bsrbi  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    BsrBI
    Description:
    BsrBI 5 000 units
    Catalog Number:
    R0102L
    Price:
    282
    Category:
    Restriction Enzymes
    Size:
    5 000 units
    Buy from Supplier


    Structured Review

    New England Biolabs bsrbi
    BsrBI
    BsrBI 5 000 units
    https://www.bioz.com/result/bsrbi/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bsrbi - by Bioz Stars, 2021-06
    95/100 stars

    Images

    1) Product Images from "High-throughput genotyping assays for identification of glycophorin B deletion variants in population studies"

    Article Title: High-throughput genotyping assays for identification of glycophorin B deletion variants in population studies

    Journal: Experimental Biology and Medicine

    doi: 10.1177/1535370220968545

    GYPB DEL1 (a) and DEL2 (b) assays on cell lines with known GYP States. PCR using the GYPB DEL1 (a) or DEL2 (b) primers was carried out on the samples followed by AciI or BsrBI restriction enzyme digestion, respectively. (a) DEL1 assay; The first seven wells (1–7) contain wild-type cell lines giving bands at 1.9 kb and 0.3 kb (V and W, respectively), five wells (11–15) contain homozygous cell-lines which give a single uncut band at 2.2 kb (U), while three cell-lines heterozygous for DEL1 (lanes 8–10) show two upper bands and one small band (2.3 kb [U], 1.9 kb [V], and 0.3 kb [W]). Lanes 16–19 are GYPB DEL2 positive cell lines that are all cut by the AciI enzyme (1.9 kb [V] and 0.3 kb [W]) indicating “normal” or non-DEL1. (b) GYPB DEL2 assay; The first seven wells (1–7) contain wild-type cell lines giving a single uncut band at 2.1 kb (X); lane (19) contains a GYPB DEL2 homozygous cell line giving two bands (1.3 kb [Y] and 0.8 kb [Z]); three wells (16–18) contain heterozygous cell-lines which give three bands (2.1 kb [X], 1.3 kb [Y], and 0.8 kb [Z]). Lanes 8–15 are DEL1 positive cell lines that are not cut by BsrBI indicating “normal” or non-DEL2.
    Figure Legend Snippet: GYPB DEL1 (a) and DEL2 (b) assays on cell lines with known GYP States. PCR using the GYPB DEL1 (a) or DEL2 (b) primers was carried out on the samples followed by AciI or BsrBI restriction enzyme digestion, respectively. (a) DEL1 assay; The first seven wells (1–7) contain wild-type cell lines giving bands at 1.9 kb and 0.3 kb (V and W, respectively), five wells (11–15) contain homozygous cell-lines which give a single uncut band at 2.2 kb (U), while three cell-lines heterozygous for DEL1 (lanes 8–10) show two upper bands and one small band (2.3 kb [U], 1.9 kb [V], and 0.3 kb [W]). Lanes 16–19 are GYPB DEL2 positive cell lines that are all cut by the AciI enzyme (1.9 kb [V] and 0.3 kb [W]) indicating “normal” or non-DEL1. (b) GYPB DEL2 assay; The first seven wells (1–7) contain wild-type cell lines giving a single uncut band at 2.1 kb (X); lane (19) contains a GYPB DEL2 homozygous cell line giving two bands (1.3 kb [Y] and 0.8 kb [Z]); three wells (16–18) contain heterozygous cell-lines which give three bands (2.1 kb [X], 1.3 kb [Y], and 0.8 kb [Z]). Lanes 8–15 are DEL1 positive cell lines that are not cut by BsrBI indicating “normal” or non-DEL2.

    Techniques Used: Polymerase Chain Reaction

    GYPB DEL1 (a) and DEL2 (b) assays on cell lines with known GYP states other than GYPB DEL1 and DEL2. PCR using the GYPB DEL1 (a) or DEL2 (b) primers was carried out on the samples followed by AciI or BsrBI restriction enzyme digestion, respectively. Lanes 22–24 are negative control wells. (a) DEL1 assay; 1.9 kb (V) and 0.8 kb (W) identify the bands expected for a non-DEL1 sample, and 2.2 kb (U) identifies the presence of GYPB DEL1. (b) GYPB DEL2 assay; 2.1 kb (X) band identifies a non-DEL2 sample, and the 1.3 kb (Y) plus 0.8 kb (Z) bands identify the presence of GYPB DEL2. See also Figure 4 . Sample designations identified from Leffler et al. 9
    Figure Legend Snippet: GYPB DEL1 (a) and DEL2 (b) assays on cell lines with known GYP states other than GYPB DEL1 and DEL2. PCR using the GYPB DEL1 (a) or DEL2 (b) primers was carried out on the samples followed by AciI or BsrBI restriction enzyme digestion, respectively. Lanes 22–24 are negative control wells. (a) DEL1 assay; 1.9 kb (V) and 0.8 kb (W) identify the bands expected for a non-DEL1 sample, and 2.2 kb (U) identifies the presence of GYPB DEL1. (b) GYPB DEL2 assay; 2.1 kb (X) band identifies a non-DEL2 sample, and the 1.3 kb (Y) plus 0.8 kb (Z) bands identify the presence of GYPB DEL2. See also Figure 4 . Sample designations identified from Leffler et al. 9

    Techniques Used: Polymerase Chain Reaction, Negative Control

    Schematic representation of strategies for amplifying and testing for the GYPB DEL1 and DEL2 structural variants. (a) Schematic representation of the alignment for the GYP SDUs showing the location of PCR primers (blue rectangles), putative breakpoint (gold rectangle), and AciI restriction site (yellow rectangle). The forward primer GYP_DEL1_F10 is specific to upstream of GYPE in the GYPE-GYPB region. The reverse primer GYPB_DEL1_R2B5 binds to the upstream of the GYPB gene in the GYB-GYPA region. In a normal or wild type individual, the GYPB_DEL1_R2B5 in the GYPE-GYPB region and the GYP_DEL1_F10 forward primer forms a PCR product made of sequences in the GYPE_GYPB region. In the GYPB DEL1 state, the PCR product formed is made of sequences in the GYPE and GYPA region because the GYPB is deleted. (b) Alternate schematic representation of the GYPB DEL1 RFLP assay showing a normal chromosome and the GYPB DEL1 chromosomes aligned. Genes (green, orange, and purple rectangles) and primers (blue rectangle) are indicated as well as the AciI restriction site and PCR-digestion fragment lengths. (c) Schematic representation of the alignment for the GYP SDUs showing the location of PCR primers, putative breakpoint (gold rectangle), and BsrBI restriction site (yellow rectangle). The forward primer GYP_DEL2_F3 is common to the GYPA downstream of the GYPB-GYPA region. The reverse primer GYPB_DEL2_R3 specifically binds to the upstream of the GYPE gene in the GYPE-GYPB region. In a normal or wild type individual, the GYPB_DEL2_F3 in the GYPB-GYPA region and the GYP_DEL2_R3 primer forms a PCR product made of sequences in the GYPB_GYPA region. In the GYPB DEL2 state, the PCR amplicon formed is made of sequences in the GYPE and GYPA region because the GYPB is deleted. (d) Alternate schematic of the GYPB DEL2 RFLP assay showing a normal chromosome and the GYPB DEL2 chromosomes aligned. Genes (green, orange, and purple rectangles) and primers (blue rectangle) are indicated as well as the BsrBI restriction site (red dotted rectangular area) and PCR-digestion fragment lengths. Coordinates of sequences are given with respect to GRCh38.
    Figure Legend Snippet: Schematic representation of strategies for amplifying and testing for the GYPB DEL1 and DEL2 structural variants. (a) Schematic representation of the alignment for the GYP SDUs showing the location of PCR primers (blue rectangles), putative breakpoint (gold rectangle), and AciI restriction site (yellow rectangle). The forward primer GYP_DEL1_F10 is specific to upstream of GYPE in the GYPE-GYPB region. The reverse primer GYPB_DEL1_R2B5 binds to the upstream of the GYPB gene in the GYB-GYPA region. In a normal or wild type individual, the GYPB_DEL1_R2B5 in the GYPE-GYPB region and the GYP_DEL1_F10 forward primer forms a PCR product made of sequences in the GYPE_GYPB region. In the GYPB DEL1 state, the PCR product formed is made of sequences in the GYPE and GYPA region because the GYPB is deleted. (b) Alternate schematic representation of the GYPB DEL1 RFLP assay showing a normal chromosome and the GYPB DEL1 chromosomes aligned. Genes (green, orange, and purple rectangles) and primers (blue rectangle) are indicated as well as the AciI restriction site and PCR-digestion fragment lengths. (c) Schematic representation of the alignment for the GYP SDUs showing the location of PCR primers, putative breakpoint (gold rectangle), and BsrBI restriction site (yellow rectangle). The forward primer GYP_DEL2_F3 is common to the GYPA downstream of the GYPB-GYPA region. The reverse primer GYPB_DEL2_R3 specifically binds to the upstream of the GYPE gene in the GYPE-GYPB region. In a normal or wild type individual, the GYPB_DEL2_F3 in the GYPB-GYPA region and the GYP_DEL2_R3 primer forms a PCR product made of sequences in the GYPB_GYPA region. In the GYPB DEL2 state, the PCR amplicon formed is made of sequences in the GYPE and GYPA region because the GYPB is deleted. (d) Alternate schematic of the GYPB DEL2 RFLP assay showing a normal chromosome and the GYPB DEL2 chromosomes aligned. Genes (green, orange, and purple rectangles) and primers (blue rectangle) are indicated as well as the BsrBI restriction site (red dotted rectangular area) and PCR-digestion fragment lengths. Coordinates of sequences are given with respect to GRCh38.

    Techniques Used: Polymerase Chain Reaction, RFLP Assay, Amplification

    2) Product Images from "Somatic Mosaicism for a Lethal TRPV4 Mutation Results in Non-Lethal Metatropic Dysplasia"

    Article Title: Somatic Mosaicism for a Lethal TRPV4 Mutation Results in Non-Lethal Metatropic Dysplasia

    Journal: American journal of medical genetics. Part A

    doi: 10.1002/ajmg.a.37942

    Somatic mosaicism for the TRPV4 mutation. (A) Ethidium bromide-stained 2% agarose gel showing BsrBI-cleaved PCR products containing TRPV4 exon 12. The p.L618P mutation created a BsrBI site which was detected in both the heterozygous lethal MD control,
    Figure Legend Snippet: Somatic mosaicism for the TRPV4 mutation. (A) Ethidium bromide-stained 2% agarose gel showing BsrBI-cleaved PCR products containing TRPV4 exon 12. The p.L618P mutation created a BsrBI site which was detected in both the heterozygous lethal MD control,

    Techniques Used: Mutagenesis, Staining, Agarose Gel Electrophoresis, Polymerase Chain Reaction

    Related Articles

    Plasmid Preparation:

    Article Title: Identification of an Intronic Splicing Enhancer Essential for the Inclusion of FGFR2 Exon IIIc * Exon IIIc * S⃞
    Article Snippet: In Vitro Splicing —For , the reactions for in vitro splicing experiments were performed as previously described ( ). .. Briefly, plasmid DNA containing the entire human β-globin sequence was digested with BsrBI (NEB) that cuts upstream of the T7 promoter and downstream of the gene. .. After purification by phenol/chloroform extraction and ethanol precipitation, 1 μg of the linearized template was used for each in vitro transcription reaction with T7 RNA polymerase (Ambion).

    Article Title: Taok2 Controls Behavioral Response to Ethanol in Mice
    Article Snippet: The Taok2tm1 targeting construct was generated using an approach similar to that reported by . .. Briefly, a C57BL/6J-derived bacterial artificial chromosome clone (RP23-142A14) comprising the Taok2 gene was obtained from Invitrogen (Carlsbad, CA, USA), digested with BamHI and BsrBI (New England Biolabs, Ipswich, MA, USA) and shotgun subcloned into the BamHI/SmaI sites of vector pBSDT-AII ( ). .. Plasmid-transformed E.coli colonies were screened by PCR using the following primers: forward: 5’GCTGAGGCTACCTCCTCCTT, reverse: 5’TGCTGCTTATGCAGTTGGAC to identify an 8.7 Kb genomic clone containing exons 1–7 of Taok2 and flanking intronic sequence.

    Sequencing:

    Article Title: Identification of an Intronic Splicing Enhancer Essential for the Inclusion of FGFR2 Exon IIIc * Exon IIIc * S⃞
    Article Snippet: In Vitro Splicing —For , the reactions for in vitro splicing experiments were performed as previously described ( ). .. Briefly, plasmid DNA containing the entire human β-globin sequence was digested with BsrBI (NEB) that cuts upstream of the T7 promoter and downstream of the gene. .. After purification by phenol/chloroform extraction and ethanol precipitation, 1 μg of the linearized template was used for each in vitro transcription reaction with T7 RNA polymerase (Ambion).

    Polymerase Chain Reaction:

    Article Title: Clinical response to non-surgical periodontal treatment in patients with interleukin-6 and interleukin-10 polymorphisms
    Article Snippet: .. The IL-6 polymorphism genotypes were determined by using the 5’-GGAGACGCCTTGAAGTAACTGC-3’ and 5’- GAGTTTCCTCTGACTCCATCGCAG-3’ primers to generate a PCR product of 163bp that was then digested with BsrBI (NEB) restriction enzyme. ..

    Article Title: Somatic Mosaicism for a Lethal TRPV4 Mutation Results in Non-Lethal Metatropic Dysplasia
    Article Snippet: The low frequency of reads with the mutation, combined with the decreased phenotypic severity, suggested that the affected individual might be a somatic mosaic for the variant. .. The p.L618P mutation created a BsrBI restriction endonuclease cleavage site so presence of the mutant allele in DNA from the proband was confirmed by PCR amplification TRPV4 exon 12 followed by cleavage with BsrBI (New England Biolabs). .. The primer sequences used for PCR were 5′-CACACTTATGCACCTGCAGACC-3′ and 5′-CCTATACATCATGGCTACTGTTCC-3′.

    Article Title: A Polymorphism in the Agouti Signaling Protein Gene Is Associated with Human Pigmentation
    Article Snippet: As an internal control that indicated incomplete or failed digestion, we added a known MC1R PCR product that contained a single, nonpolymorphic BsrB I recognition site that produced fragments 766 and 359 bp in size, after appropriate digestion. .. We digested 10 μl of ASIP PCR template and 2 μl of control MC1R PCR template with 3 μl of BsrB I (New England Biolabs), 2.5 μl of BsrB I buffer, and 7.5 μl of ddH2 0 for at least 4 h at 55°C. .. Genotyping was completed by visualization of banding patterns on a 3% agarose gel after ethidium bromide staining.

    Isolation:

    Article Title: Molecular characterization of a cellulose synthase gene (AaxmCesA1) isolated from an Acacia auriculiformis x Acacia mangium hybrid
    Article Snippet: .. Isolated genomic DNA was digested with six restriction enzymes: Bsr BI, Nru I, Hpa I, Bst Z17I, Fsp I and Sna BI (New England Biolabs, Hitchin, UK) to produce blunt-end fragments that were then ligated to genome walker adapter. .. Primary PCR was performed with primer CesAPr2, and then the 10x diluted primary PCR product was used as template for the secondary ‘nested’ PCR with primer CesANPr2.

    Mutagenesis:

    Article Title: Somatic Mosaicism for a Lethal TRPV4 Mutation Results in Non-Lethal Metatropic Dysplasia
    Article Snippet: The low frequency of reads with the mutation, combined with the decreased phenotypic severity, suggested that the affected individual might be a somatic mosaic for the variant. .. The p.L618P mutation created a BsrBI restriction endonuclease cleavage site so presence of the mutant allele in DNA from the proband was confirmed by PCR amplification TRPV4 exon 12 followed by cleavage with BsrBI (New England Biolabs). .. The primer sequences used for PCR were 5′-CACACTTATGCACCTGCAGACC-3′ and 5′-CCTATACATCATGGCTACTGTTCC-3′.

    Amplification:

    Article Title: Somatic Mosaicism for a Lethal TRPV4 Mutation Results in Non-Lethal Metatropic Dysplasia
    Article Snippet: The low frequency of reads with the mutation, combined with the decreased phenotypic severity, suggested that the affected individual might be a somatic mosaic for the variant. .. The p.L618P mutation created a BsrBI restriction endonuclease cleavage site so presence of the mutant allele in DNA from the proband was confirmed by PCR amplification TRPV4 exon 12 followed by cleavage with BsrBI (New England Biolabs). .. The primer sequences used for PCR were 5′-CACACTTATGCACCTGCAGACC-3′ and 5′-CCTATACATCATGGCTACTGTTCC-3′.

    Ethanol Precipitation:

    Article Title: MutSβ promotes trinucleotide repeat expansion by recruiting DNA polymerase β to nascent (CAG)n or (CTG)n hairpins for error-prone DNA synthesis
    Article Snippet: Hairpin removal/retention assay was performed by incubating DNA substrates (0.15 pmol) with either HeLa nuclear extracts (30 μg) or purified proteins (260 fmol Polβ, 1-8 pmol MutSβ, 600 fmol Polδ, 110 fmol RFC and 2 pmol PCNA) in a 40-μL reaction containing 110 mM KCl, 20 mM Tris-HCl (pH 7.6), 5 mM MgCl2 , 1 mM glutathione, 1.5 mM ATP, 0.1 mM of each dNTP, and 0.05 mg/mL BSA at 37 °C for 30 min. .. The reaction was terminated by incubating with 60 μL of proteinase K solution containing 0.67% (w/v) of SDS, 2.5 mM EDTA and 20 mg/mL proteinase K. After phenol extraction and ethanol precipitation, the DNA sample was digested with 0.3 units of Bsr BI (New England Biolab) and resolved in a 6% polyacrylamide denaturing gel, followed by Southern blotting analysis using a 32 P-end-labeled probe specifically annealing to the newly synthesized strand near the Bsr BI site as described . .. Gel shift analysis 32 P-labeled oligonucleotides containing 15 CAG and 15 CTG repeats were annealed with oligonucleotides containing 10 CTG and 10 CAG repeat to form (CAG)5 and (CTG)5 hairpin substrates , respectively.

    Southern Blot:

    Article Title: MutSβ promotes trinucleotide repeat expansion by recruiting DNA polymerase β to nascent (CAG)n or (CTG)n hairpins for error-prone DNA synthesis
    Article Snippet: Hairpin removal/retention assay was performed by incubating DNA substrates (0.15 pmol) with either HeLa nuclear extracts (30 μg) or purified proteins (260 fmol Polβ, 1-8 pmol MutSβ, 600 fmol Polδ, 110 fmol RFC and 2 pmol PCNA) in a 40-μL reaction containing 110 mM KCl, 20 mM Tris-HCl (pH 7.6), 5 mM MgCl2 , 1 mM glutathione, 1.5 mM ATP, 0.1 mM of each dNTP, and 0.05 mg/mL BSA at 37 °C for 30 min. .. The reaction was terminated by incubating with 60 μL of proteinase K solution containing 0.67% (w/v) of SDS, 2.5 mM EDTA and 20 mg/mL proteinase K. After phenol extraction and ethanol precipitation, the DNA sample was digested with 0.3 units of Bsr BI (New England Biolab) and resolved in a 6% polyacrylamide denaturing gel, followed by Southern blotting analysis using a 32 P-end-labeled probe specifically annealing to the newly synthesized strand near the Bsr BI site as described . .. Gel shift analysis 32 P-labeled oligonucleotides containing 15 CAG and 15 CTG repeats were annealed with oligonucleotides containing 10 CTG and 10 CAG repeat to form (CAG)5 and (CTG)5 hairpin substrates , respectively.

    Synthesized:

    Article Title: MutSβ promotes trinucleotide repeat expansion by recruiting DNA polymerase β to nascent (CAG)n or (CTG)n hairpins for error-prone DNA synthesis
    Article Snippet: Hairpin removal/retention assay was performed by incubating DNA substrates (0.15 pmol) with either HeLa nuclear extracts (30 μg) or purified proteins (260 fmol Polβ, 1-8 pmol MutSβ, 600 fmol Polδ, 110 fmol RFC and 2 pmol PCNA) in a 40-μL reaction containing 110 mM KCl, 20 mM Tris-HCl (pH 7.6), 5 mM MgCl2 , 1 mM glutathione, 1.5 mM ATP, 0.1 mM of each dNTP, and 0.05 mg/mL BSA at 37 °C for 30 min. .. The reaction was terminated by incubating with 60 μL of proteinase K solution containing 0.67% (w/v) of SDS, 2.5 mM EDTA and 20 mg/mL proteinase K. After phenol extraction and ethanol precipitation, the DNA sample was digested with 0.3 units of Bsr BI (New England Biolab) and resolved in a 6% polyacrylamide denaturing gel, followed by Southern blotting analysis using a 32 P-end-labeled probe specifically annealing to the newly synthesized strand near the Bsr BI site as described . .. Gel shift analysis 32 P-labeled oligonucleotides containing 15 CAG and 15 CTG repeats were annealed with oligonucleotides containing 10 CTG and 10 CAG repeat to form (CAG)5 and (CTG)5 hairpin substrates , respectively.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs bsrbi
    GYPB DEL1 (a) and DEL2 (b) assays on cell lines with known GYP States. PCR using the GYPB DEL1 (a) or DEL2 (b) primers was carried out on the samples followed by <t>AciI</t> or <t>BsrBI</t> restriction enzyme digestion, respectively. (a) DEL1 assay; The first seven wells (1–7) contain wild-type cell lines giving bands at 1.9 kb and 0.3 kb (V and W, respectively), five wells (11–15) contain homozygous cell-lines which give a single uncut band at 2.2 kb (U), while three cell-lines heterozygous for DEL1 (lanes 8–10) show two upper bands and one small band (2.3 kb [U], 1.9 kb [V], and 0.3 kb [W]). Lanes 16–19 are GYPB DEL2 positive cell lines that are all cut by the AciI enzyme (1.9 kb [V] and 0.3 kb [W]) indicating “normal” or non-DEL1. (b) GYPB DEL2 assay; The first seven wells (1–7) contain wild-type cell lines giving a single uncut band at 2.1 kb (X); lane (19) contains a GYPB DEL2 homozygous cell line giving two bands (1.3 kb [Y] and 0.8 kb [Z]); three wells (16–18) contain heterozygous cell-lines which give three bands (2.1 kb [X], 1.3 kb [Y], and 0.8 kb [Z]). Lanes 8–15 are DEL1 positive cell lines that are not cut by BsrBI indicating “normal” or non-DEL2.
    Bsrbi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsrbi/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bsrbi - by Bioz Stars, 2021-06
    95/100 stars
      Buy from Supplier

    Image Search Results


    GYPB DEL1 (a) and DEL2 (b) assays on cell lines with known GYP States. PCR using the GYPB DEL1 (a) or DEL2 (b) primers was carried out on the samples followed by AciI or BsrBI restriction enzyme digestion, respectively. (a) DEL1 assay; The first seven wells (1–7) contain wild-type cell lines giving bands at 1.9 kb and 0.3 kb (V and W, respectively), five wells (11–15) contain homozygous cell-lines which give a single uncut band at 2.2 kb (U), while three cell-lines heterozygous for DEL1 (lanes 8–10) show two upper bands and one small band (2.3 kb [U], 1.9 kb [V], and 0.3 kb [W]). Lanes 16–19 are GYPB DEL2 positive cell lines that are all cut by the AciI enzyme (1.9 kb [V] and 0.3 kb [W]) indicating “normal” or non-DEL1. (b) GYPB DEL2 assay; The first seven wells (1–7) contain wild-type cell lines giving a single uncut band at 2.1 kb (X); lane (19) contains a GYPB DEL2 homozygous cell line giving two bands (1.3 kb [Y] and 0.8 kb [Z]); three wells (16–18) contain heterozygous cell-lines which give three bands (2.1 kb [X], 1.3 kb [Y], and 0.8 kb [Z]). Lanes 8–15 are DEL1 positive cell lines that are not cut by BsrBI indicating “normal” or non-DEL2.

    Journal: Experimental Biology and Medicine

    Article Title: High-throughput genotyping assays for identification of glycophorin B deletion variants in population studies

    doi: 10.1177/1535370220968545

    Figure Lengend Snippet: GYPB DEL1 (a) and DEL2 (b) assays on cell lines with known GYP States. PCR using the GYPB DEL1 (a) or DEL2 (b) primers was carried out on the samples followed by AciI or BsrBI restriction enzyme digestion, respectively. (a) DEL1 assay; The first seven wells (1–7) contain wild-type cell lines giving bands at 1.9 kb and 0.3 kb (V and W, respectively), five wells (11–15) contain homozygous cell-lines which give a single uncut band at 2.2 kb (U), while three cell-lines heterozygous for DEL1 (lanes 8–10) show two upper bands and one small band (2.3 kb [U], 1.9 kb [V], and 0.3 kb [W]). Lanes 16–19 are GYPB DEL2 positive cell lines that are all cut by the AciI enzyme (1.9 kb [V] and 0.3 kb [W]) indicating “normal” or non-DEL1. (b) GYPB DEL2 assay; The first seven wells (1–7) contain wild-type cell lines giving a single uncut band at 2.1 kb (X); lane (19) contains a GYPB DEL2 homozygous cell line giving two bands (1.3 kb [Y] and 0.8 kb [Z]); three wells (16–18) contain heterozygous cell-lines which give three bands (2.1 kb [X], 1.3 kb [Y], and 0.8 kb [Z]). Lanes 8–15 are DEL1 positive cell lines that are not cut by BsrBI indicating “normal” or non-DEL2.

    Article Snippet: Restriction enzymes AciI (Catalog number: R0551L, NEB, UK) and BsrBI (Catalog number: R0102L, NEB, UK) were purchased ( ).

    Techniques: Polymerase Chain Reaction

    GYPB DEL1 (a) and DEL2 (b) assays on cell lines with known GYP states other than GYPB DEL1 and DEL2. PCR using the GYPB DEL1 (a) or DEL2 (b) primers was carried out on the samples followed by AciI or BsrBI restriction enzyme digestion, respectively. Lanes 22–24 are negative control wells. (a) DEL1 assay; 1.9 kb (V) and 0.8 kb (W) identify the bands expected for a non-DEL1 sample, and 2.2 kb (U) identifies the presence of GYPB DEL1. (b) GYPB DEL2 assay; 2.1 kb (X) band identifies a non-DEL2 sample, and the 1.3 kb (Y) plus 0.8 kb (Z) bands identify the presence of GYPB DEL2. See also Figure 4 . Sample designations identified from Leffler et al. 9

    Journal: Experimental Biology and Medicine

    Article Title: High-throughput genotyping assays for identification of glycophorin B deletion variants in population studies

    doi: 10.1177/1535370220968545

    Figure Lengend Snippet: GYPB DEL1 (a) and DEL2 (b) assays on cell lines with known GYP states other than GYPB DEL1 and DEL2. PCR using the GYPB DEL1 (a) or DEL2 (b) primers was carried out on the samples followed by AciI or BsrBI restriction enzyme digestion, respectively. Lanes 22–24 are negative control wells. (a) DEL1 assay; 1.9 kb (V) and 0.8 kb (W) identify the bands expected for a non-DEL1 sample, and 2.2 kb (U) identifies the presence of GYPB DEL1. (b) GYPB DEL2 assay; 2.1 kb (X) band identifies a non-DEL2 sample, and the 1.3 kb (Y) plus 0.8 kb (Z) bands identify the presence of GYPB DEL2. See also Figure 4 . Sample designations identified from Leffler et al. 9

    Article Snippet: Restriction enzymes AciI (Catalog number: R0551L, NEB, UK) and BsrBI (Catalog number: R0102L, NEB, UK) were purchased ( ).

    Techniques: Polymerase Chain Reaction, Negative Control

    Schematic representation of strategies for amplifying and testing for the GYPB DEL1 and DEL2 structural variants. (a) Schematic representation of the alignment for the GYP SDUs showing the location of PCR primers (blue rectangles), putative breakpoint (gold rectangle), and AciI restriction site (yellow rectangle). The forward primer GYP_DEL1_F10 is specific to upstream of GYPE in the GYPE-GYPB region. The reverse primer GYPB_DEL1_R2B5 binds to the upstream of the GYPB gene in the GYB-GYPA region. In a normal or wild type individual, the GYPB_DEL1_R2B5 in the GYPE-GYPB region and the GYP_DEL1_F10 forward primer forms a PCR product made of sequences in the GYPE_GYPB region. In the GYPB DEL1 state, the PCR product formed is made of sequences in the GYPE and GYPA region because the GYPB is deleted. (b) Alternate schematic representation of the GYPB DEL1 RFLP assay showing a normal chromosome and the GYPB DEL1 chromosomes aligned. Genes (green, orange, and purple rectangles) and primers (blue rectangle) are indicated as well as the AciI restriction site and PCR-digestion fragment lengths. (c) Schematic representation of the alignment for the GYP SDUs showing the location of PCR primers, putative breakpoint (gold rectangle), and BsrBI restriction site (yellow rectangle). The forward primer GYP_DEL2_F3 is common to the GYPA downstream of the GYPB-GYPA region. The reverse primer GYPB_DEL2_R3 specifically binds to the upstream of the GYPE gene in the GYPE-GYPB region. In a normal or wild type individual, the GYPB_DEL2_F3 in the GYPB-GYPA region and the GYP_DEL2_R3 primer forms a PCR product made of sequences in the GYPB_GYPA region. In the GYPB DEL2 state, the PCR amplicon formed is made of sequences in the GYPE and GYPA region because the GYPB is deleted. (d) Alternate schematic of the GYPB DEL2 RFLP assay showing a normal chromosome and the GYPB DEL2 chromosomes aligned. Genes (green, orange, and purple rectangles) and primers (blue rectangle) are indicated as well as the BsrBI restriction site (red dotted rectangular area) and PCR-digestion fragment lengths. Coordinates of sequences are given with respect to GRCh38.

    Journal: Experimental Biology and Medicine

    Article Title: High-throughput genotyping assays for identification of glycophorin B deletion variants in population studies

    doi: 10.1177/1535370220968545

    Figure Lengend Snippet: Schematic representation of strategies for amplifying and testing for the GYPB DEL1 and DEL2 structural variants. (a) Schematic representation of the alignment for the GYP SDUs showing the location of PCR primers (blue rectangles), putative breakpoint (gold rectangle), and AciI restriction site (yellow rectangle). The forward primer GYP_DEL1_F10 is specific to upstream of GYPE in the GYPE-GYPB region. The reverse primer GYPB_DEL1_R2B5 binds to the upstream of the GYPB gene in the GYB-GYPA region. In a normal or wild type individual, the GYPB_DEL1_R2B5 in the GYPE-GYPB region and the GYP_DEL1_F10 forward primer forms a PCR product made of sequences in the GYPE_GYPB region. In the GYPB DEL1 state, the PCR product formed is made of sequences in the GYPE and GYPA region because the GYPB is deleted. (b) Alternate schematic representation of the GYPB DEL1 RFLP assay showing a normal chromosome and the GYPB DEL1 chromosomes aligned. Genes (green, orange, and purple rectangles) and primers (blue rectangle) are indicated as well as the AciI restriction site and PCR-digestion fragment lengths. (c) Schematic representation of the alignment for the GYP SDUs showing the location of PCR primers, putative breakpoint (gold rectangle), and BsrBI restriction site (yellow rectangle). The forward primer GYP_DEL2_F3 is common to the GYPA downstream of the GYPB-GYPA region. The reverse primer GYPB_DEL2_R3 specifically binds to the upstream of the GYPE gene in the GYPE-GYPB region. In a normal or wild type individual, the GYPB_DEL2_F3 in the GYPB-GYPA region and the GYP_DEL2_R3 primer forms a PCR product made of sequences in the GYPB_GYPA region. In the GYPB DEL2 state, the PCR amplicon formed is made of sequences in the GYPE and GYPA region because the GYPB is deleted. (d) Alternate schematic of the GYPB DEL2 RFLP assay showing a normal chromosome and the GYPB DEL2 chromosomes aligned. Genes (green, orange, and purple rectangles) and primers (blue rectangle) are indicated as well as the BsrBI restriction site (red dotted rectangular area) and PCR-digestion fragment lengths. Coordinates of sequences are given with respect to GRCh38.

    Article Snippet: Restriction enzymes AciI (Catalog number: R0551L, NEB, UK) and BsrBI (Catalog number: R0102L, NEB, UK) were purchased ( ).

    Techniques: Polymerase Chain Reaction, RFLP Assay, Amplification

    Somatic mosaicism for the TRPV4 mutation. (A) Ethidium bromide-stained 2% agarose gel showing BsrBI-cleaved PCR products containing TRPV4 exon 12. The p.L618P mutation created a BsrBI site which was detected in both the heterozygous lethal MD control,

    Journal: American journal of medical genetics. Part A

    Article Title: Somatic Mosaicism for a Lethal TRPV4 Mutation Results in Non-Lethal Metatropic Dysplasia

    doi: 10.1002/ajmg.a.37942

    Figure Lengend Snippet: Somatic mosaicism for the TRPV4 mutation. (A) Ethidium bromide-stained 2% agarose gel showing BsrBI-cleaved PCR products containing TRPV4 exon 12. The p.L618P mutation created a BsrBI site which was detected in both the heterozygous lethal MD control,

    Article Snippet: The p.L618P mutation created a BsrBI restriction endonuclease cleavage site so presence of the mutant allele in DNA from the proband was confirmed by PCR amplification TRPV4 exon 12 followed by cleavage with BsrBI (New England Biolabs).

    Techniques: Mutagenesis, Staining, Agarose Gel Electrophoresis, Polymerase Chain Reaction

    MutSβ promotes (CAG) n or (CTG) n hairpin retention synthesis in HeLa nuclear extracts. (A) Diagram of hairpin removal/retention assay by Southern blot analysis. The purple bar shows the 32 P-labeled oligonucleotide probe, which specifically anneals to the newly synthesized strand near the Bsr BI site. The complete primer sequence of a CTG hairpin substrate used in this study is also shown. (B) Southern blot analysis showing the effect of MutSβ on (CAG) 5 or (CTG) 5 hairpin retention/removal during DNA synthesis in HeLa nuclear extracts. DNA hairpin substrate (0.15 pmol) was incubated with limited amount (30 μg) of HeLa nuclear extracts in the presence of increasing amounts of purified MutSβ. The resulting products were examined by Southern blot analysis. (C , D) Quantification of hairpin-retained products and hairpin-removed products shown in B , respectively. The data were from three independent experiments and the error bar represents SD.

    Journal: Cell Research

    Article Title: MutSβ promotes trinucleotide repeat expansion by recruiting DNA polymerase β to nascent (CAG)n or (CTG)n hairpins for error-prone DNA synthesis

    doi: 10.1038/cr.2016.66

    Figure Lengend Snippet: MutSβ promotes (CAG) n or (CTG) n hairpin retention synthesis in HeLa nuclear extracts. (A) Diagram of hairpin removal/retention assay by Southern blot analysis. The purple bar shows the 32 P-labeled oligonucleotide probe, which specifically anneals to the newly synthesized strand near the Bsr BI site. The complete primer sequence of a CTG hairpin substrate used in this study is also shown. (B) Southern blot analysis showing the effect of MutSβ on (CAG) 5 or (CTG) 5 hairpin retention/removal during DNA synthesis in HeLa nuclear extracts. DNA hairpin substrate (0.15 pmol) was incubated with limited amount (30 μg) of HeLa nuclear extracts in the presence of increasing amounts of purified MutSβ. The resulting products were examined by Southern blot analysis. (C , D) Quantification of hairpin-retained products and hairpin-removed products shown in B , respectively. The data were from three independent experiments and the error bar represents SD.

    Article Snippet: The reaction was terminated by incubating with 60 μL of proteinase K solution containing 0.67% (w/v) of SDS, 2.5 mM EDTA and 20 mg/mL proteinase K. After phenol extraction and ethanol precipitation, the DNA sample was digested with 0.3 units of Bsr BI (New England Biolab) and resolved in a 6% polyacrylamide denaturing gel, followed by Southern blotting analysis using a 32 P-end-labeled probe specifically annealing to the newly synthesized strand near the Bsr BI site as described .

    Techniques: CTG Assay, Southern Blot, Labeling, Synthesized, Sequencing, DNA Synthesis, Incubation, Purification