5′-[FAM] GGC GCG GAC ATG GAG GAC-3′ and reverse primer 5′-GCC CCG GCC TGG TAC ACT-3′ ). .. The amplification products were then incubated with the endonucleases AflIII (1 U) and HaeII (1 U) (New England Biolabs, Beverly, MA, USA), respectively, according to the manufacturer's recommendations.

    Mutagenesis:

    Article Title: Inactivation and Inducible Oncogenic Mutation of p53 in Gene Targeted Pigs
    Article Snippet: .. Wild-type p53 and mutant p53-R167H RT-PCR products containing the G to A substitution mutation were distinguished by HaeII (NEB) digestion. ..

    Size-exclusion Chromatography:

    Article Title: Inactivation and Inducible Oncogenic Mutation of p53 in Gene Targeted Pigs
    Article Snippet: Thermal cycling parameters were: 3 min, 95°C; then 35 cycles of: 30 sec, 95°C; 30 sec, 58°C; 1:30 min, 72°C; followed by 3 min, 72°C. .. Wild-type p53 and mutant p53-R167H RT-PCR products containing the G to A substitution mutation were distinguished by HaeII (NEB) digestion.

    Article Title: Apolipoprotein-E forms dimers in human frontal cortex and hippocampus
    Article Snippet: Briefly, each reaction (50 μL) contained 200 nM of each primer (Invitrogen, Carlsbad, CA) 5'-TCCAAGGAGCTGCAGGCGGCGCA-3' (forward) and 5'-ACAGAATTCGCCCCGGCCTGGTACACTGCCA-3' (reverse), 2 mM dNTPs, 2 mM MgCl2, 2 U Taq polymerase (PCR reagents supplied by Promega, Madison, WI) and 400 ng DNA, all combined in nuclease free H2 O. Amplification was carried out with 38 cycles of denaturation (95°C, 30 sec), annealing (60°C, 30 sec) and extension (70°C, 30 sec). .. The 244 bp PCR product was purified using the QIAquick PCR purification kit (Qiagen, Venlo, Netherlands), following the manufacturer's protocol, and eluted in 40 μL H2 O. Endonuclease restriction digests (25 μL) were performed on 15 μL of eluted DNA using either AflIII (5 U) or HaeII (20 U) in the presence of BSA (100 μg/mL) and the supplied buffer (New England Biolabs, Ipswich, MA) at 37°C for 16 h. The ε3 allele is resistant to both enzymes while ε4 is cleaved by AflIII (producing a 190 bp product) and ε2 is cleaved by HaeII (producing a 191 bp product) assessed using ethidium bromide stained 8% polyacrylamide gels.

    Labeling:

    Article Title: In vitro centromere and kinetochore assembly on defined chromatin templates
    Article Snippet: Preparation of biotinylated array DNA A tandem array of 19 copies of the high affinity nucleosome positioning sequence (19×601) , was digested with EcoRI, XbaI, DraI and HaeII (NEB) overnight to excise the 19mer array and to digest the remaining backbone DNA to smaller DNA fragments. .. The labeled DNA was then purified using a PCR fragment purification kit (Qiagen).

    Article Title: The Axon Guidance Receptor Gene ROBO1 Is a Candidate Gene for Developmental Dyslexia
    Article Snippet: PCR assays were performed under standard conditions and 10 ng of the purified PCR products (Qiagen PCR purification kit) (Qiagen, Valencia, California, United States) and 10 ng of the purified probes were labeled with [a-32P] dCTP (Rediprime DNA Labeling System, Amersham Biosciences, Little Chalfont, United Kingdom). .. Southern blotting and hybridizations were performed by standard protocols with seven μg of DNA from the translocation patient and a healthy control individual digested in separate reactions with BamHI, BglII, EarI, EcoRI, HaeII, HindIII, NcoI, and PstI (New England Biolabs, Beverly, Massachusetts, United States).

    Purification:

    Article Title: OsGPAT3 Plays a Critical Role in Anther Wall Programmed Cell Death and Pollen Development in Rice
    Article Snippet: .. A total of 100 µL of this reaction system contained 3 µL of HaeII (20 units per 1 µL), 10 µL of NEBuffer (1×), 60 µL of purified DNA template (3 µg), and 27 µL of distilled deionized H2 O (ddH2 O). ..

    Article Title: A cell free system for functional centromere and kinetochore assembly Authors
    Article Snippet: .. QIAquick PCR purification kit (Qiagen, catalogue # 28106) Restriction enzymes EcoRI, DraI, XbaI, HaeII, AvaI (New England BioLabs, catalogue # R0101, R0129, R0145, R0107, R0152) NEB 2-log DNA ladder (New England BioLabs, catalogue # N3200) Agarose (GeneMate LE, catalogue # E-3120) Biotin-14-ATP (Invitrogen, catalogue # 19524-016) Alpha-thio-dTTP (Chemcyte, catalogue # CC-3004-1) Alpha-thio-dGTP (Chemcyte, catalogue # CC-3003-1 dCTP (Invitrogen, catalogue # 10217016) Klenow fragment (Invitrogen, catalogue # M0212) Streptavidin-FITC at 0.2mg/ml (e.g. Invitrogen catalogue # 43-4311) Polyethylene glycol (PEG) 4000 (TCI America, catalogue # P0885) HCl (J.T. .. Baker, catalogue # 9530) CAUTION: corrosive, causes burns, use eye and skin protection and a chemical fume hood.

    Article Title: In vitro centromere and kinetochore assembly on defined chromatin templates
    Article Snippet: Preparation of biotinylated array DNA A tandem array of 19 copies of the high affinity nucleosome positioning sequence (19×601) , was digested with EcoRI, XbaI, DraI and HaeII (NEB) overnight to excise the 19mer array and to digest the remaining backbone DNA to smaller DNA fragments. .. The array DNA was then purified by PEG precipitation and dialyzed against 10mM Tris-HCl pH 8.0, 0.25mM EDTA as previously described .

    Article Title: The Axon Guidance Receptor Gene ROBO1 Is a Candidate Gene for Developmental Dyslexia
    Article Snippet: PCR assays were performed under standard conditions and 10 ng of the purified PCR products (Qiagen PCR purification kit) (Qiagen, Valencia, California, United States) and 10 ng of the purified probes were labeled with [a-32P] dCTP (Rediprime DNA Labeling System, Amersham Biosciences, Little Chalfont, United Kingdom). .. Southern blotting and hybridizations were performed by standard protocols with seven μg of DNA from the translocation patient and a healthy control individual digested in separate reactions with BamHI, BglII, EarI, EcoRI, HaeII, HindIII, NcoI, and PstI (New England Biolabs, Beverly, Massachusetts, United States).

    Article Title: Apolipoprotein-E forms dimers in human frontal cortex and hippocampus
    Article Snippet: .. The 244 bp PCR product was purified using the QIAquick PCR purification kit (Qiagen, Venlo, Netherlands), following the manufacturer's protocol, and eluted in 40 μL H2 O. Endonuclease restriction digests (25 μL) were performed on 15 μL of eluted DNA using either AflIII (5 U) or HaeII (20 U) in the presence of BSA (100 μg/mL) and the supplied buffer (New England Biolabs, Ipswich, MA) at 37°C for 16 h. The ε3 allele is resistant to both enzymes while ε4 is cleaved by AflIII (producing a 190 bp product) and ε2 is cleaved by HaeII (producing a 191 bp product) assessed using ethidium bromide stained 8% polyacrylamide gels. .. SK-N-SH neuroblastoma cell culture Cell culture media and additives were from Invitrogen (Melbourne, Australia).

    Polymerase Chain Reaction:

    Article Title: Differential levels of p75NTR ectodomain in CSF and blood in patients with Alzheimer's disease: a novel diagnostic marker
    Article Snippet: The PCR reactions were performed with 1 μl DNA sample, 1 × GC-I buffer (TaKaRa, Kusatsu, Japan), 2.0 mM Mg2+ , 0.2 mM dNTP (Generay Biotech, Shanghai, China), 1U HotStarTaq polymerase (Qiagen, Hilden, Germany), 2 μl multiple PCR primers (Sangon, Shanghai, China) and ddH2 O in a total volume of 10 μl. .. The digestion of endonuclease was performed with AflIII or HaeII (New England Biolabs, Ipswich, MA, USA) for rs429358 or rs7412, respectively.

    Article Title: A cell free system for functional centromere and kinetochore assembly Authors
    Article Snippet: .. QIAquick PCR purification kit (Qiagen, catalogue # 28106) Restriction enzymes EcoRI, DraI, XbaI, HaeII, AvaI (New England BioLabs, catalogue # R0101, R0129, R0145, R0107, R0152) NEB 2-log DNA ladder (New England BioLabs, catalogue # N3200) Agarose (GeneMate LE, catalogue # E-3120) Biotin-14-ATP (Invitrogen, catalogue # 19524-016) Alpha-thio-dTTP (Chemcyte, catalogue # CC-3004-1) Alpha-thio-dGTP (Chemcyte, catalogue # CC-3003-1 dCTP (Invitrogen, catalogue # 10217016) Klenow fragment (Invitrogen, catalogue # M0212) Streptavidin-FITC at 0.2mg/ml (e.g. Invitrogen catalogue # 43-4311) Polyethylene glycol (PEG) 4000 (TCI America, catalogue # P0885) HCl (J.T. .. Baker, catalogue # 9530) CAUTION: corrosive, causes burns, use eye and skin protection and a chemical fume hood.

    Article Title: Molecular Typing of Methicillin Resistant Staphylococcus aureus Clinical Isolates on the Basis of Protein A and Coagulase Gene Polymorphisms
    Article Snippet: .. A similarly designed study by Mitani et al. [ ] reported 8 spa and 6 coa types using HaeII restriction enzyme for coa and spa genes PCR-RFLP. ..

    Article Title: Inactivation and Inducible Oncogenic Mutation of p53 in Gene Targeted Pigs
    Article Snippet: Paragraph title: PCR and RT-PCR analysis of targeted MSC clones ... Wild-type p53 and mutant p53-R167H RT-PCR products containing the G to A substitution mutation were distinguished by HaeII (NEB) digestion.

    Article Title: In vitro centromere and kinetochore assembly on defined chromatin templates
    Article Snippet: Preparation of biotinylated array DNA A tandem array of 19 copies of the high affinity nucleosome positioning sequence (19×601) , was digested with EcoRI, XbaI, DraI and HaeII (NEB) overnight to excise the 19mer array and to digest the remaining backbone DNA to smaller DNA fragments. .. The labeled DNA was then purified using a PCR fragment purification kit (Qiagen).

    Article Title: The Axon Guidance Receptor Gene ROBO1 Is a Candidate Gene for Developmental Dyslexia
    Article Snippet: PCR assays were performed under standard conditions and 10 ng of the purified PCR products (Qiagen PCR purification kit) (Qiagen, Valencia, California, United States) and 10 ng of the purified probes were labeled with [a-32P] dCTP (Rediprime DNA Labeling System, Amersham Biosciences, Little Chalfont, United Kingdom). .. Southern blotting and hybridizations were performed by standard protocols with seven μg of DNA from the translocation patient and a healthy control individual digested in separate reactions with BamHI, BglII, EarI, EcoRI, HaeII, HindIII, NcoI, and PstI (New England Biolabs, Beverly, Massachusetts, United States).

    Article Title: Extraction of amplifiable DNA from embalmed human cadaver tissue
    Article Snippet: Paragraph title: APOE PCR amplification and digest ... Amplified DNA was digested with HaeII and AflIII (NEB cat#R0107S and R0541S) for 2 h at 37 °C and resolved on a 4% agarose gel.

    Article Title: Frequencies of mtDNA mutations in primary tissue of colorectal adenopolyps
    Article Snippet: Paragraph title: 3.2. High resolution restriction endonucleases and PCR-based analysis of mtDNA variants ... Restriction Fragment Length Polymorphisms (RFLP) was performed with HaeIII, HaeII, and HinfI according to the manufacturer's protocols (New England Biolab).

    Article Title: The Role of Apolipoprotein E as a Risk Factor for an Earlier Age at Onset for Machado-Joseph Disease Is Doubtful
    Article Snippet: PCR reactions for the two SNPs were each performed in a 10 µL reaction mixture containing 1x GC buffer I, 2 mM MgCl2, 0.2 mM dNTP, 2 µM primers, 1 U Hotstar Taq polymerase (Qiagen, Hilden, Germany), and 30 ng template DNA, using the following cycling conditions: an initial denaturation at 95°C for 15 min, followed by 11 cycles of 94°C for 20 s, 65°C (0.5°C decrease per cycle) for 40 s, 72°C for 1.5 min, then another 24 cycles of 94°C for 20 s, 59°C for 30 s, and 72°C for 1.5 min, and a final extension step at 72°C for 2 min. .. The amplification products were then incubated with the endonucleases AflIII (1 U) and HaeII (1 U) (New England Biolabs, Beverly, MA, USA), respectively, according to the manufacturer's recommendations.

    Article Title: Apolipoprotein-E forms dimers in human frontal cortex and hippocampus
    Article Snippet: .. The 244 bp PCR product was purified using the QIAquick PCR purification kit (Qiagen, Venlo, Netherlands), following the manufacturer's protocol, and eluted in 40 μL H2 O. Endonuclease restriction digests (25 μL) were performed on 15 μL of eluted DNA using either AflIII (5 U) or HaeII (20 U) in the presence of BSA (100 μg/mL) and the supplied buffer (New England Biolabs, Ipswich, MA) at 37°C for 16 h. The ε3 allele is resistant to both enzymes while ε4 is cleaved by AflIII (producing a 190 bp product) and ε2 is cleaved by HaeII (producing a 191 bp product) assessed using ethidium bromide stained 8% polyacrylamide gels. .. SK-N-SH neuroblastoma cell culture Cell culture media and additives were from Invitrogen (Melbourne, Australia).

    Microscopy:

    Article Title: Frequencies of mtDNA mutations in primary tissue of colorectal adenopolyps
    Article Snippet: To increase the quality of target DNA extracted from small samples, laser-capture micro-dissection was performed on the selected tissue samples with the use of an Arctus PixCell II microscope (Arcturus Engineering) for replication of the distance between the polyps and matched surrounding precancerous normal-appearing cells. .. Restriction Fragment Length Polymorphisms (RFLP) was performed with HaeIII, HaeII, and HinfI according to the manufacturer's protocols (New England Biolab).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Extraction of amplifiable DNA from embalmed human cadaver tissue
    Article Snippet: .. Amplified DNA was digested with HaeII and AflIII (NEB catR0107S and R0541S) for 2 h at 37 °C and resolved on a 4% agarose gel. ..

    In Situ Hybridization:

    Article Title: The Axon Guidance Receptor Gene ROBO1 Is a Candidate Gene for Developmental Dyslexia
    Article Snippet: YAC clones A136E9 (Washington University, St. Louis, Missouri, United States), 34FC9, 15AC10, 39F13, 2DG9, 25DH8, 35AH8 (ICI/Zeneca), 912A11, 934E8, 422A6, 959F5, 650C2, 938D4, and BAC RP11-143B12 were used as probes in fluorescence in situ hybridization experiments. .. Southern blotting and hybridizations were performed by standard protocols with seven μg of DNA from the translocation patient and a healthy control individual digested in separate reactions with BamHI, BglII, EarI, EcoRI, HaeII, HindIII, NcoI, and PstI (New England Biolabs, Beverly, Massachusetts, United States).

    Agarose Gel Electrophoresis:

    Article Title: The Fourth Apolipoprotein E Haplotype Found in the Yoruba of Ibadan
    Article Snippet: Since the rare CT haplotype in combination with the frequent APOE ε3 TC haplotype would give an APOE ε2/ε4 HhaI digestion pattern and would not be distinguished by direct sequencing, all samples resulting in a ε2/ε4 genotype were digested with restriction enzymes AflIII and HaeII (New England Biolabs, Beverly, MA) [ ]. .. Fractionation of lipoproteins by gel filtration and agarose gel electrophoresis revealed a normal distribution of lipoproteins.

    Article Title: Extraction of amplifiable DNA from embalmed human cadaver tissue
    Article Snippet: .. Amplified DNA was digested with HaeII and AflIII (NEB cat#R0107S and R0541S) for 2 h at 37 °C and resolved on a 4% agarose gel. ..

    In Situ:

    Article Title: The Axon Guidance Receptor Gene ROBO1 Is a Candidate Gene for Developmental Dyslexia
    Article Snippet: Paragraph title: Fluorescence in situ and Southern hybridization. ... Southern blotting and hybridizations were performed by standard protocols with seven μg of DNA from the translocation patient and a healthy control individual digested in separate reactions with BamHI, BglII, EarI, EcoRI, HaeII, HindIII, NcoI, and PstI (New England Biolabs, Beverly, Massachusetts, United States).

    Fractionation:

    Article Title: The Fourth Apolipoprotein E Haplotype Found in the Yoruba of Ibadan
    Article Snippet: Since the rare CT haplotype in combination with the frequent APOE ε3 TC haplotype would give an APOE ε2/ε4 HhaI digestion pattern and would not be distinguished by direct sequencing, all samples resulting in a ε2/ε4 genotype were digested with restriction enzymes AflIII and HaeII (New England Biolabs, Beverly, MA) [ ]. .. Fractionation of lipoproteins by gel filtration and agarose gel electrophoresis revealed a normal distribution of lipoproteins.

    BAC Assay:

    Article Title: The Axon Guidance Receptor Gene ROBO1 Is a Candidate Gene for Developmental Dyslexia
    Article Snippet: Southern hybridization probes were PCR-amplified genomic fragments from non-repetitive regions on the BAC clone RP11-143B12. .. Southern blotting and hybridizations were performed by standard protocols with seven μg of DNA from the translocation patient and a healthy control individual digested in separate reactions with BamHI, BglII, EarI, EcoRI, HaeII, HindIII, NcoI, and PstI (New England Biolabs, Beverly, Massachusetts, United States).

    CTG Assay:

    Article Title: The Role of Apolipoprotein E as a Risk Factor for an Earlier Age at Onset for Machado-Joseph Disease Is Doubtful
    Article Snippet: Primer pairs were designed to genotype rs429358 (fluorescence-labeled forward primer: 5′-[FAM] AGG GCG CTG ATG GAC GAG AC-3′ and reverse primer 5′- GCC CCG GCC TGG TAC ACT-3′ ) and rs7412 (fluorescence-labeled forward primer 5′-[FAM] GGC GCG GAC ATG GAG GAC-3′ and reverse primer 5′-GCC CCG GCC TGG TAC ACT-3′ ). .. The amplification products were then incubated with the endonucleases AflIII (1 U) and HaeII (1 U) (New England Biolabs, Beverly, MA, USA), respectively, according to the manufacturer's recommendations.

    Staining:

    Article Title: Apolipoprotein-E forms dimers in human frontal cortex and hippocampus
    Article Snippet: .. The 244 bp PCR product was purified using the QIAquick PCR purification kit (Qiagen, Venlo, Netherlands), following the manufacturer's protocol, and eluted in 40 μL H2 O. Endonuclease restriction digests (25 μL) were performed on 15 μL of eluted DNA using either AflIII (5 U) or HaeII (20 U) in the presence of BSA (100 μg/mL) and the supplied buffer (New England Biolabs, Ipswich, MA) at 37°C for 16 h. The ε3 allele is resistant to both enzymes while ε4 is cleaved by AflIII (producing a 190 bp product) and ε2 is cleaved by HaeII (producing a 191 bp product) assessed using ethidium bromide stained 8% polyacrylamide gels. .. SK-N-SH neuroblastoma cell culture Cell culture media and additives were from Invitrogen (Melbourne, Australia).

    Hood:

    Article Title: A cell free system for functional centromere and kinetochore assembly Authors
    Article Snippet: QIAquick PCR purification kit (Qiagen, catalogue # 28106) Restriction enzymes EcoRI, DraI, XbaI, HaeII, AvaI (New England BioLabs, catalogue # R0101, R0129, R0145, R0107, R0152) NEB 2-log DNA ladder (New England BioLabs, catalogue # N3200) Agarose (GeneMate LE, catalogue # E-3120) Biotin-14-ATP (Invitrogen, catalogue # 19524-016) Alpha-thio-dTTP (Chemcyte, catalogue # CC-3004-1) Alpha-thio-dGTP (Chemcyte, catalogue # CC-3003-1 dCTP (Invitrogen, catalogue # 10217016) Klenow fragment (Invitrogen, catalogue # M0212) Streptavidin-FITC at 0.2mg/ml (e.g. Invitrogen catalogue # 43-4311) Polyethylene glycol (PEG) 4000 (TCI America, catalogue # P0885) HCl (J.T. .. Baker, catalogue # 9530) CAUTION: corrosive, causes burns, use eye and skin protection and a chemical fume hood.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs haeii restriction enzyme
    Representative 2% agarose gel electrophoresis of spa gene <t>HaeII</t> restriction enzyme digestion <t>PCR</t> products, where M is DNA molecular size marker (100 bp ladder). (a) isolate 64 showing 2 bands spa gene PCR products (A) that remained uncut after (B) restriction, (b) isolate 1 showing single band spa gene PCR products (A) and the corresponding 3 bands HaeII restriction digestion pattern (B), and (c) isolate 62 showing 2 bands spa gene PCR products (A) and its corresponding 4 bands HaeII restriction digestion products (B).
    Haeii Restriction Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/haeii restriction enzyme/product/New England Biolabs
    Average 90 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    haeii restriction enzyme - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    99
    New England Biolabs avai
    Representative 2% agarose gel electrophoresis of spa gene <t>HaeII</t> restriction enzyme digestion <t>PCR</t> products, where M is DNA molecular size marker (100 bp ladder). (a) isolate 64 showing 2 bands spa gene PCR products (A) that remained uncut after (B) restriction, (b) isolate 1 showing single band spa gene PCR products (A) and the corresponding 3 bands HaeII restriction digestion pattern (B), and (c) isolate 62 showing 2 bands spa gene PCR products (A) and its corresponding 4 bands HaeII restriction digestion products (B).
    Avai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/avai/product/New England Biolabs
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    avai - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Representative 2% agarose gel electrophoresis of spa gene HaeII restriction enzyme digestion PCR products, where M is DNA molecular size marker (100 bp ladder). (a) isolate 64 showing 2 bands spa gene PCR products (A) that remained uncut after (B) restriction, (b) isolate 1 showing single band spa gene PCR products (A) and the corresponding 3 bands HaeII restriction digestion pattern (B), and (c) isolate 62 showing 2 bands spa gene PCR products (A) and its corresponding 4 bands HaeII restriction digestion products (B).

    Journal: International Journal of Microbiology

    Article Title: Molecular Typing of Methicillin Resistant Staphylococcus aureus Clinical Isolates on the Basis of Protein A and Coagulase Gene Polymorphisms

    doi: 10.1155/2014/650328

    Figure Lengend Snippet: Representative 2% agarose gel electrophoresis of spa gene HaeII restriction enzyme digestion PCR products, where M is DNA molecular size marker (100 bp ladder). (a) isolate 64 showing 2 bands spa gene PCR products (A) that remained uncut after (B) restriction, (b) isolate 1 showing single band spa gene PCR products (A) and the corresponding 3 bands HaeII restriction digestion pattern (B), and (c) isolate 62 showing 2 bands spa gene PCR products (A) and its corresponding 4 bands HaeII restriction digestion products (B).

    Article Snippet: A similarly designed study by Mitani et al. [ ] reported 8 spa and 6 coa types using HaeII restriction enzyme for coa and spa genes PCR-RFLP.

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Marker